Supporting information
|
|
|
- Mildred Lawson
- 5 years ago
- Views:
Transcription
1 Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction in vivo Kai Wang, a,b, Li Bao, a, b, Nan Zhou, c Jinjin Zhang, a,b Mingfang Liao, a,b Zhongyong Zheng, a,b Yujing Wang, b,c Chang Liu, c Jun Wang, d Lifeng Wang, e Wenzhao Wang, a ShuangJiang Liu, b,c Hongwei Liu a, b, * a State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, No.1 Beichenxi Road, Chaoyang District, Beijing , P. R. China b University of Chinese Academy of Sciences, Beijing, , P. R. China c State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, No.1 Beichenxi Road, Chaoyang District, Beijing , P. R. China d CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, No.1 Beichenxi Road, Chaoyang District, Beijing , P. R. China e Beijing Kangyuan Pharmaceutical Co., Ltd., No. 3 Changliu Road, Changping District, , Beijing P. R. China S1
2 Contents Scheme S1. Synthesis of compound 7n Figure S1. α-glucosidase reductase inhibitory activities of 7c-7f performed by HPLC method. Figure S2. The chemical stability of 7d compared with ganomycin I Figure S3. Long-term toxicity of 7d on C57BL/6J mice Figure S4. Mean plasma concentration profile of 7d in rat plasma after intragastric administration of 7d 2.0 mg/ kg in rats. Figure S5. Effects of 7d on body weight control in DIO mice. Figure S6. Effects of 7d on blood glucose levels and insulin resistance in DIO mice. Figure S7. Effects of 7d on lipid metabolism in DIO mice Figure S8. Effects of 7d on the in vivo α-glucosidase inhibitory activitys and small intestinal carbohydrate distribution. Figure S9. Transcriptome analysis of the hepatic gene expression profile in 7d-treated ob/ob mice. Figure S10. Detection of pseudo-germ-free mice treated with antibiotics (Abx). Figure S11. Antibiotics treatment blocks the therapeutic effects of 7d Figure S12. 1 H NMR spectrum of 2b (CDCl 3, 500 MHz) Figure S C NMR spectrum of 2b (CDCl 3, 125 MHz) Figure S14. 1 H NMR spectrum of 2d (CDCl 3, 500 MHz) Figure S C NMR spectrum of 2d (CDCl 3, 125 MHz) Figure S16. 1 H NMR spectrum of 5 (CDCl 3, 500 MHz) Figure S17. 1 H NMR spectrum of aldehyde (CDCl 3, 500 MHz) Figure S18. 1 H NMR spectrum of 6 (CDCl 3, 500 MHz) Figure S19. 1 H NMR spectrum of 7a (CDCl 3, 500 MHz) Figure S C NMR spectrum of 7a (CDCl 3, 125 MHz) Figure S21. 1 H NMR spectrum of 7b (CDCl 3, 500 MHz) Figure S C NMR spectrum of 7b (CDCl 3, 125 MHz) Figure S23. 1 H NMR spectrum of 7c (CDCl 3, 500 MHz) S4 S5 S6 S7 S8 S9 S10 S11 S12 S13 S14 S15 S16 S17 S18 S19 S20 S21 S22 S23 S24 S25 S26 S27 S2
3 Figure S C NMR spectrum of 7c (CDCl 3, 125 MHz) Figure S25. 1 H NMR spectrum of 7d (CDCl 3, 500 MHz) Figure S C NMR spectrum of 7d (CDCl 3, 125 MHz) Figure S27. 1 H NMR spectrum of 7e (Acetone-d 6, 500 MHz) Figure S28. 1 H NMR spectrum of 7f (CDCl 3, 500 MHz) Figure S C NMR spectrum of 7f (CDCl 3, 125 MHz) Figure S30. 1 H NMR spectrum of 7g (CDCl 3, 500 MHz) Figure S C NMR spectrum of 7g (CDCl 3, 125 MHz) Figure S32. 1 H NMR spectrum of 7h (CDCl 3, 500 MHz) Figure S33. 1 H NMR spectrum of 7i (CDCl 3, 500 MHz) Figure S34. 1 H NMR spectrum of 7j (CDCl 3, 500 MHz) Figure S C NMR spectrum of 7j (CDCl 3, 125 MHz) Figure S36. 1 H NMR spectrum of 7k (CDCl 3, 500 MHz) Figure S37. 1 H NMR spectrum of 7l (CDCl 3, 500 MHz) Figure S38. 1 H NMR spectrum of 7m (CDCl 3, 500 MHz) Figure S C NMR spectrum of 7m (CDCl 3, 125 MHz) Figure S40. 1 H NMR spectrum of 7n (CDCl 3, 500 MHz) Figure S C NMR spectrum of 7n (CDCl 3, 125 MHz) Table S1. Primers used in this study S28 S29 S30 S31 S32 S33 S34 S35 S36 S37 S38 S39 S40 S41 S42 S43 S44 S45 S46 S3
4 Supplementary Figures Scheme S1. Synthesis of compound 7n Reagents and conditions: (a) Allyl magnesium bromide, THF, -78 ºC to room temperature; (b) MnO 2, hexane, room temperature; (c) (R)-CBS catalyst (10 mol%), BH SMe 2, DCM, 20 ºC; (d) Cl 3 C 6 H 2 COCl, DIPEA, DMAP, toluene, room temperature; (e) Grubbs 1st catalyst, CH 2 Cl 2, room temperature; (DCM = dichloromethane, DIPEA = diisopropylefhylamine, DMAP = 4-(dimethylamino) pyridine, Grubbs 1st catalyst = [(PCy 3 ) 2 Cl 2 Ru=CHPh] S4
5 mau 40 *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C D) 7c IC 50 = 0.23 ±0.04µM PNP mau 40 *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA D) 7d IC 50 = 0.04 ±0.01µM PNPG PNP 30 PNPG µm 0.05 µm 0.1 µm 0.2 µm 0.4 µm 0.8 µm µm µm 0.05 µm 0.1 µm 0.2 µm 0.4 µm min min mau *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7C D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7E D) 7e IC 50 = ±3.26 µm PNPG PNP mau *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\7F D) *DAD1 D, Sig=340,16 Ref=360,100 (SA7\SA D) 7f IC 50 = 0.16 ±0.03µM PNP µm 40 µm 20 µm 10 µm 0.8 µm 10 0 µm 0.8 µm µm 0.05 µm 0.1 µm 0.2 µm 0.4 µm PNPG min Figure S1. α-glucosidase reductase inhibitory activities of 7c-7f performed by HPLC method. HPLC conditions are as follows: YMC-Pack ODS column (C18, mm, 5 µm); temperature, 25 ºC; injection volume, 10 µl; flow rate, 1 ml/min; Detection wavelength: 340 nm; PNPG: p-nitrophenol glucopyranoside; PNP: p-nitrophenol. min S5
6 *DAD1 B, Sig=210,4 Ref=360,100 (GL\GL-1S D) *DAD1 A, Sig=205,4 Ref=360,100 (GLY\PCBE \ D) A *DAD1 B, Sig=210,4 Ref=360,100 (GL\GL-1S D) *DAD1 E, Sig=210,16 Ref=360,100 (GLY\PCBE \ D) mau Ganomycin I BmAU 7d Ganomycin I sa day day days days min min Figure S2. Comparison of the chemical stability of 7d and ganomycin I when exposed to room temperature for 3 weeks. HPLC conditions are as follows: YMC-Pack ODS column (C18, mm, 5 µm); temperature, 25 ºC; concentration, 0.1 mg/ml; injection volume, 5 µl; flow rate, 1 ml/min; solvent, 60% MeCN in H 2 O (with 0.1 trifluoroacetic acid). S6
7 Figure S3. Long-term toxicity of 7d on C57BL/6J mice administrated with daily dose of 30.0 mg/kg for 3 months: (A) Weight change; (B) Cumulative food intake per mouse; (C) Plasma aspartate transaminase (AST); (D) Plasma alanine transaminase (ALT); (E) Free diet blood glucose; (F) Organ coefficients; (G) Macroscopic appearance of the liver. The dose of 7d treatment is 30.0 mg/kg. Measurements were taken from distinct samples. Data are presented as the mean ± SEM. N = 10 mice per group. Statistical analysis was done using two-way ANOVA followed by the Bonferroni post hoc test for A and E, and one-way ANOVA followed by the Tukey post hoc test for B-D, and F. * P<0.05; ** P<0.01; *** P< S7
8 Figure S4. Mean plasma concentration profile of 7d in rat plasma after intragastric administration of 7d at a dose of 2.0 mg/kg in rats. S8
9 A B C *** ** ** Figure S5. Effects of 7d on body weight and food intake in DIO mice: (A) Body weight gain; (B) Cumulative food intake; (C) LEE index. Mod, DIO model; Gm-I, Ganomycin I 3.0 mg/kg. Data are presented as the mean ± standard error of the mean (SEM). N = 8-10 mice per group. Statistical analysis was done using one-way ANOVA followed by the Tukey post hoc test. * P<0.05; ** P<0.01. S9
10 A B ### ### ### ### ### ### C D * ** ** * * * ** *** ** *** *** *** Days of treatment *** ** * E F *** *** *** *** Figure S6. Effects of 7d on blood glucose levels and insulin resistance in DIO mice: (A) Sequential monitoring of blood glucose in DIO mice after 4h fasting; (B) Free diet blood glucose in DIO mice; (C) OGTT and (D) AUC on the 25th day of treatment in DIO mice; (E) HbA1c in DIO mice; (F) ISI in DIO mice. Con, C57BL/6J mice control; Mod, DIO model; Gm-I, Ganomycin I 3.0 mg/kg. N = 8 mice per group. Statistical analysis was done using one-way ANOVA followed by the Tukey post hoc test. * P<0.05; ** P<0.01, *** P< S10
11 *** *** *** *** Figure S7. Effects of 7d on lipid metabolism in DIO mice: (A) Serum TG in DIO mice; (B) Serum FFAs in DIO mice; (C) Serum TC in DIO mice. Con, C57BL/6J mice control; Mod, DIO model; Gm-I, Ganomycin I 3.0 mg/kg. N = 8 mice per group. Statistical analysis was done using one-way ANOVA followed by the Tukey post hoc test. * P<0.05; ** P<0.01, *** P< S11
12 Figure S8. Effects of 7d on the in vivo α-glucosidase inhibitory activitys and small intestinal carbohydrate distribution: (A) OMTT test and (B) AUC on the 30th day of treatment in DIO mice; (C) OSTT test and (D) AUC on the 32th day of treatment in DIO mice; (E) Small intestinal carbohydrate distribution in ob/ob mice. Con, C57BL/6J mice control; Mod, DIO or ob/ob mice; Acar, Acarbose 10.0 mg/kg; Gm-I, ganomycin I 3.0 mg/kg. Values are means ±SEM (n = 8-10 for ob/ob or DIO mice); *P<0.05, **P<0.01, ***P<0.001 versus ob/ob or DIO model group. S12
13 Figure S9. Transcriptome analysis of the hepatic gene expression profile in 7d-treated ob/ob mice: (A) Top 10 biological processes related to inflammation and immunity of all downregulated and differentially expressed genes ( 2-fold); (B) KEGG pathway enrichment analyses of all downregulated and differentially expressed genes ( 2-fold); (C) Gene expression changes (with p < 0.05) among the 13,407 genes detected by RNA sequencing (RNA-seq; FPKM min > 0); (D) The heatmap of 46 upregulated and 284 downregulated genes that differentially expressed by two-fold or more. S13
14 Figure S10. Detection of pseudo-germ-free mice treated with antibiotics (Abx): (A) Cecum bloating and caecum liquid contents; (B) Colony-forming units (CFUs) in feces from each group cultivated on YCFA solid medium under anaerobic conditions. Data were obtained with three replicates. Statistical analysis was done using two-way ANOVA followed by the Bonferroni post hoc test. * P<0.05; ** P<0.01; *** P< S14
15 A B C D Weight gain (g) (the 20th day) ** ** ns E F G H ns I J K L M N O P * ns Figure S11. Antibiotics treatment blocks the therapeutic effects of 7d: (A) Weight gain; (B) Cumulative food intake for 18 days per mouse; (C) Free diet blood glucose; (D) HbA1c; (E) The mean AUC measured during an OGTT; (F) Insulin content; (G) Insulin sensitivity index (ISI); (H) Plasma triglycerides; (I) Plasma free fatty acids; (J) Plasma total cholesterol; (K) Plasma LDL-C; (L) Hepatic triglycerides; (M) Hepatic total cholesterol; (N) Hepatic LDL-C; (O) Hepatic free fatty acids; (P) Plasma levels of LPS. The dose of 7d treatment is 3.0 mg/kg. Data are presented as the mean ± SEM. N = 8 mice per group. Statistical analysis was done using the unpaired Student s t-test. * P<0.05; ** P<0.01; *** P< S15
16 Figure S12. 1 H NMR spectrum of 2b (CDCl 3, 500 MHz) S16
17 Figure S C NMR spectrum of 2b (CDCl 3, 125 MHz) S17
18 Figure S14. 1 H NMR spectrum of 2d (CDCl 3, 500 MHz) S18
19 Figure S C NMR spectrum of 2d (CDCl 3, 125 MHz) S19
20 Figure S16. 1 H NMR spectrum of 5 (CDCl 3, 500 MHz) S20
21 Figure S17. 1 H NMR spectrum of aldehyde (CDCl 3, 500 MHz) S21
22 Figure S18. 1 H NMR spectrum of 6 (CDCl 3, 500 MHz) S22
23 Figure S19. 1 H NMR spectrum of 7a (CDCl 3, 500 MHz) S23
24 Figure S C NMR spectrum of 7a (CDCl 3, 125 MHz) S24
25 Figure S21. 1 H NMR spectrum of 7b (CDCl 3, 500 MHz) S25
26 Figure S C NMR spectrum of 7b (CDCl 3, 125 MHz) S26
27 Figure S23. 1 H NMR spectrum of 7c (CDCl 3, 500 MHz) S27
28 Figure S C NMR spectrum of 7c (CDCl 3, 125 MHz) S28
29 Figure S25. 1 H NMR spectrum of 7d (CDCl 3, 500 MHz) S29
30 Figure S C NMR spectrum of 7d (CDCl 3, 125 MHz) S30
31 Figure S27. 1 H NMR spectrum of 7e (Acetone-d 6, 500 MHz) S31
32 Figure S28. 1 H NMR spectrum of 7f (CDCl 3, 500 MHz) S32
33 Figure S C NMR spectrum of 7f (CDCl 3, 125 MHz) S33
34 Figure S30. 1 H NMR spectrum of 7g (CDCl 3, 500 MHz) S34
35 Figure S C NMR spectrum of 7g (CDCl 3, 125 MHz) S35
36 Figure S32. 1 H NMR spectrum of 7h (CDCl 3, 500 MHz) S36
37 Figure S33. 1 H NMR spectrum of 7i (CDCl 3, 500 MHz) S37
38 Figure S34. 1 H NMR spectrum of 7j (CDCl 3, 500 MHz) S38
39 Figure S C NMR spectrum of 7j (CDCl 3, 125 MHz) S39
40 Figure S36. 1 H NMR spectrum of 7k (CDCl 3, 500 MHz) S40
41 Figure S37. 1 H NMR spectrum of 7l (CDCl 3, 500 MHz) S41
42 Figure S38. 1 H NMR spectrum of 7m (CDCl 3, 500 MHz) S42
43 Figure S C NMR spectrum of 7m (CDCl 3, 125 MHz) S43
44 Figure S40. 1 H NMR spectrum of 7n (CDCl 3, 500 MHz) S44
45 Figure S C NMR spectrum of 7n (CDCl 3, 125 MHz) S45
46 Table S1. Primers used in this study. Name Sequence (5 3 ) Gapdh-forward Gapdh-reverse Muc1-forward Muc1-reverse Muc5-forward Muc5-reverse ZO-1-forward ZO-1-reverse Occludin-forward Occludin -reverse Pparg-forward Pparg -reverse Nos2-forward Nos2 -reverse Tnf-forward Tnf-reverse Il1a-forward Il1a-reverse AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA GGCATTCGGGCTCCTTTCTT TGGAGTGGTAGTCGATGCTAAG GTGGTTTGACACTGACTTCCC CTCCTCTCGGTGACAGAGTCT ACCCGAAACTGATGCTGTGGATAG AAATGGCCGGGCAGAACTTGTGTA TTGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG CCCAGGCCGGAGTTTAACC GTTGCTCATAAAGTCGGTGCT TTTTCCGAAGAACCATCCGATT ATGGCATTGTGAGACATCCCC CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG CGAAGACTACAGTTCTGCCATT GACGTTTCAGAGGTTCTCAGAG S46
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
a b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
Supplementary Information
Supplementary Information J. Braz. Chem. Soc., Vol. 24, No. 12, S1-S21, 2013. Printed in Brazil - 2013 Sociedade Brasileira de Química 0103-5053 $6.00+0.00 SI Rui He, a,b,c Bochu Wang,*,b Toshiyuki Wakimoto,
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Electronic Supplementary Information. Quinine/Selectfluor Combination Induced Asymmetric Semipinacol Rearrangement of
Electronic Supplementary Information Quinine/Selectfluor Combination Induced Asymmetric Semipinacol Rearrangement of Allylic Alcohols: An Effective and Enantioselective Approach to α Quaternary β Fluoro
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Supporting Information. Palladium-Catalyzed Formylation of Aryl Iodides with HCOOH as
Supporting Information Palladium-Catalyzed Formylation of Aryl Iodides with HCOOH as CO Source Guanglong Sun,,, Xue Lv,,, Yinan Zhang, Min Lei,*,, and Lihong Hu*, Jiangsu Key Laboratory for Functional
Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).
Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between
Determination of Tetracyclines in Chicken by Solid-Phase Extraction and High-Performance Liquid Chromatography
Determination of Tetracyclines in Chicken by Solid-Phase Extraction and High-Performance Liquid Chromatography Application ote Food Safety Authors Chen-Hao Zhai and Yun Zou Agilent Technologies Co. Ltd.
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Thiol-Activated gem-dithiols: A New Class of Controllable. Hydrogen Sulfide (H 2 S) Donors
Thiol-Activated gem-dithiols: A New Class of Controllable Hydrogen Sulfide (H 2 S) Donors Yu Zhao, Jianming Kang, Chung-Min Park, Powell E. Bagdon, Bo Peng, and Ming Xian * Department of Chemistry, Washington
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
TRPM8 in the negative regulation of TNFα expression during cold stress
in the negative regulation of TNFα expression during cold stress Xin-Pei Wang 1, Xuan Yu 1, Xiao-Jin Yan 1, Fan Lei 2, Yu-Shuang Chai 1, Jing-Fei Jiang 1, Zhi- Yi Yuan 1, Dong-Ming Xing 1, Li-Jun Du 1*
Christophe Lincheneau, Bernard Jean-Denis and Thorfinnur Gunnlaugsson* Electronic Supplementary Information
Self-assembly formation of mechanically interlocked [2]- and [3]catenanes using lanthanide ion [Eu(III)] templation and ring closing metathesis reactions Christophe Lincheneau, Bernard Jean-Denis and Thorfinnur
Supplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
Supporting Information
Notes Bull. Korean Chem. Soc. 2013, Vol. 34, No. 1 1 http://dx.doi.org/10.5012/bkcs.2013.34.1.xxx Supporting Information Chemical Constituents of Ficus drupacea Leaves and their α-glucosidase Inhibitory
Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism
Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Electronic Supplementary Material
Electronic Supplementary Material PAMAM Dendrimers Bearing Electron-Donating Chromophores: Fluorescence and Electrochemical Properties Bing-BingWang a, Xin Zhang a, Ling Yang a, Xin-Ru Jia* a, Yan Ji a,
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Supporting Information for. Boronic Acid Functionalized Aza-Bodipy (azabdpba) based Fluorescence Optodes for the. analysis of Glucose in Whole Blood
Supporting Information for Boronic Acid Functionalized Aza-Bodipy (azabdpba) based Fluorescence Optodes for the analysis of Glucose in Whole Blood Yueling Liu, Jingwei Zhu, Yanmei Xu, Yu Qin*, Dechen Jiang*
Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3
(ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,
Screening of Monacolin K-high-yielding Monascus strain by combinative mutation treatment
264507~5162007 Mycosystema 1 550002 2 100039 3 550002 4 550000 Monascus purpureus 45s 1.0 Monacolin K Monascus purpureus ZT32 5 Monacolin K 219.9µg/mL 2 Monacolin K 8.33mg/g 3.3 Q939.5 A 1672-6472200704-0507-0516
Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:
Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli
Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
Supplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
176 YMC Chiral Columns
176 YMC Chiral Columns YMC Chiral Columns 177 Chiral Columns Content YMC Chiral NEA(R)(S)... 178-181 YMC Chiral CD BR... 182-185 Ordering Information... 186 HPLC Columns for Optical Isomer Separation Introduction
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p Preparation, isolation and characterization of N α -Fmoc-peptide isocyanates: Solution synthesis of oligo-α-peptidyl ureas
SUPPORTING INFORMATION Preparation, isolation and characterization of N α -Fmoc-peptide isocyanates: Solution synthesis of oligo-α-peptidyl ureas Vommina V. Suresh Babu*, Basanagoud S. Patil, and Rao Venkataramanarao
Chukvelutins A-C, 16-norphragmalin limonoids with unprecedented skeletons from Chukrasia tabularis var. velutina
Chukvelutins A-C, 16-norphragmalin limonoids with unprecedented skeletons from Chukrasia tabularis var. velutina Jun Luo, Jun-Song Wang, Jian-Guang Luo, Xiao-Bing Wang, and Ling-Yi Kong* Department of
Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells
Supporting Information for Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Sasa Zhu, Weiying Lin,* Lin Yuan State Key Laboratory of Chemo/Biosensing
Production and use of Artemisia annua (sweet wormwood) against bacterial diseases in poultry stocks and its effect on meat quality.
Production and use of Artemisia annua (sweet wormwood) against bacterial diseases in poultry stocks and its effect on meat quality. X.C. Fretté, R.M. Engberg, A. Kjær, E. Ivarsen, K.B. Christensen, K.
Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava.
Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava. Chuang-Jun Li, Jie Ma, Hua Sun, Dan Zhang, and Dong-Ming Zhang* State Key Laboratory
Analysis of fatty acid metabolism using Click-Chemistry and HPLC-MS
Analysis of fatty acid metabolism using Click-Chemistry and HPLC-MS Alexander J. Pérez and Helge B. Bode -Supporting Information- Contents Experimental section Supplementary figures NMR spectra Page S2
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Supplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119
Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk
An Orthogonal Array Optimization of Lipid-like Nanoparticles for. mrna Delivery in Vivo
Supporting Information An rthogonal Array ptimization of Lipid-like Nanoparticles for mrna Delivery in Vivo Bin Li, Xiao Luo, Binbin Deng, Junfeng Wang, David W. McComb, Yimin Shi, Karin M.L. Gaensler,
Gut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Gut Reaction Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Ley, R. et al (2005) PNAS vol. 102 no. 31 Bacterial diversity in the distal gut (ceca) of C57BL6 mice. (A) Phylogenetic tree of
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Investor Overview. November 2018
Investor Overview November 218 Forward-Looking Statement These slides and the accompanying oral presentation contain forward-looking statements and information. The use of words such as may, might, will,
SUPPORTING INFORMATION SECTION: The manufacture of a homochiral 4-silyloxy-cyclopentenone intermediate for. the synthesis of prostaglandin analogues
SUPPORTING INFORMATION SECTION: The manufacture of a homochiral 4-silyloxy-cyclopentenone intermediate for the synthesis of prostaglandin analogues Julian P. Henschke,* a Yuanlian Liu, b Xiaohong Huang,
Lanostane Triterpenes from the Tibetan Medicinal Mushroom Ganoderma leucocontextum and Their Inhibitory Effects on HMG-CoA Reductase and α Glucosidase
This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. pubs.acs.org/jnp Lanostane
Supplementary information
Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,
Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based. Metabolomics and Serum Amino Acid Profiles in Obese Women from a
Supporting information for Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based Metabolomics and Serum Amino Acid Profiles in Obese Women from a Randomized Controlled Study Shanshan
Supporting Information
Supporting Information Discovery of Pentacyclic Triterpenes as Potential Entry Inhibitors of Influenza Viruses Maorong Yu*,,, Longlong Si,, Yufei Wang, Yiming Wu, Fei Yu,, Pingxuan Jiao, Yongying Shi,
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways Department of Gastroenterology, Endocrinology & Metabolism Medical University Innsbruck Herbert Tilg Nothing to disclose Fig.
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic
A high-performance liquid chromatography (HPLC) method for determination of chlorogenic acid and emodin in Yinhuang Jiangzhi Tea
Journal of Hainan Medical University 2016; 22(12): 17-21 17 Journal of Hainan Medical University http://www.jhmuweb.net/ A high-performance liquid chromatography (HPLC) method for determination of chlorogenic
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
NOTES. Developed by Fabio Comana, MA., MS., All rights Reserved Page 1
Session 455: Core Essentials in Science Fabio Comana, MA, MS, NASM CPT, CES & PES; ACE CPT & LWMC; ACSM HFS, NSCA CSCS; CISSN National Academy of Sports Medicine fabio.comana@nasm.org NOTES Developed by
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets
Diabetologia () 5:77 DOI.7/s5--- SHORT COMMUNICATION A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets Q. Cheng & Y. C.
ALKA VITA DIABETES TEST
ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Supporting Information for. Use of the Curtius Rearrangement of Acryloyl Azides in the Synthesis of. 3,5-Disubstituted Pyridines: Mechanistic Studies
Supporting Information for Use of the Curtius Rearrangement of Acryloyl Azides in the Synthesis of 3,5-Disubstituted Pyridines: Mechanistic Studies Ta-Hsien Chuang* a, Yu-Chi Chen b and Someshwar Pola
Achiral SFC: Development of an Orthogonal SFC Method for Mometasone Furoate Impurity Analysis
Achiral SFC: Development of an Orthogonal SFC Method for Mometasone Furoate Impurity Analysis Zhenyu Wang Merck Research Laboratories NJCG 2013 Outline SFC chronicle The journey of a half century Re-birth
Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation
Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,
ph Switchable and Fluorescent Ratiometric Squarylium Indocyanine Dyes as Extremely Alkaline Sensors
ph Switchable and Fluorescent Ratiometric Squarylium Indocyanine Dyes as Extremely Alkaline Sensors Jie Li, Chendong Ji, Wantai Yang, Meizhen Yin* State Key Laboratory of Chemical Resource Engineering,
This chapter deals with the evaluation of alpha amylase inhibitory
This chapter deals with the evaluation of alpha amylase inhibitory activity of different extracts isolated from leaves of Aloe vera L. and leaves of Azadiracta indica A Juss. collected from Bharatpur and
Supplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2017 Supplementary Information Geometrical Confinement Directed Albumin-Based
Learning Objectives. Disclosures. Self Assessment Questions. Background
Association of Hyperuricemia with Liver Dysfunction amongst Adults with Metabolic Disorders in the United States: A Cross Sectional Study Disclosures Dr. Prashant Sakharkar and Dr. Subrata Deb declare(s)
Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Supplementary files Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
Application Note. Authors. Abstract. Food
Determination of Hormones in Shrimp by Agilent 129 Infinity LC with Agilent Poroshell 12 LC Column and Agilent Bond Elut QuEChERS for Sample Preparation Application Note Food Authors Rongjie Fu and Andy
Cornstarch
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
Electronic Supporting Information
Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2018 Electronic Supporting Information Tetraphenylpyrazine-based luminogens with full-colour
mm C3a. 1 mm C3a Time (s) C5a. C3a. Blank. 10 mm Time (s) Time (s)
125 I-C5a (cpm) Fluorescnece Em 520nm a 4000 3000 2000 1000 c 0 5000 4000 3000 2000 Blank C5a C3a 6 0.3 mm C3a 7 9 10 11 12 13 15 16 0.3 mm C5a 0 300 600 900 1200 Time (s) 17 Fluorescnece Em 520nm Fluorescnece
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Artepillin C, is it a good marker for quality control of Brazilian Green Propolis? Cui-ping Zhang 1, Xiao-ge Shen 1, Jia-wei Chen 1, Xia-sen Jiang 1, Kai Wang 2, Fu-liang Hu 1 *
RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting Information 1. General Information...S2 a. Materials b. HPLC
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
BIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2007
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2007 Organocatalytic Asymmetric Sulfa-Michael Addition to α,β- Unsaturated Ketones Paolo Ricci, Armando Carlone, Giuseppe
yellow coloured amorphous powder, which on crystallization from hot acetone resulted in pale
Supporting Information Hexane Extract. Compound I: Elution of column with hexane: dichloromethane (50:50 v/v; 200 ml), gave a pale yellow coloured amorphous powder, which on crystallization from hot acetone
Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
Synthesis and Polymerization of Cyclobutenyl-Functionalized. Polylactide and Polycaprolactone: A Consecutive ROP/ROMP
Electronic Supplementary Material (ESI) for Polymer Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting Information Synthesis and Polymerization of Cyclobutenyl-Functionalized Polylactide
PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes
PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes Sébastien Bolze 1 ; Sophie Hallakou-Bozec 1 ; Michael Roden 2, 3,4 ; Julien Roux
PCSK9 RNAi Therapeutics. Kevin FitzGerald
PCSK9 RNAi Therapeutics Kevin FitzGerald Presenter Disclosure Information PSCK9 RNAi Therapeutics The following relationships exist related to this presentation:» Kevin Fitzgerald and Alnylam team members:
Supplemental Fig. 1 A. C57BL/6 (B6) C. Number of colonies in culture media B6. B6 + Abx
A. Day C57BL/6 (B6) n=9 B6 + Abx (12 weeks) n=9 B. Supplemental Fig. 1 day 1 I/R 4min Sacrifice C. Number of colonies in culture media B6 Escherichia coli Lactbacillus spp. Lactobacillus murinus Enterococcus
Synthesis and Blastocyst Implantation Inhibition Potential of Lupeol Derivatives in Female Mice
Supporting Information Rec. Nat. Prod. 9:4 (2015) 561-566 Synthesis and Blastocyst Implantation Inhibition Potential of Lupeol Derivatives in Female Mice Anita Mahapatra 1*, Purvi Shah 1, Mehul Jivrajani
Supplementary Materials
Supplementary Materials Supplementary Materials and Methods Biochemical Methods Methods to assay HMT activities have been previously described (1). In vitro cell assays Proliferation and LCC calculations
Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China. Testing Report
Ministry Health approved Natural Health Products Testing Agency Issued by: Public Health Inspections, Ministry Health (1996) Publication # 53 Nutrition and Foods Safety Agency the Centre for Disease Prevention
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun