Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
|
|
- Marybeth Baldwin
- 5 years ago
- Views:
Transcription
1 Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell, Emmanuelle St-Amand, Bruno Marcotte and André Marette. Supplementary Figures - Nature Medicine: doi:./nm.9
2 Supplementary Figure BLOOD SAMPLE LEGEND ο Pre-infusion sample Pre-clamp sample Clamp samples Post clamp sample H-Glucose Bolus.µCi Kg Insulin Bolus mu Kg - - ο - µg or icle µg or icle Insulin (mu kg min - ) % dextrose variable - - H-Glucose (.µci min ) + RBC (.ml h ) hour intravenous Lipid or Saline infusion (ml kg h - ) Supplementary figure. Lipid-infusion hyperinsulinemic-euglycemic clamp schema. h fasted mice were infused with lipid or saline for h. Prior to the initiation of the infusion a blood sample was drawn to determine pre-infusion glycemia and FFA's. At t= min the tracer stabilization period of the clamp procedure was begun. Immediately prior to the stabilization period a blood sample was taken to determine pre-clamp glycemia and insulinemia. The clamp was begun at t= min with infusion of insulin. Groups were administered µg of or equal volumes of vehicle immediately prior to the infusion and at t=. Nature Medicine: doi:./nm.9
3 Supplementary Figure a Saline Lipid Lipid + µg ml c Percent palmitate Plasma adiponectin Palm Palm + -nm Palm + -nm Nitrite production b pg ml d IL- Palmitate (nm) inos pjnk Thr/Tyr JNK Palm Palm + -nm Palm + -nm IL- ng ml CCL CCL TNF-α IL- Mθ protein (AU).... inos ND Palm Palm + -nm Palm + -nm pjnk/jnk Supplementary figure. dampens lipid-induced inflammation in macrophages. (a) Plasma adiponectin in clamped saline-vehicle, lipid-vehicle and lipid- treated mice. Data are mean ± s.e.m., and are representative of mice per group. (b) Chemokines, cytokines (c) and nitrite in media of J77A. macrophages exposed to vehicle () or palmitate (µm) for h in the presence or absence of. (d) Immunoblots for inos, pjnk Thr/Tyr, and total JNK in palmitate-treated macrophages. Quantitation of densitometry analyses are shown besides the representative gels Data are mean ± s.e.m., and are representative of independent experiments. P<., P.<., P<. calculated using analysis of variance. Nature Medicine: doi:./nm.9
4 Supplementary Figure a b c µg g tissue.... Saline Lipid Lipid + Liver IL- Fold vehicle IL- in media Nor Fold vehicle nm -nm -µm IL- mrna d IL- in media (fold veh) -nm -nm -µm LPS e pampk Thr7 AMPK Mθ protein (AU) - nm -nm -µm - µm min h h pampk/ampk f 9Z E Z E 7Z Z 7(S) (S) CO PD RvD DiHETE 9Z Z E E 7Z Z CO 7(S) (R) PD 7(S) (R) 9Z E Z E 9E Z CO Fold vehicle 7(S) RvD (S) E Z 9E (S) Z CO (S)(S)DiHETE IL- in media Nature Medicine: doi:./nm.9
5 Supplementary figure. selectively induces skeletal muscle IL-. (a) IL- protein in liver from clamped saline-vehicle, lipid-vehicle and lipid- treated mice. Data are mean ± s.e.m., and are representative of mice per group. (b) IL- protein in media of T7i brown adipocytes treated with vehicle (), norepinephrine (Nor, µm) or ( nm) for h. Data are mean ± s.e.m. of independent experiments. (c) IL- mrna (h) and (d) IL- protein in media of J77A. macrophages treated with, or LPS (ng/ml). Data are mean ± s.e.m. of independent experiments. (e) Immunoblots of pampk Thr7 and total AMPK in J77A. macrophages treated with or. Quantification of densitometry analyses are shown below the representative gels. Data are mean ± s.e.m. of independent experiments.(f) IL- in media of CC myotubes treated with or nm of, PD, RvD or (S) (S) DiHETE (DiHETE) for h. Data are mean ± s.e.m. of independent experiments. Chemical structures of, PD, RvD and (S) (S) DiHETE are shown to the left. Structures shared with are colored red while strucutures colored in blue represent a common feature that is the same distance from the methyl end but not the carboxyl terminal of the fatty acid chain due to a difference in chain length. For all figures P<., P<., P<. vs vehicle calculated using analysis of variance. Nature Medicine: doi:./nm.9
6 Supplementary Figure a Glycemia (mm) Glycemia (mm) b GIR (mg kg min ) GIR (mg kg min ) Pre-clamp glycemia c Time (min) d Time (min) Glucose infusion rate Fold increase in Rd % suppression of HGP pg g tissue Peripheral insulin action Hepatic insulin action Muscle IL- e f g pstat Ser77 pampk Thr7 Liver protein (AU) STAT... Relative expression Muscle protein (AU) AMPK pstat/stat Ppargc Pck Gpc pampk/ampk Nature Medicine: doi:./nm.9
7 Supplementary figure. IL- is required for the glucoregulatory actions of. (a) Pre-clamp glycemia (left) and clamp glucose excursion (right), (b) glucose infusion rate (GIR) (left) and mean GIR for the final min of clamp (right) in wild-type () or IL- null () saline-infused (S) (P) or vehicle (V) treated animals. (c) Peripheral insulin action expressed as fold increase in Rd during the clamp (left) and hepatic insulin action expressed as percent suppression of hepatic glucose production (HGP; right), (d) Skeletal muscle IL- content (e) Immunoblots for pstat Ser77 and total STAT and (f) relative mrna expression of Ppargc, Pck and GPc normalized to GAPDH in liver from clamped wild-type () or IL- null () saline-infused (S) (P) or vehicle (V) treated animals. (g) Immunoblots for pampk Thr7 and total AMPK in gastrocnemius muscle from clamped wild-type () or IL- null () saline-infused (S) (P) or vehicle (V) treated animals. Quantification of densitometry analyses for immunoblots is shown below the representative gels. Dotted lines indicate that lanes were run on the same gel but were noncontiguous. -, wild-type saline-infused vehicle, n = mice. -, wild-type saline-infused, n = mice. -, IL- null saline-infused vehicle, n = mice. -, IL- null saline-infused, n= mice. Data are mean ± s.e.m, P<., P<. calculated using analysis of variance. Nature Medicine: doi:./nm.9
8 Supplementary Figure a pakt Ser7 Akt b Fold vehicle -nm -nm -µm IL- in media c pampk Thr7 AMPK CC protein (AU) nm nm pampk/ampk µm -nm -nm -µm d e pstat Ser77 STAT pg ml - - -LV -LP Plasma TNFα Supplementary figure. mediated activation of AMPK is IL- independent. (a) Immunoblot for pakt Ser7 and total Akt in liver from clamped wild-type () or IL- null () saline-infused (S) (P) or vehicle (V) treated mice. Dotted line indicates that lanes were run on the same gel but were noncontiguous. (b) IL- in media and (c) immunoblots for pampk Thr7 and total AMPK in CC myotubes treated with vehicle () or for min. Quantification of densitometry analyses is shown below representative gels. Data are mean ± s.e.m. of independent experiments. (d) Plasma TNF-α from clamped saline (S) or lipid-infused (L) IL- null () mice treated with vehicle (V) or (P). Data are mean ± s.e.m. -, IL- null saline-infused vehicle, n =. -, IL- null saline-infused, n =. -LV, IL- null lipid-infused vehicle, n =. -LP, IL- null lipid-infused, n =. (e) Immunoblot of pstat ser77 and total STAT in liver of vehicle () or acute -treated genetically obese diabetic db/db mice. P<., P<. calculated using analysis of variance. Nature Medicine: doi:./nm.9
9 Supplementary Figure a c e pg mg ewat Glycemia (mm) GIR (mg kg min ) Pre-clamp glycemia Time (min) Glycemia (mm) pg mg ewat,,, GIR (mg kg min ) Time (min) Glucose infusion rate f pg ml b Insulin (ng ml ) d pg µg protein Pre-clamp Post-clamp Muscle IL- pg ml ng ml 9 Plasma IL- Nature Medicine: doi:./nm.9
10 Supplementary figure. Chronic therapy improves insulin sensitivity in db/db mice. (a) Pre-clamp glycemia (left) and clamp glucose excursion (right), (b) Pre and post-clamp insulin and (c) glucose infusion rate (GIR) (left) and mean GIR for the final min of clamp (right) in vehicle (veh) and chronic -treated 7 week old genetically obese diabetic db/db mice. (d) Skeletal muscle (left) and plasma (right) IL- content, (e) Chemokines and cytokines in epididymal white adipose tissue (ewat) and (f) plasma of clamped vehicle (veh) and chronic -treated genetically obese diabetic db/db mice. Data are mean ± s.e.m., and are representative of mice per group. P<. calculated using student's t-test. Nature Medicine: doi:./nm.9
Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis
Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis Phillip J White,, Philippe St-Pierre,, Alexandre Charbonneau,, Patricia L Mitchell,, Emmanuelle St-Amand,,
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationAntisense Mediated Lowering of Plasma Apolipoprotein C-III by Volanesorsen Improves Dyslipidemia and Insulin Sensitivity in Type 2 Diabetes
Antisense Mediated Lowering of Plasma Apolipoprotein C-III by Volanesorsen Improves Dyslipidemia and Insulin Sensitivity in Type 2 Diabetes Digenio A, et al. Table of Contents Detailed Methods for Clinical
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationResveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
More informationa. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationAdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency
AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,
More informationSupplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
More informationMetformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production
activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
More informationSupplementary Information Titles
Journal: Nature Medicine Supplementary Information Titles Article Title: Corresponding Author: Authors: An inhibitor of the protein kinases /ε improves obesity- related metabolic dysfunctions Alan Saltiel
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationRoger J. Davis. Metabolic Stress Signaling by the JNK Pathway
Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )
More informationIL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationglucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationSupplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
More informationEpigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity
Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1
More informationSupplementary Figure 1.
Supplementary Figure 1. Transduction of adipocytes after intra-ewat administration of AAV vectors. A: Immunostaining against GFP (green) in sections of ewat two weeks after the intra-ewat administration
More informationSupplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationSupplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationTLR4 links innate immunity and fatty acid induced insulin resistance
Research article TLR4 links innate immunity and fatty acid induced insulin resistance Hang Shi, Maia V. Kokoeva, Karen Inouye, Iphigenia Tzameli, Huali Yin, and Jeffrey S. Flier Division of Endocrinology,
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationFigure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney
SUPPLEMENTAL FIGURE LEGENDS Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney macrophage infiltration. Wild type or COX-2 -/- mice (2 months old, C57/Bl6 background) were treated
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More informationTitle: Obesity in mice with adipocyte-specific deletion of clock component Bmal1
Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Authors: Georgios K. Paschos, Salam Ibrahim, Wen-Liang Song, Takeshige Kunieda, Gregory Grant, Teresa M. Reyes, Christopher
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationFigure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk
EGF induced VATPase assembly and mtorc1 activation Supplemental Information Supplemental Figure Legends Figure S1. Effect of bafilomycin on EGFinduced Akt and Erk signaling. A. Hepatocytes were treated
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationMS/MS analysis of plasma from AD patients and healthy volunteers (n=8 healthy volunteers
Figure S. PGFα, - and -HETE are elevated in of patients with Acute Decompensation (AD) when compared with healthy volunteers. (a-g) Lipidomic LC/ESI- MS/MS analysis of from AD patients and healthy volunteers
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationSupplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance
Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,
More informationSmall molecule inhibitors of PKR improve glucose homeostasis in obese,
Page 1 of 24 Small molecule inhibitors of PKR improve glucose homeostasis in obese, diabetic mice Takahisa Nakamura, Alessandro Arduini, Brenna Baccaro, Masato Furuhashi, and Gökhan S. Hotamisligil Department
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationHSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationInflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra
Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationProtein extraction and western blot analysis Protein extraction was performed as
ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,
More informationSupplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationBaf60c drives glycolytic muscle formation and improves glucose homeostasis through Deptor-mediated Akt activation
Baf6c drives glycolytic muscle formation and improves glucose homeostasis through Deptor-mediated Akt activation Zhuo-Xian Meng,2, Siming Li,2, Lin Wang,2, Hwi Jin Ko 3, Yongjin Lee 3, Dae Young Jung 3,
More informationTissue inflammation and nitric oxide-mediated alterations in cardiovascular function are major determinants of endotoxin-induced insulin resistance
House et al. Cardiovascular Diabetology (2015) 14:56 DOI 10.1186/s12933-015-0223-2 CARDIO VASCULAR DIABETOLOGY ORIGINAL INVESTIGATION Open Access Tissue inflammation and nitric oxide-mediated alterations
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationModulation of TRP channels by resolvins in mouse and human
July 9, 2015, Ion Channel Retreat, Vancouver Ion Channel and Pain Targets Modulation of TRP channels by resolvins in mouse and human Ru-Rong Ji, PhD Pain Research Division Department of Anesthesiology
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and
Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and plasma insulin levels (C) during the 48 h infusion period before the two-step hyperglycemic clamp in diabetes-prone
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationThe Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationMCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity
Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationSUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)
SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation
More informationInterplay between FGF21 and insulin action in the liver regulates metabolism
Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationhuman epithelial cells were pretreated with control sirna (50 nm) or GSK-3β sirna (50 nm)
GSK3β facilitates IFNγ signaling Supplementary Figure Legends Figure S1. The effects of inhibiting GSK3β on IFNγinduced TNFα expression. A, A549 human epithelial cells were pretreated with control sirna
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationSupplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
More informationData supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity
Data supplement Netrin- promotes adipose tissue macrophage accumulation and insulin resistance in obesity Bhama Ramkhelawon, Elizabeth J Hennessy, Mickaël Ménager 2, Tathagat D. Ray, Frederick J Sheedy,
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationTrim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
More informationA 2B Adenosine Receptors Prevent Insulin Resistance by Inhibiting Adipose Tissue Inflammation via Maintaining Alternative Macrophage Activation
850 Diabetes Volume 63, March 2014 Balázs Csóka, 1 Balázs Koscsó, 1 Gábor Tör}o, 2 Endre Kókai, 2 László Virág, 2,3 Zoltán H. Németh, 1,4 Pál Pacher, 5 Péter Bai, 2,3 and György Haskó 1,2 A 2B Adenosine
More informationNAFLD AND TYPE 2 DIABETES
NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More information