Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Size: px

Start display at page:

Download "Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation"

Brent Anderson
5 years ago
Views:

1 Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of C7BL/6J (WT) mice Supplemental Table. EAE clinical parameters of f S1PR1(SA) mice Supplemental Table 3. EAE clinical parameters of WT T H 17-adoptive transferred WT mice Supplemental Table. EAE clinical parameters of S1PR1(SA) T H 17 transferred WT mice Supplemental Table. EAE clinical parameters of WT T H 1-adoptive transferred WT mice Supplemental Table 6. EAE clinical parameters of S1PR1(SA) T H 1 transferred WT mice Supplemental Table 7. EAE clinical parameters of S1PR1(SA) mice with anti-ccr6 antibody treatment Supplemental Table 8. Primers for SYBRGreen quantitative PCR Supplemental Figure 1. The expression of S1P receptors in splenic CD + T cells Supplemental Figure. EAE disease incidence of WT and S1PR1(SA) mice following Supplemental FTY7 treatment Supplemental Figure 3. Splenic lymphocyte counts in WT and S1PR1(SA) EAE mice Supplemental Figure. Gating strategy of CNS immune cells by multi-dimensional flow cytometry Supplemental Figure. The profile of CNS-infiltrating lymphocytes in WT and S1PR1(SA) EAE mice Supplemental Figure 6. The profile of CNS-infiltrating myeloid cells in WT and S1PR1(SA) EAE mice

2 Supplemental Figure 7. S1PR1(SA) mice with established EAE were refractory to FTY7 treatment. Supplemental Figure 8. The functions of CNS-infiltrating T H cells in WT and S1PR1(SA) EAE mice Supplemental Figure 9. The expression of FOXP3 and IFNγ in CNS-infiltrating CD + CCR6 + T lymphocytes Supplemental Figure 1. FTY7 suppressed CCR6 + cell generation both in vivo and in vitro. Supplemental Figure 11. Control IgG had no significant effects on the improvement of EAE clinical score.

3 Supplemental Table 1. EAE clinical parameters of C7BL/6J (WT) mice following immunization with MOG 3- peptide. WT (C7BL6/J) Vehicle WT (C7BL6/J) FTY7 p Value Incidence 1% (1/1) % (/1).1 Onset (days after immunization) 1 ±. 17 ± Maximum score 3. ± ±.. Score at Peak EAE.7 ±.67.7 ± C.D.I ±.3 7.±9.9. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index. Supplemental Table. EAE clinical parameters of f S1PR1(SA) mice following immunization with MOG 3- peptide. S1PR1(SA) Vehicle S1PR1(SA) FTY7 p Value Incidence 1%(1/1) 83% (1/1) n.s. Onset (days after immunization) 13 ±1.9 1 ±.7 n.s. Maximum score 3.9 ±.9.6 ± Score at Peak EAE 3. ±.8. ± C.D.I..8± ±.3.39 p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index.

4 Supplemental Table 3. EAE clinical parameters of C7BL/6J (WT) mice following adoptive transfer of IL-3-polarized (T H 17) WT splenocytes. WT T H 17 WT T H 17 Vehicle FTY7 p value Incidence 8/1(8%) 6% (6/1) n.s. Onset (days post transfer) 9.6 ± ± Maximum score. ± ± 1.1 n.s. Score at Peak EAE. ± ±1. n.s. C.D.I. 39.7± ±.8. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index. Supplemental Table. EAE clinical parameters of S1PR1(SA) mice following adoptive transfer of IL-3-polarized (T H 17) S1PR1(SA) splenocytes. S1PR1(SA)T H 17 S1PR1(SA)T H 17 Vehicle FTY7 p value Incidence 73% (11/1) 87% (13/1) n.s. Onset (days post transfer) 8.9 ± ± Maximum score 3.1 ±. 3.± 1.1 n.s. Score at Peak EAE.7 ± ±1.3 n.s. C.D.I. 6. ± ± n.s. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index.

5 Supplemental Table. EAE clinical parameters of C7BL/6J (WT) mice following adoptive transfer of IL-1-polarized (T H 1) WT splenocytes. WT T H 1 WT T H 1 Vehicle FTY7 p value Incidence 6% (6/1) %(/1) n.s. Onset (days post transfer) 1 ± ± 9.87 n.s. Maximum score 1.3 ± ± 1. n.s. Score at Peak EAE 1. ±1.1.8±1.3 n.s. C.D.I. 17.7± ± 1.31 n.s. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index. Supplemental Table 6. EAE clinical parameters of S1PR1(SA) mice following adoptive transfer of IL-1-polarized (T H 1) S1PR1(SA) splenocytes. S1PR1(SA)T H 1 S1PR1(SA)T H 1 Vehicle FTY7 p value Incidence 3% (8/1) 67% (1/1) n.s. Onset (days post transfer) 1. ± ± 3.88 n.s. Maximum score 1. ± ± 1. n.s. Score at Peak EAE 1.3 ±1. 1. ±1.1 n.s. C.D.I. 17. ± ±.37 n.s. p<., Mann-Whitney U-test. Experiment repeated three times, n=1/arm. C.D.I.=Cumulative disease index.

6 Supplemental Table 7. EAE clinical parameters of S1PR1(SA) mice following immunization with MOG 3- peptide and FTY7 treatment. S1PR1(SA) FTY7 treatment p value Control IgG Anti-CCR6 Incidence 1% (7/7) 8% (6/7) n.s. Onset (days after immunization) 1 ± ± Maximum score.9 ±.69.1 ± 1.3 n.s. Score at Peak EAE.9 ±.69.1 ± 1.3 n.s. C.D.I. ±. 1 ± Control IgG and Anti-CCR6 mab (1µg per mice) were administrated twice as indicated. p<., Mann-Whitney U-test. n=7/arm. C.D.I.=Cumulative disease index. Supplemental Table 8. Primers for SYBRGreen quantitative PCR (synthesized in Stanford PAN Facility) Transcript Forward primer Reverse primer Il17a TACCTCAACCGTTCCACGTC TTTCCCTCCGCATTGACACA S1pr1 GTGTAGACCCAGAGTCCTGCG AGCTTTTCCTTGGCTGGAGAG S1pr CCAAGGAGACGCTGGACATG TGCCGTAGAGCTTGACCTTG S1pr3 GCAACTTGGCTCTCTGCGAC GACGATGGTCACCAGAATGG S1pr GTGTATGGCTGCATCGGTCTGTG GGATTAATGGCTGAGTTGAACACG S1pr GTGGCGCTCGCCGCGTCGGTG GAAGGTGTAGATGATGGGATTCAG

7 Supplemental Figure 1 Relative Abundance S1pr1 WT p=. S1PR1(SA) Relative Abundance S1pr WT p=.9 S1PR1(SA) Relative Abundance S1pr3 WT p=.9 S1PR1(SA) Relative Abundance S1pr WT p=.31 S1PR1(SA) Relative Abundance S1pr WT p=.9 S1PR1(SA) Relative RNA expression of S1P receptors in splenic CD + T cells from naïve WT (C7BL/6J) and S1PR1(SA) mice. Total RNA was isolated from splenic CD + T cells and analyzed by SYBRGreen quantitative PCR. Data was normalized with RNA expression of β- actin (n= per group, Mean± SEM, p<., -tailed Student s t-test).

8 Supplemental Figure % Incidence of EAE Time after immunization (d) S1PR1(SA) mice showed higher incidence and early onset of EAE compared to C7BL/6J (WT) mice following FTY7 treatment. MOG 3- -immunized C7BL/6J (WT) and mice carrying phosphorylation defective S1PR1 (S1PR1(SA)) (females, 8-1 weeks) were treated with either vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily intraperitoneal injections. Mice were followed clinically throughout EAE disease course. n= 1-1 mice/arm.

9 Supplemental Figure 3 A B C D E CD3 + CD + CD8 + [ 3 H] thymidine incorporation (1 c.p.m) MOG (µg/ml) Cell number ( 1 7 ) 6 Cell number ( 1 7 ) 3 1 Cell number ( 1 7 ) Cell number ( 1 7 ) 8 6 CD11b + F G H I J IL17A + IFNγ + FOXP3 + IFNγ + IL17A + Cell number ( 1 ) 8 6 Cell number ( 1 ) 3 1 Cell number ( 1 ) 1 1 Cell number ( 1 ) 1 1 Relative Abundance Il17a FTY7 treatment decreased lymphocyte counts in the spleens of both WT and S1PR1(SA) EAE mice. MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) at the day of immunization by daily i.p injection. Splenocytes were isolated at D8 post-immunization. (A) Immune cells proliferation in response to ex vivo MOG 3- reactivation was measured by [ 3 H] thymidine incorporation (c.p.m., counts per minute). The numbers of CD3 + (B), CD + (C), CD8 + (D), and CD11b + (E) cells were quantified by flow cytometry. The cell number was calculated by multiplying the total viable cell number of splenocytes by the percentage of gated cells. Cells were stimulated with PMA (ng/ml) and ionomycin (ng/ml) for h and intracellular staining was performed to measure IL-17A (F, I), IFN-γ (G, I), and FOXP3 (H) expression among CD + T cells. CD + T cells were isolated from splenocytes of MOG 3- -immunized EAE mice at D8. The expression of IL-17A RNA transcripts (J) in the CD + T cells was analyzed by SyBrGreen quantitative PCR and normalized to β-actin. (n= per group, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

Supplemental Figure A B C D E F G H I J Gating strategy of CNS immune cells by multi-dimensional flow cytometry (A) CD low and CD hi cells were gated from live leukocytes.

CD low cells were gated to microglia cells (CDl o CD11b + ) (D).

10 Supplemental Figure A B C D E F G H I J Gating strategy of CNS immune cells by multi-dimensional flow cytometry (A) CD low and CD hi cells were gated from live leukocytes. CD hi cells were gated to CNSinfiltrating myeloid cells (CD hi CD11b + ) and CD3 + cells (B). CD3 + cells were then gated to CD + and CD8 + T cells (C). CD low cells were gated to microglia cells (CDl o CD11b + ) (D). Infiltrating myeloid cells (CD hi CD11b + ) were further gated to neutrophils/monocytes (CD hi CD11b + Gr1 + ) (E), dendritic cells (CD hi CD11b + CD11c + ) (F), eosinophils (CD hi CD11b + SiglecF + ) (G). The effector functions of CD + T cells were gated by CCR6, IL- 17A, IFN-γ, and FOXP3 markers (H-J).

11 Supplemental Figure A B C CD hi CD3 + Cell number ( 1 ) 1 1 Cell number ( 1 ) 8 6 Cell number ( 1 ) CD + 6 D Cell number ( 1 ) CD8 + E % of total cells 8 6 CD8 + The profile and cell counts of CNS-infiltrating lymphocytes in WT and S1PR1(SA) EAE mice MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections. Immune cells from the brains and spinal cords were collected when EAE clinical scores reached -3. Numbers of CD hi (A), CD3 + (B), CD + (C), CD8 + (D) cells and percentage of CD8 + (E) cells were quantified by flow cytometrty. The cell number was calculated by multiplying the total viable cell number of splenocytes by the percentage of gated cells. Data represent three independent experiments (n, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

12 Supplemental Figure 6 A B C D E % of total cells CD hi CD11b + 6 % of total cells CD lo CD11b + % of total cells CD11b + CD11c % of total cells 3 1 CD11b + Gr1 + % of total cells CD11b + SiglecF + 6 F G H I J Cell number ( 1 ) 1 1 CD hi CD11b + Cell number ( 1 ) CD lo CD11b Cell number ( 1 ) CD11b + CD11c Cell number ( 1 ) 3 1 CD11b + Gr1 + Cell number ( 1 ) CD11b + SiglecF The profile and number of CNS-infiltrating myeloid cells in C7BL/6J (WT) and S1PR1(SA) EAE mice MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections. Immune cells from the brains and spinal cords were collected when EAE clinical scores reached -3. The percentage and number of CNS-infiltrating myeloid cells (CD hi CD11b + ) (A, F), microglia cells (CD lo CD11b + ) (B, G), dendritic cells (CD hi CD11b + CD11c + ) (C, H), monocytes/neutrophils (CD hi CD11b + Gr1 + ) (D, I), and eosinophils (CD hi CD11b + SiglecF + ) (E, J) were quantified by flow cytometry. The cell number was calculated by multiplying the total viable cell number of cells by percentage of gated cells. Data represent three independent experiments (n, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

13 Supplemental Figure 7 A Mean clinical score Time after immunization (d) B C D E % of total CD + cells IL17A + % of total CD + cells 1 1 IFNγ + % of total CD + cells 1 1 FOXP3 + % of total CD + cells 1 1 CCR6 + S1PR1(SA) mice with established EAE were refractory to FTY7 treatment. (A) Mean clinical score of MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) mice (females, 8-1 weeks) treated with either vehicle (1% cyclodextrin in PBS ) or FTY7 (.mg/kg) by daily i.p. injections when mice first displayed an EAE clinical score of. Arrows (!WT and! S1PR1(SA)) indicate the time of initiation of therapy. p<., Mann-Whitney U-test. This experiment was performed times with n= 9-1 mice/ arm. (B-E) MOG 3- - immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) at the day of immunization by daily i.p. injections. Immune cells from the spleen were collected when EAE clinical scores reached -3. Cells were stimulated with PMA ( ng/ml) and ionomycin ( ng/ml) for h and intracellular staining was performed to measure the expression of IL-17A (B), IFN- γ (C), FOXP3 (D) and CCR6 (E) among CD + T cells. This experiment was performed three times with n mice/ arm, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test.

14 Supplemental Figure 8 A B C Cell number ( 1 3 ) 3 1 IL17A + Cell number ( 1 3 ) 6 IFNγ + Cell number ( 1 3 ) FOXP3 + The functions and cell counts of CNS-infiltrating T H cells in WT and S1PR1(SA) EAE mice MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections. Immune cells from the brains and spinal cords were collected when EAE clinical scores reached -3. Cells were stimulated with PMA ( ng/ml) and ionomycin ( ng/ml) for h and intracellular staining was performed to measure the expression of IL-17A (A), IFN- γ (B), and FOXP3 (C) among CD + T cells. The cell number was calculated by multiplying the total viable cell number of cells by percentage of gated cells. Data represent three independent experiments (n 6, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

15 Supplemental Figure 9 A B % of total CCR6 + cells 1 1 FOXP3 + % of total CCR6 + cells 1 1 IFNγ + The percentage of FOXP3-positive and IFNγ-positive cells among CCR6-positive CNSinfiltrating CD T lymphocytes MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections at the day of immunization. Immune cells from the brains and spinal cords were collected when mice display an EAE score of to 3. CNS immune cells were re-stimulated with PMA ( ng/ml) and ionomycin ( ng/ml) for h and then cells were labeled with antibodies against CD, CCR6, IFN-γ, and FOXP3 antibodies. Percentage of FOXP3 + (A) and IFN-γ + (B) cells in CD + CCR6 + population were quantified by flow cytometry (n, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

16 Supplemental Figure 1 A B C D CCR6 + CD + CCR6 + CCR6 % of total CD + T cells 1 1 Cell number ( 1 ) 3 1 WT_PBS SA_PBS MFI 1 1 % of total CD T cells D-D D3-D CCR6 + FTYp - D-D D3-D FTYp WT S1PR1(SA) FTY7 suppressed CCR6 + cell generation both in vivo and in vitro. MOG 3- -immunized C7BL/6J (WT) and S1PR1(SA) EAE mice were treated with vehicle (1% cyclodextrin in PBS) or FTY7 (.mg/kg) by daily i.p. injections up to D8 postimmunization. Splenocytes were harvested and labeled with anti-cd and CCR6 antibodies. The percentage (A), total number (B), and MFI (C) of CCR6 + cells among CD + T cells from the spleen were quantified by flow cytometry. The cell number was calculated by multiplying the total viable cell number of cells by percentage of gated cells. Data represent two independent experiments (n=, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test) CD + T cells were isolated from spleens of naïve C7BL/6J (WT) and S1PR1 (SA) mice and activated in vitro with anti-cd3 (µg/ml) and anti-cd8 (µg/ml) for days in RPMI16 media supplemented with IL-6 (ng/ml), IL-3 (ng/ml), TGF-β (1ng/ml) in the presence of FTYp (1µM). Cells were stained with anti-ccr6 antibody and percentage of CCR6 + cells (D) among CD + T cells was analyzed by flow cytometry. This experiment was performed three times (n=3, Mean± SEM, p<., ANOVA analysis with Turkey s multiple comparison test).

17 Supplemental Figure 11 Mean clinical score 3 1 _IgG 1 1 Time after immunization (d) Control IgG had no significant effects on the improvement of EAE clinical score. Mean clinical score ± SEM of MOG 3- -immunized S1PR1(SA) mice (females, 8-1 weeks) treated with FTY7 (.mg/kg) by daily i.p. injections. Arrow indicates time of initiation of FTY7 therapy. Additionally, mice were also i.p. injected with IgG control (1µg per mouse) at D and D8. Arrowheads indicates time of antibody injection (n per arm p<., Mann- Whitney U-test).

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna