Engineering a polarity-sensitive biosensor for time-lapse imaging of apoptotic processes and degeneration
|
|
- Roger Fowler
- 5 years ago
- Views:
Transcription
1 nature methods Engineering a polarity-sensitive biosensor for time-lapse imaging of apoptotic processes and degeneration Yujin E Kim, Jeannie Chen, Jonah R Chan & Ralf Langen Supplementary figures and text: Supplementary Figure 1 Additional controls for psiva fluorescence and membrane-binding. Supplementary Figure 2 Additional examples of apoptotic COS-7 cells detected by psiva m. Supplementary Figure 3 Supplementary Table 1 The staining pattern of psiva m and neurofilament on NGF-deprived (20 h) DRG neurons. Sequences of oligos used to make cysteine mutants. Note: Supplementary Videos 1 4 are available on the Nature Methods website.
2 Supplementary Fig % PC 25% PS-PC Anx B12 101C, 260C Anx B12 4C Anx B12 101C Anx B12 260C Anx B12 101C, 260C Anx A5 262C S P S P S P S P S P S P a. 36 kda IANBD-labeled b. 36 kda BADAN-labeled Fluorescence (relative units) c. 900 d. e. f g. 900 h. i. j Wavelength (nm) k. 100 % Fluorescence AnxV-FITC psiva 0 1:500 1:1000 Molar ratio (protein:lipid)
3 Supplementary Fig. 1 Additional controls for psiva fluorescence and membrane-binding. A co-sedimentation assay of the various IANBD (a) and BADAN (b) labeled annexin proteins with liposomes indicates that labeling at the various sites does not affect membrane-binding affinity or specificity. All of the proteins were associated with the lipid pellet (P) when incubated with PS-containing vesicles. When incubated with vesicles composed of 100% PC all of the proteins remained in the supernatant (S). c-j shows the fluorescence intensities of the different psiva variants in solution (dotted lines) and the fluorescence intensities in the presence of 100% PC vesicles (solid lines). The excitation wavelength was set to 478 nm and fluorescence emission intensities were measured for IANBD labeled annexins: c) AnxB12 101C-IANBD, d) AnxB12 260C-IANBD, e) AnxA5 262C-IANBD and f) AnxB12 101C-, 260C-IANBD. The excitation wavelength was set to 380 nm and the fluorescence emission intensities were measured for BADAN labeled annexins: g) AnxB12 101C- BADAN, h) AnxB12 260C- BADAN, i) AnxA5 262C- BADAN and j) AnxB12 101C-, 260C- BADAN. The only measurable changes observed between the comparison of fluorescence intensities in the absence or presence of PC vesicles was due to lipid scatter. k, To provide a comparison of psiva (Anx B12 101C-, 260C-IANBD) to AnxV-FITC, 1 µm annexin protein was incubated with varying amounts of PS-containing vesicles (1:1000, 1:500, 1:250, 1:100, 1:50. 1:10, and 1:1 molar ratios of protein:lipid). The maximum fluorescence emission intensities measured at the different protein:lipid ratios for anxb12-101c-,260c-ianbd (excitation max. = 478 nm, emission max. = 525) was compared with AnxV-FITC (excitation max. = 485 nm, emission max. = 520 nm). As expected for psiva, the fluorescence intensity increased with increasing amounts of PScontaining vesicles, indicating that increasing fluorescence intensities correlates with increasing membrane-binding. No significant change in the overall fluorescence intensity was observed for AnxV-FITC when increasing the amount of PS-containing vesicles.
4 Supplementary Fig. 2 Control (DMSO) 39h a. 35h 41h 46h PI (red) psiva (green) phase contrast overlay 25h b. 100uM Etoposide PI (red) psiva (green) phase contrast overlay * * *
5 Supplementary Fig. 2 Additional examples of apoptotic COS-7 cells detected by psiva. a, COS-7 cells monitored under physiological conditions and b, in the presence of the apoptotic factor, etoposide. Green fluorescence indicates psiva binding to the PS exposed on the outer leaflet of the plasma membrane, and red fluorescence indicates propidium iodide (PI) staining of nuclei during later stages of apoptosis, with loss of plasma membrane integrity. (Scale bars, 40 µm)
6 Supplementary Fig. 3 a. b. c. d.
7 Supplementary Fig 3. The staining pattern of psiva and neurofilament on NGF-deprived (20 h) DRG neurons. Live-staining (unpermeabilized) of DRG neurons was compared with staining of permeabilized neurons. Similar to what was observed in the live-cell imaging experiments, psiva staining of axons which were not permeabilized resulted in a punctate staining pattern (a). Neurofilament staining was excluded from the majority of axons (b), indicating that the psiva signal (a) arises from binding to exposed PS on axons with membrane integrity still intact. In contrast the staining pattern of permeabilized cells with psiva was uniform throughout the axon (c), in agreement with the more abundant and uniform distribution of PS on the inner leaflet of the plasma membrane. For comparison, neurofilament staining of permeabilized axons is shown in d.
8 Supplementary Table 1 mutation oligo sequence AnxB12: Q4C 5'-GAA TAA ACC ATG GTT GTT TGT GGA ACA GTT AAA CCA CAT G-3' AnxB12: L101C 5'-GCT ATG AAG GGG TGT GGA ACT GAT GAA AAC-3' AnxA5: A262C 5'-GCT ATG AAG GGA TGT GGG ACA GAT GAT CAT ACC C-3' AnxA5: C316A 5'-GCT CTT CTG CTG CTC GCT GGA GAA GAT GAC-3'
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationFigure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationSupplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationSupplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
More informationSupplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
More informationSupplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationA smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationSupplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
More informationDescription of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationToluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
More informationResistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.
Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationNature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationSupplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationCitation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
More informationCD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
More informationBHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL
1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.
More informationAstaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
More informationSupplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
More informationPhylogenetic analysis of human and chicken importins. Only five of six importins were studied because
Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein
More informationCulture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)
A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB
More informationRapid blue-light mediated induction of protein interactions in living cells
Nature Methods Rapid blue-light mediated induction of protein interactions in living cells Matthew J Kennedy, Robert M Hughes, Leslie A Peteya, Joel W Schwartz, Michael D Ehlers & Chandra L Tucker Supplementary
More informationSupplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease
Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,
More informationThe Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
More informationSupplementary Information
Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
More informationBeta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
More informationSupplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota
Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources
More informationBeta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015
Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationTable S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
More informationwww.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationSingle-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast
Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and
More informationSUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
More informationJournal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
More informationice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.
Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/334/rs4/dc1 Supplementary Materials for Rapidly rendering cells phagocytic through a cell surface display technique and concurrent Rac activation Hiroki Onuma,
More informationSupplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
More informationSupplementary information
Supplementary information Unique polypharmacology nuclear receptor modulator blocks inflammatory signaling pathways Mi Ra Chang 1, Anthony Ciesla 1, Timothy S. Strutzenberg 1, Scott J. Novick 1, Yuanjun
More informationSupplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
More informationCross-talk between mineralocorticoid and angiotensin II signaling for cardiac
ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10743 Supplementary Figures and Legends Supplementary Figure 1. CYP17A1 (red boxes) lies at the intersection of steroid hormone biosynthetic pathways. CYP17A1
More informationRayBio Annexin V-FITC Apoptosis Detection Kit
RayBio Annexin V-FITC Apoptosis Detection Kit User Manual Version 1.0 May 25, 2014 (Cat#: 68FT-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or
More informationSupplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/473/eaai7696/dc1 Supplementary Materials for Astrocyte-shed extracellular vesicles regulate the peripheral leukocyte response to inflammatory brain lesions
More informationSUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM)
SUPPLEMENTAL METHODS Cell culture Human peripheral blood mononuclear cells were isolated from healthy donors by Ficoll density gradient centrifugation. Monocyte differentiation to resting macrophages ()
More informationTetR repressor-based bioreporters for the detection of doxycycline using Escherichia
Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental
More informationExtracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation
Supplementary material; Title; Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation Authors; Petra Wäster 1, Ida Eriksson 1, Linda Vainikka 1, Inger Rosdahl 2,
More informationExpression of Selected Inflammatory Cytokine Genes in Bladder Biopsies
Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-
More informationFor the rapid, sensitive and accurate measurement of apoptosis in various samples.
ab14082 500X Annexin V-FITC Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples. This product is for research use only and
More informationINTERLEUKIN-10 FACILITATES BOTH CHOLESTEROL UPTAKE AND EFFLUX IN MACROPHAGES
SUPPLEMENTAL DATA INTERLEUKIN-10 FACILITATES BOTH CHOLESTEROL UPTAKE AND EFFLUX IN MACROPHAGES Xinbing Han, Shiro Kitamoto, Qingyu Lian and William A. Boisvert Vascular Medicine Research Unit, Brigham
More informationMulti-Parameter Apoptosis Assay Kit
Multi-Parameter Apoptosis Assay Kit Catalog Number KA1335 5 x 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
More informationSUPPLEMENTARY INFORMATION
BASELINE ISCHAEMIA a b Phd2 +/- c d Collateral growth and maintenance SMC recruitment SMC proliferation Phd2 +/- NF- B off NF- B on NF- B on NF- B on Endothelial cell Smooth muscle cell Pro-arteriogenic
More informationA basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
More informationSupplementary Data. Clinical Setup. References. Program for Embryo Donation
Supplementary Data Clinical Setup Notwithstanding their value in stem cell research, the source of supernumerary human blastocysts for the derivation of new stem cell lines and the modalities of their
More informationBaseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3
Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and
More informationSupporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in
Supporting Information for Mutational analysis of a phenazine biosynthetic gene cluster in Streptomyces anulatus 9663 Orwah Saleh 1, Katrin Flinspach 1, Lucia Westrich 1, Andreas Kulik 2, Bertolt Gust
More informationFormylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis
Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott
More informationLezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza
More informationLoyer, et al. microrna-21 contributes to NASH Suppl 1/15
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models
More informationFrequency of mosaicism points towards mutation prone early cleavage cell divisions.
Frequency of mosaicism points towards mutation prone early cleavage cell divisions. Chad Harland, Wouter Coppieters, Latifa Karim, Carole Charlier, Michel Georges Germ-line de novo mutations Definition:
More informationViral hepatitis, which affects half a billion people
GASTROENTEROLOGY 2006;130:435 452 BASIC LIVER, PANCREAS, AND BILIARY TRACT Natural Killer Cells Ameliorate Liver Fibrosis by Killing Activated Stellate Cells in NKG2D-Dependent and Tumor Necrosis Factor
More informationHuman Endogenous Retrovirus W and Motor Neurone Disease, Conradi, S, Kristensson, K, Karlsson, H
ORIGINAL ARTICLE Human Endogenous Retrovirus W and Motor Neurone Disease Oluwole, OSA, Conradi, S, Kristensson, K, Karlsson, H 1,2 3 2 2 Abstract Background Enteroviral infections and mutations of superoxide
More informationRegulation of bcl-2 family in hydrogen peroxide-induced apoptosis in human leukemia HL-60 cells
EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 32, No. 1, 42-46, March 2000 Regulation of bcl-2 family in hydrogen peroxide-induced apoptosis in human leukemia HL-60 cells Jung Eun Lee 1, Jeongwon Sohn 2, Jung
More informationSupporting Information
Supporting Information Molecular Recognition Based DNA Nanoassemblies on the Surfaces of Nanosized Exosomes Shuo Wan,, Liqin Zhang,,, Sai Wang, Yuan Liu,, Cuichen Wu, Cheng Cui, Hao Sun, Muling Shi, Ying
More informationSupporting Information
Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationIntegration Solutions
Integration Solutions (1) a) With no active glycosyltransferase of either type, an ii individual would not be able to add any sugars to the O form of the lipopolysaccharide. Thus, the only lipopolysaccharide
More informationMutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Beck et al., http://www.jcb.org/cgi/content/full/jcb.201011027/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Membrane binding of His-tagged proteins to Ni-liposomes.
More informationRelationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
More informationNucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10
J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By
More informationPE Annexin V Apoptosis Detection Kit User Manual KT40001
PE Annexin V Apoptosis Detection Kit User Manual KT40001 For research use only. Not intended for diagnostic testing. a WuXi AppTec company www.abgent.com.cn PE Annexin-V Apoptosis Detection Kit Product
More informationDevelopment of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients
Development of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients Sangjung Park The Graduate School Yonsei University Department of Biomedical Laboratory
More informationAPOPTOSIS is a morphologically and biochemically
Keratinocyte Growth Factor Decreases Total Parenteral Nutrition Induced Apoptosis in Mouse Intestinal Epithelium Via Bcl-2 By Barbara E. Wildhaber, Hua Yang, and Daniel H. Teitelbaum Ann Arbor, Michigan
More informationMutation analysis of a Chinese family with oculocutaneous albinism
/, 2016, Vol. 7, (No. 51), pp: 84981-84988 Mutation analysis of a Chinese family with oculocutaneous albinism Xiong Wang 1, Yaowu Zhu 1, Na Shen 1, Jing Peng 1, Chunyu Wang 1, Haiyi Liu 2, Yanjun Lu 1
More informationUniversity of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick
University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationSupplementary Figure 1: Loop conversion from inactive (0 ns) to pre-active (75 ns) observed in MD2. The plot monitors the RMSD calculated for
Supplementary Figure 1: Loop conversion from inactive (0 ns) to pre-active (75 ns) observed in MD2. The plot monitors the RMSD calculated for residues 3 to 345 and backbone atoms of the 344-loop using
More informationAnnexin V-APC/7-AAD Apoptosis Kit
Annexin V-APC/7-AAD Apoptosis Kit Catalog Number KA3808 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4
More informationBIOLOGY 621 Identification of the Snorks
Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on
More informationA highly selective AIE fluorogen for lipid droplet imaging in live cells and green algae
Electronic Supporting Information highly selective IE fluorogen for lipid droplet imaging in live cells and green algae Erjing Wang, ab Engui Zhao, ab Yuning Hong, ab Jacky W. Y. Lam, ab and en Zhong Tang*
More informationASSESSMENT OF CELLULAR OXYGEN GRADIENTS WITH A PANEL OF PHOSPHORESCENT OXYGEN-SENSITIVE PROBES
ASSESSMENT OF CELLULAR OXYGEN GRADIENTS WITH A PANEL OF PHOSPHORESCENT OXYGEN-SENSITIVE PROBES Ruslan I. Dmitriev, Alexander V. Zhdanov, Greg Jasionek, Dmitri B. Papkovsky Biochemistry Department, University
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chen et al., http://www.jcb.org/cgi/content/full/jcb.201210119/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Lack of fast reversibility of UVR8 dissociation. (A) HEK293T
More informationmir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Supplementary Information
Title: mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Authors: Juan Pablo Lopez 1, Raymond Lim 3, Cristiana Cruceanu 1, Liam Crapper 1,
More informationCharacterizing intra-host influenza virus populations to predict emergence
Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems
More informationDetection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany
HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.
More informationTable S1. Primers used to quantitatively amplify the human mirnas precursors and indicated genes
Table S1. Primers used to quantitatively amplify the human mirnas precursors and indicated genes Forward primer (5 3 ) Rervese primer (5 3 ) U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 5S TACGGCCATACCACCCTGAA
More informationSupplementary material
Supplementary material Docking procedures PtdIns(4)P headgroup docked onto FAPP1-PH The ligand structure and charges were generated within GHEMICAL (Hassinen and Perakyla, 2001) using minimization (500
More information