Atrial natriuretic peptide preconditioning protects against hepatic preservation injury by attenuating necrotic and apoptotic cell death

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Atrial natriuretic peptide preconditioning protects against hepatic preservation injury by attenuating necrotic and apoptotic cell death"

Transcription

1 Journal of Hepatology 39 (2003) Atrial natriuretic peptide preconditioning protects against hepatic preservation injury by attenuating necrotic and apoptotic cell death Tobias Gerwig 1,2, Herbert Meibner 3, Manfred Bilzer 2, Alexandra K. Kiemer 1, Hans Arnholdt 3, Angelika M. Vollmar 1, Alexander L. Gerbes 2, * 1 Department of Pharmacy, Center of Drug Research, University of Munich, Klinikum Grosshadern, Marchioninistrasse 15, D Munich, Germany 2 Department of Medicine II, University of Munich, Klinikum Grosshadern, Marchioninistrasse 15, D Munich, Germany 3 Institute of Pathology, University of Munich, Klinikum Grosshadern, Marchioninistrasse 15, D Munich, Germany See Editorial, pages Background/Aims: Preconditioning of livers with the atrial natriuretic peptide (ANP) markedly reduces hepatic ischemia-reperfusion injury. Aim of this study was to characterize the influence of ANP preconditioning on necrotic and apoptotic cell death and on proliferation. Methods: Rat livers were perfused with Krebs-Henseleit buffer with or without ANP or its second messenger analogue 8-Bromo cyclic guanosine monophosphate (8-Br cgmp) for 20 min, stored in cold University of Wisconsin solution (24 h), and reperfused for up to 120 min. Apoptosis and necrosis were determined using biochemical and morphological criteria, proliferation was assessed by Ki67 histochemistry. Results: Apoptosis peaked after 24 h of cold ischemia. Preconditioning with both ANP and 8-Br-cGMP significantly reduced caspase-3-like activity and the number of triphosphate nick-end labelling-positive cells. Reduction of apoptosis was significant for hepatocytes, but not for endothelial cells. After ischemia, degenerative cell changes were clearly reduced in ANP pretreated livers. After reperfusion, ANP preconditioning led to a significant reduction of necrotic hepatocytes and endothelial cells in periportal zones. Cell proliferation was not affected by preconditioning. Conclusions: ANP reduces necrotic and apoptotic cell death without affecting the proliferation status. The protection takes place mainly in the periportal area and seems to be most prominent against necrosis of hepatocytes and endothelial cells during reperfusion. q 2003 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. Keywords: Hormonal preconditioning; Liver transplantation; cgmp; Ischemia-reperfusion 1. Introduction Ischemia-reperfusion injury (IRI) is the main cause of primary dysfunction or non-function after liver resection or transplantation. Therefore, it is of great clinical interest to elucidate the underlying pathomechanisms and to develop protective strategies [1]. IRI is caused by a combination of cellular changes in the ischemic period and the consecutive reperfusion period Received 28 August 2002; received in revised form 18 March 2003; accepted 5 May 2003 * Corresponding author. Tel.: þ ; fax: þ address: (A.L. Gerbes). where blood flow and oxygen supply is restored. In the ischemic phase, reduced energy status leads to a breakdown of energy-dependent metabolic pathways and transport processes, resulting in perturbation of ion homeostasis and activation of proteases [2 5]. In organ transplantation, hypothermic storage itself causes negative effects like cell swelling and calcium alterations despite the beneficial properties of low temperatures to prolong the possible storing time by reducing the metabolic rate [6,7]. Sinusoidal endothelial cells (SEC) seem to be more susceptible to cold ischemia than hepatocytes [8] and contribute to reduced organ viability by detaching from their cellular matrix at the beginning of reperfusion [9]. When oxygen supply is restored in the reperfusion /03/$30.00 q 2003 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. doi: /s (03)00240-x

2 342 T. Gerwig et al. / Journal of Hepatology 39 (2003) period, Kupffer cells are rapidly activated and are regarded as central mediators of hepatic IRI [1,10,11]. They release reactive oxygen species and activate a variety of mediators including platelet activating factor, interleukins, tumor necrosis factor (TNF)-a, transcription factors, and adhesion molecules [12 15], leading to microcirculatory failure and manifestation of IRI. IRI was originally considered to be due to a necrotic type of cell death. However, there is increasing evidence for a role of apoptotic cell death in IRI of heart and brain [16,17]. Apoptosis is defined by morphological criteria [18]. These comprise nuclear fragmentation with chromatin condensation and cell shrinkage followed by fragmentation into membrane bound apoptotic bodies. Recent studies reported apoptotic cell death of SEC and hepatocytes during reperfusion of the liver [19,20]. The significance of apoptosis for warm or cold [21,22] hepatic IRI, however, has been questioned. Recently, we demonstrated that hormonal preconditioning with the atrial natriuretic peptide (ANP) protects the liver from IRI after both warm and cold [23,24] ischemia. ANP mediates its hepatoprotective action via the guanylatecyclase coupled A-receptor, attenuating the inflammatory response of IRI [14]. The activation of a heat shock response might contribute to its anti-inflammatory potential [25]. Stimulated by the increasing discussion of the role of apoptosis for hepatic IRI we here focussed on the occurrence of apoptotic compared to necrotic cell death using the model of the isolated perfused rat liver. We characterized apoptotic cell death in addition to necrotic cell death in hepatocytes and SEC and determined the effects of ANP. In addition, we assessed the hepatocyte proliferation state to investigate a potential effect of preconditioning on liver regeneration. 2. Materials and methods 2.1. Materials Rat ANP was obtained from Calbiochem/Novabiochem (Bad Soden, Germany), Narcoren w from Merial (Hallbergmoos, Germany), Complete w from Roche Diagnostics GmbH (Mannheim, Germany), N-acetyl-Asp-Glu-Val-Asp-7-amino-4-trifluoromethyl-coumarin (Ac-DEVD-AFC) from Biosource (Hamburg, Germany), anti-caspase-3 antibody (sc-7148, rabbit) from Santa Cruz Biotechnology (Heidelberg, Germany), and Pefabloc w SC from Biomol GmbH (Hamburg, Germany). All other materials were purchased from Sigma (Taufkirchen, Germany) Liver perfusion Male Sprague Dawley rats weighing g were purchased from Charles River GmbH (Sulzfeld, Germany) and housed in a climatized room with a 12-h light-dark cycle. The animals had free access to chow (Standard-Diet, Altromin 1314 Lage, Germany) and water. After anaesthetizing the animals with Narcoren w (50 mg/kg body weight, intraperitoneally), the livers were perfused via the portal vein in situ with a bicarbonate buffered Krebs-Henseleit (KH) solution (ph 7.4, 378C) gassed with 95% O 2 and 5% CO 2, as described previously [14,23,24]. The perfusion medium was pumped through the livers at a constant flow rate of ml min 21 g liver 21 in a non-recirculating fashion. After 30 min of perfusion with KH buffer, livers were perfused with cold (48C) University of Wisconsin (UW) solution (DuPont, Bad Homburg, Germany) for 1 min. The organs were then kept in UW solution at 48C for 24 h. Pretreatment was performed by adding ANP (200 nm) or 8-Br-cGMP (50 mm) to the pre-ischemic perfusate for 20 min until ischemia and to the storage solution. Livers were reperfused with KH buffer for up to 2 h. At the indicated times, livers were snap-frozen and stored at 2808C until further analysis. Unless stated otherwise, four to five independent experiments were performed. All animals received humane care. The study was registered with the local animal welfare committee Determination of apoptosis and necrosis To distinguish apoptotic from necrotic cell death, commonly used biochemical methods in combination with morphological evaluation were used [21,26]. As parameters for apoptotic cell death, caspase-3-like activity in combination with caspase-3 protein processing and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labelling (TUNEL) were determined. Morphological criteria were cell shrinkage, chromatin condensation and margination, and the occurrence of apoptotic bodies. Necrotic cell death was characterized morphologically by hematoxylin and eosin (HE) staining and trypan blue uptake into injured cells Measurement of caspase-3-like activity Cytosolic extracts from liver tissue were prepared by homogenization in hypotonic extraction buffer (25 mmol/l HEPES, ph 7.5; 5 mmol/l MgCl 2 ; 1 mmol/l EGTA; 1 mmol/l Pefablock w SC; and pepstatin, leupeptin, and aprotinin, 1 mg/ml each) in a Potter device (Braun, Melsungen, Germany.). Homogenates were subsequently centrifuged, and supernatants were stored at 2808C. The fluorometric Ac-DEVD-AFC cleavage assay was carried out on microtiter plates (Greiner, Nürtingen, Germany) according to the method originally described by Nicholson et al. [27]. Cytosolic extracts (10 ml,,1 mg/ml protein) were diluted 1:10 with substrate buffer (55 mmol/l of fluorogenic substrate N-acetyl-Asp-Glu-Val-Asp-7-amino- 4-trifluoromethyl-coumarin in 50 mmol/l HEPES, ph 7.4, 1% sucrose, 0.1% CHAPS, 10 mmol/l dithiothreitol). Blanks contained 10 ml of extraction buffer and 90 ml of substrate buffer. Generation of free 7-amino-4-trifluoro-methylcoumarin at 378C was kinetically determined using a fluorometer plate reader (excitation, 385 nm; emission, 505 nm) (Fluostar, BMG GmbH, Offenburg, Germany). Enzyme activity was calculated using an external AFC standard curve. The highest enzyme activity measured was set to 100%. Protein concentrations of the samples were estimated with the Pierce Assay (Pierce, Rockford, USA). Control experiments confirmed that the activity was linear with time and with protein concentration under the conditions described above Western blot analysis of caspase-3 processing Deep-frozen liver samples were lysed in 150 mm NaCl, 50 mm Tris HCl, ph 7.5, 1% Nonidet P-40, 0.25 deoxycholate, 0.1% sodium dodecyl sulfate (SDS) supplemented with a protease inhibitor cocktail (Complete w ). The protein concentration was determined as described by Lowry et al. [28]. UW solution in the dilution employed did not affect protein determination. Equal amounts of liver lysates (50 mg) were loaded onto an SDS/polyacrylamide gel electrophoresis (10%), electroblotted onto a PVDF membrane (Millipore, Eschwege, Germany), and caspase-3 precursor (CPP32) and proteolytic active subunit (p17) were detected using a specific rabbit polyclonal anti-caspase-3 antibody (sc-7148, rabbit) from Santa Cruz (Heidelberg, Germany) and the Renaissance A chemiluminescence reagent plus (NEN Lifescience, Cologne, Germany) with a KODAK Image Station 440CF (Eastman Kodak Company, Rocester, New York, USA) TUNEL analysis To determine strand brakes of genomic DNA cells were stained with the TUNEL-assay [29]: at indicated time points liver samples were taken and slices were immediately fixed in buffered formalin solution (4% formaldehyde). Samples were embedded in paraffin and cut into 6 mm sections. For evaluation of apoptotic cells liver sections were stained with

3 T. Gerwig et al. / Journal of Hepatology 39 (2003) Statistics All data are expressed as mean and standard error of mean. The significance of differences between experimental groups was determined by one-way ANOVA or with Student s t-test. P, 0:05 was considered statistically significant. Analyzes were performed with GraphPad Prism, San Diego, USA. 3. Results 3.1. ANP and 8-Br-cGMP preconditioning reduce caspase-3-like activity and caspase-3 processing A maximum of caspase-3 like activity was seen after 24 h of cold ischemia. During reperfusion, caspase-3 like activity decreased to the basal levels of blood-free perfused control livers. Preconditioning with ANP significantly reduced caspase-3 like activity by 53% after 24 h of cold ischemia and by 52% after 45 min of reperfusion in Fig. 1. ANP and 8-Br-cGMP preconditioning reduce caspase-3-like activity. At indicated time points (0 0 : shortly perfused, no ischemia; 24 h isch.: 24 h of cold ischemia; 45 0 rep.: 45 min of reperfusion; rep.: 120 min of reperfusion) control livers and pre-treated livers (ANP 200 nm: panel A, 8-Br-cGMP 50 mm: panel B) were snap frozen and caspase-3-like activity was measured as described under Section 2. Data are expressed as percentage of the highest activity. Columns show mean 6 SEM of two to three independent experiments with four to five rat livers. *P <0.05 versus control, # P<0.05 versus 0 0. the ApopTag w Peroxidase In Situ Apoptosis Detection Kit (Intergen Company, Purchase, New York, USA). 10 high-power fields were counted (1.96 mm 2, approximately 4000 hepatocytes) using a Zeiss Axiolab microscope. The ApopTag w staining results were evaluated in combination with morphological criteria. All histological evaluations were performed in a blinded fashion Histological analysis of liver tissue Paraffin embedded livers were cut into 6 mm sections. HE staining was performed using a standard protocol. Proliferating cells were identified by staining of liver sections with a monoclonal Ki67-antibody (Dianova, dia-5055, Hamburg, Germany), which were pretreated for 30 min with Protex I (Quartett, Berlin, Germany). Ten mid-power fields were counted (approximately 10,000 hepatocytes). Trypan blue uptake of necrotic cells was evaluated at the end of the 2-h reperfusion period. Livers were perfused with trypan blue (0.2 mmol/l) for 10 min and fixed with formalin (1.5%) during a 5-min perfusion. The liver tissue was embedded in paraffin and stained with eosin. Ten high power fields (1.5 mm 2, approximately 3100 hepatocytes) were counted. The percentage of trypan blue stained cells around randomly chosen central and portal veins was determined. All histological evaluations were performed without knowledge from which groups samples were taken from. Fig. 2. Reduced processing of caspase-3 in ANP pre-treated livers. At indicated time points (0 0 : shortly perfused, no ischemia; 24 h isch.: 24 h of cold ischemia; rep.: 120 min of reperfusion) control livers and pre-treated livers (ANP 200 nm) were snap frozen. Western blot with caspase-3 antibody was performed as described under Section 2. CPP32: caspase-3 precursor; p17: proteolytic active subunit. Data show one representative blot out of three independent experiments (mean 6 SEM) with two to three rat livers. Panel A: Western blot; panel B: densitometric analysis of CPP32; panel C: densitometric analysis of p17. *P <0.01 versus control, # P<0.05 versus 0 0.

4 344 T. Gerwig et al. / Journal of Hepatology 39 (2003) Fig. 3. (A) Morphological characteristics of apoptotic cell death. As described in detail under Section 2, apoptotic cell death was determined by biochemical and morphological techniques in order to clearly discriminate from necrotic cell death. The picture shows one representive TUNEL staining after 24 h of cold ischemia. Morphological criteria of apoptosis in TUNEL stained hepatocytes were cell shrinkage, chromatin condensation and margination, and the occurrence of apoptotic bodies. Original magnification: 400-fold. (B) ANP and 8-Br-cGMP preconditioning decrease proportion of apoptotic cells after ischemia. At indicated time points (0 0 : shortly perfused, no ischemia; 24 h isch.: 24 h of cold ischemia; 45 0 rep.: 45 min of reperfusion; rep.: 120 min of reperfusion) control livers and pre-treated livers (ANP 200 nm: panel A, 8-Br-cGMP 50 mm: panel B) were snap frozen and prepared for TUNEL analysis as described under Section 2. Columns show numbers of apoptotic cells (mean 6 SEM, with mean in numerical values) in four to five rat livers. Ten high power fields (1.96 mm 2, approx hepatocytes) were counted at a magnification of 400-fold. *P <0.05 versus control, # P<0.05 versus 0 0. comparison to control livers (Fig. 1, panel A). Perfusion of livers with 8-Br-cGMP, an analogue of the second messenger of ANP, showed a similar significant reduction of caspase-3 like activity after 24 h of cold ischemia. The extent of inhibition after ischemia and 45 min of reperfusion was 51 and 61%, respectively (Fig. 1, panel B). Western blot analysis was performed to detect caspase-3 protein cleavage. In pre-ischemic liver homogenates, caspase-3 precursor CPP32 was clearly detectable in contrast to its cleavage product p17, the proteolytic active subunit. After 24 h of cold ischemia both precursor and proteolytic active subunit increased to a maximum indicating highest enzyme activity. At 120 min of reperfusion, only small amounts of precursor and p17 cleavage product were detectable. Preconditioning with ANP (Fig. 2, panels A, B and C)

5 T. Gerwig et al. / Journal of Hepatology 39 (2003) of TUNEL positive hepatocytes after 24 h of cold ischemia by 37% and 28%, respectively. TUNEL staining of endothelial cells was not affected by ANP nor by 8-Br-cGMP (Fig. 3B) Decreased degenerative changes in ANP pre-treated livers HE staining of cold preserved livers displayed significant evidence of cell injury. Hepatocytes showed large, clear vacuoles within the cytoplasm. Moderate swelling and loosening of intercellular attachments was visible with predominant location in the periportal area. ANP pretreatment decreased degenerative changes with less vacuolization and improved cellular integrity (Fig. 4) ANP preconditioning attenuates necrosis Fig. 4. Degenerative changes of hepatocytes are decreased by ANP pretreatment. After 24 h of preservation in UW solution, liver slices were fixed in formalin solution (1.5%) and embedded in paraffin. HE staining was performed using a standard protocol. (A) Arrows show cytoplasmatic vacuolization as an indicator of degenerative cell damage in a representative control liver. (B) Representative picture of an ANP-pretreated liver (200 nm). Original magnification: 400-fold. diminished the amount of caspase-3 precursor CPP32 and the active p17 subunit compared to control livers after 24 h of cold ischemia ANP and 8-Br-cGMP preconditioning decrease the proportion of TUNEL-positive cells TUNEL staining of liver sections at the beginning of perfusion showed only few TUNEL positive hepatocytes and endothelial cells with characteristic morphology for apoptosis. After 24 h of cold ischemia proportion of TUNEL positive hepatocytes increased significantly. Endothelial cells showed a similar time pattern for TUNEL staining. Apoptotic cells accounted for ^ 0.05% in control livers after 24 h of cold ischemia. Preconditioning with ANP as well as with 8-Br-cGMP reduced the number Histological analysis of livers perfused with trypan blue at the end of the 2-h reperfusion period revealed increased staining of liver cells, demonstrating necrotic cell death. The extent of necrosis was calculated to be 10.9 ^ 2.4% for hepatocytes and 17.2 ^ 2.4% for endothelial cells in periportal liver areas. Pericentrally, 10.3 ^ 1.3% of hepatocytes and 13.1 ^ 1.2% of endothelial cells were necrotic. Pre-treatment with ANP significantly reduced trypan blue uptake in hepatocytes by about 75% in periportal but not in pericentral areas. Similarly, endothelial cells were markedly protected by ANP preconditioning by about 87% in periportal but not in pericentral areas (Fig. 5, panels A and B) No influence of ANP on liver proliferation Histochemical Ki67 antigen staining revealed a large increase of proliferation after cold storage. No changes of proliferation were detected in ANP pre-treated livers compared to control organs (Fig. 6). 4. Discussion To further elucidate the mechanisms of ANP mediated protection against IRI of the isolated perfused rat liver this work specifically investigated necrotic and apoptotic cell death. Our study provides the following novel findings: (1) ANP attenuates apoptotic cell damage. (2) Cold ischemia induces procaspase-3. (3) ANP reduces ischemic degenerative cell changes. (4) During reperfusion, necrotic cell damage is decreased by ANP predominantly in periportal areas. (5) Liver proliferation is not affected by ANP pretreatment. (6) In our model of IRI in isolated perfused rat liver necrotic cell damage prevails over apoptosis.

6 346 T. Gerwig et al. / Journal of Hepatology 39 (2003) Mode of cell death in this model of cold liver ischemia and reperfusion Fig. 5. Necrotic damage during reperfusion is reduced by ANP preconditioning in hepatocytes. After 24 h of preservation in UW solution and 2 h of reperfusion with KH buffer, livers were perfused with trypan blue (0.2 mmol/l) for 10 min and fixed with formalin (1.5%) during a 5-min perfusion as described under Section 2. Panel A: percentage of necrotic hepatocytes in periportal and pericentral areas, panel B: percentage of necrotic endothelial cells. Columns show the percentage of trypan blue stained cells around randomly selected central and portal veins. Magnification 400-fold (mean 6 SEM of four to five different rat livers). *P <0.001 versus control. Fig. 6. No influence of ANP on liver proliferation. At indicated time points (0 0 : shortly perfused, no ischemia; 24 h isch.: 24 h of cold ischemia; 45 0 rep.: 45 min of reperfusion; rep.: 120 min of reperfusion) control livers and pre-treated liver slices (ANP 200 nm) were fixed in formalin solution (1.5%) and embedded in paraffin. Histochemical detection of the proliferation marker Ki67 was performed as described under Section 2. Data (mean 6 SEM) show percentage of Ki67-positive cells per 10 midpower fields (approximately 10,000 hepatocytes). Four to five different rat livers were counted. There were no significant differences versus untreated control livers. # P<0.01 versus 0 0. We evaluated necrotic and apoptotic cell death by common biochemical and histological techniques [26], and regarding zonal and cellular aspects. In addition, morphological criteria were taken into account for a detailed identification of the respective kind of cell death [21]: cells had to show characteristic cell shrinkage, chromatin condensation and margination, and the occurrence of apoptotic bodies to be defined as apoptotic. Furthermore, conditions of the TUNEL assay were chosen with no background staining. In view of increasing controversy over the role of apoptosis in hepatic IRI [21], we aimed at unequivocal identification of apoptotic cells. Cells were counted as necrotic when showing increased eosinophilia, vacuolization, cell disruption, loss of architecture and karyolysis. These investigations were performed in a blinded fashion. Apoptotic cell death was highest after 24 h of cold ischemia. This demonstrates an activation of the apoptotic cascade already during the ischemic period supporting the observations of Rentsch et al. [30]. TUNEL analysis revealed that mainly hepatocytes were affected, whereas SEC showed only minor damage. Our finding is in contrast to other groups, who regard SEC as the main target of reperfusion injury [31], but results similar to ours were also found by others [30]. Apoptotic cell death comprised about 0.8% of total cells, less than one tenth of the proportion of necrotic cells. This points to a minor relevance of apoptosis in our model of IRI [22]. Again, our findings are in contrast to Claviens group [19]. This discrepancy could be due to differences between isolated perfused livers and in vivo experiments. However, also recent in-vivo observations support a minor role of apoptosis [22]. Finally, we decided to perform our study with the experimental conditions previously used to describe hepatoprotection by ANP. This model of isolated perfusion is not affected by systemic effects and can thus focus on intrahepatic mechanisms. To evaluate necrosis, trypan blue uptake into damaged cells was investigated. This dye is selectively taken up by injured cells and is commonly regarded as an indicator of necrotic cell death [32]. After 2 h of reperfusion both periportal and pericentral regions of trypan blue perfused livers showed necrotic changes in hepatocytes and SEC. The evaluation of the degree of necrotic cell death suggests its dominant role in liver injury: about 11% of hepatocytes and 17% of endothelial cells were damaged and therefore necrosis seems to be more relevant than apoptotic damage in this experimental model Reduction of apoptosis by ANP treatment Preconditioning with ANP led to a significant reduction of apoptosis that was most prominent after 24 h of cold

7 T. Gerwig et al. / Journal of Hepatology 39 (2003) ischemia. Protection affected predominantly hepatocytes, whereas apoptosis of SEC was not influenced by ANP. Interestingly, preconditioning of livers with 8-Br-cGMP resulted in a similar reduction of apoptosis. This analogue of ANP s second messenger cgmp has previously been shown to mimic ANP action on liver protection, suggesting a cgmp-mediated mechanism [24]. Preconditioning with either compound reduced apoptotic cell death after 24 h of ischemia by half Caspase-3 upregulation during cold ischemia Interestingly, Western blot analysis revealed a significant increase of caspase-3 precursor CPP32 during the ischemic period. Recently, a transcriptional [33] and translational [34] caspase-3 induction was demonstrated in a rat model of focal cerebral ischemia. The occurrence of such energydependent processes at 48C may be surprising. Indeed, the possibility of transcriptional induction in cold ischemia has been shown for other genes before: despite substrate depletion and reduced metabolism, endothelin-1 is upregulated in the preserved kidney [35]. In addition, there are clear evidences for metabolic activity in cold ischemia as demonstrated by stimulation of stress-activated protein kinases [36,37]. Surprisingly, the amount of caspase-3 precursor CPP32 declined during reperfusion period. This might be explained by the non-recirculating perfusion system employed, leading to removal of apoptotic cells by wash-out ANP reduces early degenerative cell changes HE staining of ischemic livers before reperfusion did not identify necrotic cells, but revealed loss of cell integrity and increased vacuolization. These reversible, predominantly periportal changes seem to progress necrotic cell death in the reperfusion period. ANP revealed its protective potential already after 24 h of cold ischemia by clearly reducing these features of cell degeneration Zonal distribution of hepatoprotection Preconditioning with ANP markedly reduced necrotic damage after 2 h of reperfusion. This protection may be mediated by the property of ANP to prevent cell damage caused by activated Kupffer cells (KC) [38]. Indeed, the zonal pattern of protection seems to depend on the regional distribution of Kupffer cells: these macrophages are predominantly localized in periportal liver areas and periportal KC show higher activity than KC from perivenous areas [39,40]. These findings can explain the zonal distribution of ANP mediated protection No influence of ANP on liver proliferation After orthotopic liver transplantation regenerative pathways are initiated in order to compensate the injury sustained from ischemia and reperfusion [41]. As yet, there is little information about proliferation after cold ischemia and during early reperfusion. We have observed a marked increase of proliferation after ischemia, accounting for 3 5% of hepatocytes. ANP preconditioning did not influence the proliferative response of the organ. Effects at intervals of reperfusion longer than investigated here cannot be excluded by our experiments. The finding that ANP reduces apoptotic together with necrotic cell death in the liver represents a novel aspect of ANP action. ANP has been reported to induce apoptosis in cardiac myocytes of rats [42], whereas ANP protected rat PC12 cells from apoptosis [43]. This suggests a highly celltype specific regulation of apoptotic processes exerted by ANP. Regarding hepatocytes induction of p38 mitogenactivated protein kinase (MAPK) attenuates apoptotic cell death [44]. Interestingly, we recently demonstrated a strong increase of p38 MAPK activity by preconditioning rat livers with ANP [37]. Furthermore, induction of heat shock protein hsp70, which suppresses apoptosis in hepatocytes [45] is another consequence of ANP preconditioning [25]. In conclusion, ANP preconditioning leads to a marked protection against hepatic IRI. Interestingly, apoptosis as well as necrosis are affected making this compound unique in modulating different modes of cell death. In isolated perfused liver, ANP protects most prominently against necrosis of hepatocytes and endothelial cells in periportal zones. Acknowledgements The excellent technical assistance of Ingrid Lib and Andrea Sendelhofert is gratefully acknowledged. This work was supported by the Deutsche Forschungsgemeinschaft (DFG: Ge 576/14-2 and FOR 440/1, TP2). References [1] Bilzer M, Gerbes AL. Preservation injury of the liver: mechanisms and novel therapeutic strategies. J Hepatol 2000;32: [2] Rosser BG, Gores GJ. Liver cell necrosis: cellular mechanisms and clinical implications. Gastroenterology 1995;108: [3] Takei Y, Gao WS, Hijioka T, Savier E, Lindert KA, Lemasters JJ, et al. Increase in survival of liver grafts after rinsing with warm Ringer s solution due to improvement of hepatic microcirculation. Transplantation 1991;52: [4] Upadhya AG, Harvey RP, Howard TK, Lowell JA, Shenoy S, Strasberg SM. Evidence of a role for matrix metalloproteinases in cold preservation injury of the liver in humans and in the rat. Hepatology 1997;26: [5] Calmus Y, Cynober L, Dousset B, Lim SK, Soubrane O, Conti F, et al. Evidence for the detrimental role of proteolysis during liver preservation in humans. Gastroenterology 1995;108: [6] Hansen TN, Dawson PE, Brockbank KG. Effects of hypothermia upon

8 348 T. Gerwig et al. / Journal of Hepatology 39 (2003) endothelial cells: mechanisms and clinical importance. Cryobiology 1994;31: [7] Marsh DC, Lindell SL, Fox LE, Belzer FO, Southard JH. Hypothermic preservation of hepatocytes. I. Role of cell swelling. Cryobiology 1989;26: [8] Otto G, Wolff H, David H. Preservation damage in liver transplantation: electron-microscopic findings. Transplant Proc 1984;16: [9] McKeown CM, Edwards V, Phillips MJ, Harvey PR, Petrunka CN, Strasberg SM. Sinusoidal lining cell damage: the critical injury in cold preservation of liver allografts in the rat. Transplantation 1988;46: [10] Mochida S, Arai M, Ohno A, Masaki N, Ogata I, Fujiwara K. Oxidative stress in hepatocytes and stimulatory state of Kupffer cells after reperfusion differ between warm and cold ischemia in rats. Liver 1994;14: [11] Wanner GA, Ertel W, Muller P, Hofer Y, Leiderer R, Menger MD, et al. Liver ischemia and reperfusion induces a systemic inflammatory response through Kupffer cell activation. Shock 1996;5: [12] Zhou W, McCollum MO, Levine BA, Olson MS. Inflammation and platelet-activating factor production during hepatic ischemia/ reperfusion. Hepatology 1992;16: [13] Le Moine O, Louis H, Stordeur P, Collet JM, Goldman M, Deviere J. Role of reactive oxygen intermediates in interleukin 10 release after cold liver ischemia and reperfusion in mice. Gastroenterology 1997; 113: [14] Kiemer AK, Vollmar AM, Bilzer M, Gerwig T, Gerbes AL. Atrial natriuretic peptide reduces expression of TNF-alpha mrna during reperfusion of the rat liver upon decreased activation of NF-kappaB and AP-1. J Hepatol 2000;33: [15] Jaeschke H, Smith CW, Clemens MG, Ganey PE, Roth RA. Mechanisms of inflammatory liver injury: adhesion molecules and cytotoxicity of neutrophils. Toxicol Appl Pharmacol 1996;139: [16] Gottlieb RA, Burleson KO, Kloner RA, Babior BM, Engler RL. Reperfusion injury induces apoptosis in rabbit cardiomyocytes. J Clin Invest 1994;94: [17] Edwards AD, Mehmet H. Apoptosis in perinatal hypoxic-ischaemic cerebral damage. Neuropathol Appl Neurobiol 1996;22: [18] Leist M, Jaattela M. Four deaths and a funeral: from caspases to alternative mechanisms. Nat Rev Mol Cell Biol 2001;2: [19] Gao W, Bentley RC, Madden JF, Clavien PA. Apoptosis of sinusoidal endothelial cells is a critical mechanism of preservation injury in rat liver transplantation. Hepatology 1998;27: [20] Kohli V, Selzner M, Madden JF, Bentley RC, Clavien PA. Endothelial cell and hepatocyte deaths occur by apoptosis after ischemiareperfusion injury in the rat liver. Transplantation 1999;67: [21] Gujral JS, Bucci TJ, Farhood A, Jaeschke H. Mechanism of cell death during warm hepatic ischemia-reperfusion in rats: apoptosis or necrosis? Hepatology 2001;33: [22] Redaelli CA, Tian YH, Schaffner T, Ledermann M, Baer HU, Dufour JF. Extended preservation of rat liver graft by induction of heme oxygenase-1. Hepatology 2002;35: [23] Bilzer M, Witthaut R, Paumgartner G, Gerbes AL. Prevention of ischemia/reperfusion injury in the rat liver by atrial natriuretic peptide. Gastroenterology 1994;106: [24] Gerbes AL, Vollmar AM, Kiemer AK, Bilzer M. The guanylate cyclase-coupled natriuretic peptide receptor: a new target for prevention of cold ischemia-reperfusion damage of the rat liver. Hepatology 1998;28: [25] Kiemer AK, Gerbes AL, Bilzer M, Vollmar AM. The atrial natriuretic peptide and cgmp: novel activators of the heat shock response in rat livers. Hepatology 2002;35: [26] Miyoshi H, Rust C, Roberts PJ, Burgart LJ, Gores GJ. Hepatocyte apoptosis after bile duct ligation in the mouse involves Fas. Gastroenterology 1999;117: [27] Nicholson DW, Ali A, Thornberry NA, Vaillancourt JP, Ding CK, Gallant M, et al. Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis. Nature 1995;376: [28] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193: [29] Gavrieli Y, Sherman Y, Ben Sasson SA. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 1992;119: [30] Rentsch M, Beham A, Iesalnieks I, Mirwald T, Anthuber M, Jauch KW. Impact of prolonged cold ischemia and reperfusion on apoptosis, activation of caspase 3, and expression of bax after liver transplantation in the rat. Transplant Proc 2001;33: [31] Natori S, Selzner M, Valentino KL, Fritz LC, Srinivasan A, Clavien PA, et al. Apoptosis of sinusoidal endothelial cells occurs during liver preservation injury by a caspase-dependent mechanism. Transplantation 1999;68: [32] Belinsky SA, Popp JA, Kauffman FC, Thurman RG. Trypan blue uptake as a new method to investigate hepatotoxicity in periportal and pericentral regions of the liver lobule: studies with allyl alcohol in the perfused liver. J Pharmacol Exp Ther 1984;230: [33] Harrison DC, Davis RP, Bond BC, Campbell CA, James MF, Parsons AA, et al. Caspase mrna expression in a rat model of focal cerebral ischemia. Brain Res Mol Brain Res 2001;89: [34] Krupinski J, Lopez E, Marti E, Ferrer I. Expression of caspases and their substrates in the rat model of focal cerebral ischemia. Neurobiol Dis 2000;7: [35] Wilhelm SM, Simonson MS, Robinson AV, Stowe NT, Schulak JA. Cold ischemia induces endothelin gene upregulation in the preserved kidney. J Surg Res 1999;85: [36] Crenesse D, Gugenheim J, Hornoy J, Tornieri K, Laurens M, Cambien B, et al. Protein kinase activation by warm and cold hypoxiareoxygenation in primary-cultured rat hepatocytes-jnk(1)/sapk(1) involvement in apoptosis. Hepatology 2000;32: [37] Kiemer AK, Heinze SK, Gerwig T, Gerbes AL, Vollmar AM. Stimulation of p38 MAPK by hormonal preconditioning with atrial natriuretic peptide. World J Gastroenterol 2002;8: [38] Bilzer M, Jaeschke H, Vollmar AM, Paumgartner G, Gerbes AL. Prevention of Kupffer cell-induced oxidant injury in rat liver by atrial natriuretic peptide. Am J Physiol 1999;276:G1137 G1144. [39] Vollmar B, Glasz J, Post S, Menger MD. Depressed phagocytic activity of Kupffer cells after warm ischemia-reperfusion of the liver. J Hepatol 1994;20: [40] Sleyster EC, Knook DL. Relation between localization and function of rat liver Kupffer cells. Lab Invest 1982;47: [41] Olthoff KM. Molecular pathways of regeneration and repair after liver transplantation. World J Surg 2002;26: [42] Filippatos GS, Gangopadhyay N, Lalude O, Parameswaran N, Said SI, Spielman W, et al. Regulation of apoptosis by vasoactive peptides. Am J Physiol Lung Cell Mol Physiol 2001;281:L749 L761. [43] Fiscus RR, Tu AW, Chew SB. Natriuretic peptides inhibit apoptosis and prolong the survival of serum-deprived PC12 cells. Neuroreport 2001;12: [44] Roberts RA, James NH, Cosulich SC. The role of protein kinase B and mitogen-activated protein kinase in epidermal growth factor and tumor necrosis factor alpha-mediated rat hepatocyte survival and apoptosis. Hepatology 2000;31: [45] Ikeyama S, Kusumoto K, Miyake H, Rokutan K, Tashiro S. A nontoxic heat shock protein 70 inducer, geranylgeranylacetone, suppresses apoptosis of cultured rat hepatocytes caused by hydrogen peroxide and ethanol. J Hepatol 2001;35:53 61.

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Focus Application. Compound-Induced Cytotoxicity

Focus Application. Compound-Induced Cytotoxicity xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity For life science research only. Not for use in diagnostic procedures. Featured Study: Using the Time Resolving

More information

The Need for a PARP in vivo Pharmacodynamic Assay

The Need for a PARP in vivo Pharmacodynamic Assay The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D. Chief Scientific Officer Trevigen, Inc. Gaithersburg, MD Poly(ADP-ribose) polymerases are promising therapeutic targets. In response

More information

Introduction to pathology lecture 5/ Cell injury apoptosis. Dr H Awad 2017/18

Introduction to pathology lecture 5/ Cell injury apoptosis. Dr H Awad 2017/18 Introduction to pathology lecture 5/ Cell injury apoptosis Dr H Awad 2017/18 Apoptosis = programmed cell death = cell suicide= individual cell death Apoptosis cell death induced by a tightly regulated

More information

Anti-Apoptotic Effects of Cellular Therapy

Anti-Apoptotic Effects of Cellular Therapy Anti-Apoptotic Effects of Cellular Therapy Jason Lapetoda 1, Lee K Landeen, PhD 1, George K Michalopoulos, MD 2, Patricia W Bedard, PhD 1 1 Vital Therapies, Inc., San Diego, CA, USA 2 University of Pittsburgh

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

The Groningen hypothermic liver perfusion system for improved preservation in organ transplantation Plaats, Arjan van der

The Groningen hypothermic liver perfusion system for improved preservation in organ transplantation Plaats, Arjan van der University of Groningen The Groningen hypothermic liver perfusion system for improved preservation in organ transplantation Plaats, Arjan van der IMPORTANT NOTE: You are advised to consult the publisher's

More information

Glutathione Peroxidase Assay Kit

Glutathione Peroxidase Assay Kit Glutathione Peroxidase Assay Kit Catalog Number KA0882 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

Do Histological Features Inform DILI mechanisms?

Do Histological Features Inform DILI mechanisms? Do Histological Features Inform DILI mechanisms? Drug-Induced Liver Injury (DILI) Conference XVII June, 2017 David Kleiner, M.D., Ph.D. NCI/Laboratory of Pathology Disclosures No financial or other conflicts

More information

The Annexin V Apoptosis Assay

The Annexin V Apoptosis Assay The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.

More information

Lipid Peroxidation Assay

Lipid Peroxidation Assay Package Insert Lipid Peroxidation Assay 96 Wells For Research Use Only v. 1.0 Eagle Biosciences, Inc. 82 Broad Street, Suite 383, Boston, MA 02110 Phone: 866-419-2019 Fax: 617-419-1110 INTRODUCTION Lipid

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

More information

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor

More information

ab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric)

ab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric) ab156064 Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric) Instructions for Use For the quantitative measurement of Histone Deacetylase activity in cell lysates This product is for research

More information

Collagenase Assay Kit

Collagenase Assay Kit Collagenase Assay Kit Catalog # 31 and 32 For Research Use Only - Not Human or Therapeutic Use INTRODUCTION Collagenases are members of the matrix metalloproteinase (MMP) family and degrade collagen types

More information

SensoLyte 520 Cathepsin K Assay Kit *Fluorimetric*

SensoLyte 520 Cathepsin K Assay Kit *Fluorimetric* SensoLyte 520 Cathepsin K Assay Kit *Fluorimetric* Catalog # 72171 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit is optimized to detect Cathepsin K activity. Enhanced Value: Ample

More information

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal

More information

The Comet and TUNEL Assays

The Comet and TUNEL Assays Sperm DNA: organization, protection and vulnerability from basic science to clinical application Methods to assess the status of the sperm DNA: The Comet and TUNEL Assays Lars Björndahl Centre for Andrology

More information

Instructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests

Instructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests 3URGXFW,QIRUPDWLRQ Sigma TACS Annexin V Apoptosis Detection Kits Instructions for Use APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests For Research Use Only. Not for use in diagnostic procedures.

More information

Dr. Hany M. Abo-Haded

Dr. Hany M. Abo-Haded BY Dr. Hany M. Abo-Haded Pediatric Cardiology Unit, Mansoura Universty Children Hospital, Mansoura, Egypt Co-authors: Dina S El-Agamy and Mohamed A Elkablawy Background Doxorubicin (DOX) is an anthracycline

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Journal Club Semmler Lorenz

Journal Club Semmler Lorenz Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB

Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Kenji Kawamura, Yoshio Kano. Kibi International University, Takahashi-city, Japan. Disclosures: K.

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Purification and biochemical properties of SDS-stable low molecular weight alkaline serine protease from Citrullus Colocynthis Muhammad Bashir Khan, 1,3 Hidayatullah khan, 2 Muhammad

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Pepsin Solution ready-to-use

Pepsin Solution ready-to-use SIE HABEN DIE VISION, WIR HABEN DIE SUBSTANZ. Pepsin Solution Single component Pepsin Solution: only one component refrigerator stable Pepsin is a commonly used digestive enzyme for immunohistochemical

More information

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Melissa Mihelidakis May 6, 2004 7.340 Research Proposal Introduction Apoptosis, or programmed cell

More information

The alleviation of myocardial ischemia/reperfusion injury by lycopene.

The alleviation of myocardial ischemia/reperfusion injury by lycopene. Biomedical Research 2017; 28 (17): 7720-7724 ISSN 0970-938X www.biomedres.info The alleviation of myocardial ischemia/reperfusion injury by lycopene. Zhenjun Liu *, Guangming He, Lili Zhao Intensive Care

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

APPENDIX 1 ETHICAL CLEARANCE

APPENDIX 1 ETHICAL CLEARANCE APPENDIX 1 ETHICAL CLEARANCE 75 APPENDIX 2 76 PROCEDURE FOR PREPARING OF LIVER HISTOLOGY SLIDES Overview: Histology involves the use of a set of techniques to examine the morphology, architecture and composition

More information

SensoLyte Rh110 Cathepsin K Assay Kit *Fluorimetric* Revision#1.2 Last Updated: May 2017 Catalog # Kit Size

SensoLyte Rh110 Cathepsin K Assay Kit *Fluorimetric* Revision#1.2 Last Updated: May 2017 Catalog # Kit Size SensoLyte Rh110 Cathepsin K Assay Kit *Fluorimetric* Revision#1.2 Last Updated: May 2017 Catalog # 72152 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit detects Cathepsin K activity.

More information

HDAC1 Inhibitor Screening Assay Kit

HDAC1 Inhibitor Screening Assay Kit HDAC1 Inhibitor Screening Assay Kit Catalog Number KA1320 96 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

Cell Injury MECHANISMS OF CELL INJURY

Cell Injury MECHANISMS OF CELL INJURY Cell Injury MECHANISMS OF CELL INJURY The cellular response to injurious stimuli depends on the following factors: Type of injury, Its duration, and Its severity. Thus, low doses of toxins or a brief duration

More information

Human PKA (Protein Kinase A) Activity Assay Kit

Human PKA (Protein Kinase A) Activity Assay Kit Human PKA (Protein Kinase A) Activity Assay Kit CATALOG NO: IRAAKT2532 LOT NO: SAMPLE INTENDED USE The PKA (Protein Kinase A) Activity kit is designed to quantitatively measure PKA activity in a variety

More information

Nuclear Extraction Kit

Nuclear Extraction Kit Nuclear Extraction Kit Item No. 10009277 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION 3 Materials

More information

TECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates

TECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Catalog Number RAB0011 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

Global Histone H3 Acetylation Assay Kit

Global Histone H3 Acetylation Assay Kit Global Histone H3 Acetylation Assay Kit Catalog Number KA0633 96 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle

More information

Oxidative Stress in PGE2 Treated H9c2 Cardiomyocytes. Rose Picklo

Oxidative Stress in PGE2 Treated H9c2 Cardiomyocytes. Rose Picklo Oxidative Stress in PGE2 Treated H9c2 Cardiomyocytes Rose Picklo Abstract Heart disease is the leading cause of adult death in the United States. Chronic ischemia resulting from obstruction of coronary

More information

Method Booklet 3. Apoptosis Applications & Glossary

Method Booklet 3. Apoptosis Applications & Glossary Method Booklet 3 Apoptosis Applications & Glossary Apoptosis Applications & Glossary Table of Contents Introduction................................2 Annexin-V...................................5 Caspases....................................8

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and Supplementary Materials Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS Daryl A. Bosco, Gerardo Morfini, Murat Karabacak, Yuyu Song, Francois Gros-Louis,

More information

Hepatitis B Virus infection: virology

Hepatitis B Virus infection: virology Hepatitis B Virus infection: virology 167 Falk Symposium: Liver under constant attack from fat to viruses III Falk Gastro-Konferenz 17.-21. September 2008 Congress Centrum Mainz Maura Dandri Department

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Supporting Information

Supporting Information Supporting Information Gerasimenko et al..73/pnas.39 SI Materials and Methods Reagents used in this study include Fluo-4/Fura- (Invitrogen), thapsigargin (albiochem), collagenase (Worthington), palmitoleic

More information

Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit

Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit CATALOG NO: IRAAKT2552 LOT NO: SAMPLE INTENDED USE The Hydrogen Peroxide Fluorescent Detection Kit is designed to quantitatively measure H2O2 in

More information

MPO Peroxidation Assay Kit

MPO Peroxidation Assay Kit MPO Peroxidation Assay Kit Catalog Number KA1338 96 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

ab Dipeptidyl peptidase IV (DPP4) Inhibitor Screening Assay Kit

ab Dipeptidyl peptidase IV (DPP4) Inhibitor Screening Assay Kit ab133081 Dipeptidyl peptidase IV (DPP4) Inhibitor Screening Assay Kit Instructions for Use For screening DPP4 inhibitors. This product is for research use only and is not intended for diagnostic use. 1

More information

HT Glutathione Assay Kit

HT Glutathione Assay Kit IFU0 Rev Status: RELEASED printed //0 ::0 AM by Trevigen Document Control Instructions For Research Use Only. Not For Use In Diagnostic Procedures HT Glutathione Assay Kit Colorimetric assay for total,

More information

Lecture 14 - The cell cycle and cell death

Lecture 14 - The cell cycle and cell death 02.17.10 Lecture 14 - The cell cycle and cell death The cell cycle: cells duplicate their contents and divide The cell cycle may be divided into 4 phases The cell cycle triggers essential processes (DNA

More information

PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS

PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS TMM,5-2011 PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS Ice-cold means cooled in ice water. In order to prevent proteolysis, make sure to perform all steps on ice. Pre-cool glass homogenizers, buffers

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

BIOCHEMICAL EXAMINATION OF ACUTE MYOCARDIAL INFARCTION. Written by Lenka Fialová, translated by Jan Pláteník

BIOCHEMICAL EXAMINATION OF ACUTE MYOCARDIAL INFARCTION. Written by Lenka Fialová, translated by Jan Pláteník BIOCHEMICAL EXAMINATION OF ACUTE MYOCARDIAL INFARCTION 1 Structure of heart muscle Written by Lenka Fialová, translated by Jan Pláteník Heart muscle (myocardium) is a particular form of striated muscle,

More information

OxiSelect Malondialdehyde (MDA) Immunoblot Kit

OxiSelect Malondialdehyde (MDA) Immunoblot Kit Product Manual OxiSelect Malondialdehyde (MDA) Immunoblot Kit Catalog Number STA- 331 10 blots FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipid peroxidation is a well-defined

More information

NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update

NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed

More information

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20

More information

ab NF-kB p50/p65 Transcription Factor Assay Kit

ab NF-kB p50/p65 Transcription Factor Assay Kit ab133128 NF-kB p50/p65 Transcription Factor Assay Kit Instructions for Use For the detection of specific transcription factor DNA binding activity in nuclear extracts. This product is for research use

More information

Using the Ch6diak-Higashi Marker

Using the Ch6diak-Higashi Marker A Study of the Origin of Pulmonary Macrophages Using the Ch6diak-Higashi Marker Kent J. Johnson, MD, Peter A. Ward, MD, Gary Striker, MD, and Robin Kunkel, MS Using bone marrow reconstitution techniques

More information

ab E3 Ligase Auto- Ubiquitilylation Assay Kit

ab E3 Ligase Auto- Ubiquitilylation Assay Kit ab139469 E3 Ligase Auto- Ubiquitilylation Assay Kit Instructions for Use For testing ubiquitin E3 ligase activity through assessment of their ability to undergo auto-ubiquitinylation This product is for

More information

Mammalian Cell PE LB

Mammalian Cell PE LB 257PR G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Mammalian Cell PE LB Mammalian Cell Protein Extraction & Lysis Buffer (Cat. # 786 180)

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

TEST REPORT & SPECIFIC INFORMATION

TEST REPORT & SPECIFIC INFORMATION Page 1 (5) Dartsch Scientific GmbHAuf der Voßhardt 25 D-49419 Wagenfeld Firma LuKo Pharm GmbH Mayrwiesstrasse 25-27 A-5300 Hallwang Auf der Voßhardt 25 D-49419 Wagenfeld, Germany Fon: +49 5444 980 1322

More information

Production of Exosomes in a Hollow Fiber Bioreactor

Production of Exosomes in a Hollow Fiber Bioreactor Production of Exosomes in a Hollow Fiber Bioreactor John J S Cadwell, President and CEO, FiberCell Systems Inc INTRODUCTION Exosomes are small lipid membrane vesicles (80-120 nm) of endocytic origin generated

More information

Detection of Apoptosis in Primary Cells by Annexin V Binding Using the Agilent 2100 Bioanalyzer. Application Note

Detection of Apoptosis in Primary Cells by Annexin V Binding Using the Agilent 2100 Bioanalyzer. Application Note Detection of Apoptosis in Primary Cells by Annexin V Binding Using the Agilent 2100 Bioanalyzer Application Note Samuel D. H. Chan Marc Valer and Tobias Preckel, Introduction The Agilent 2100 bioanalyzer

More information

EPIGENTEK. EpiQuik Global Histone H4 Acetylation Assay Kit. Base Catalog # P-4009 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Global Histone H4 Acetylation Assay Kit. Base Catalog # P-4009 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Global Histone H4 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H4 Acetylation Assay Kit is suitable for specifically measuring global

More information

Close to site of release (at synapse); binds to receptors in

Close to site of release (at synapse); binds to receptors in Chapter 18: The Endocrine System Chemical Messengers 1. Neural 2. Endocrine 3. Neuroendocrine 4. Paracrine 5. Autocrine Endocrine System --Endocrine and nervous systems work together --Endocrine vs. Nervous

More information

Free Fatty Acid Assay Kit (Fluorometric)

Free Fatty Acid Assay Kit (Fluorometric) Product Manual Free Fatty Acid Assay Kit (Fluorometric) Catalog Number STA-619 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Triglycerides (TAG) are a type of lipid

More information

* Author to whom correspondence should be addressed; Tel.:

* Author to whom correspondence should be addressed;   Tel.: Molecules 215, 2, 346-343; doi:1.339/molecules22346 Article OPEN ACCESS molecules ISSN 142-349 www.mdpi.com/journal/molecules Anti-Proliferative Effect and Induction of Apoptosis in Androgen-Independent

More information

Slide 7 demonstrates acute pericholangitisis with neutrophils around proliferating bile ducts.

Slide 7 demonstrates acute pericholangitisis with neutrophils around proliferating bile ducts. Many of the histologic images and the tables are from MacSween s Pathology of the Liver (5 th Edition). Other images were used from an online source called PathPedia.com. A few images from other sources

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

See external label 2 C 8 C 96 tests B-HCG (Total) Cat #

See external label 2 C 8 C 96 tests B-HCG (Total) Cat # DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external

More information

Lipase Assay Kit. Catalog Number KA assays Version: 02. Intended for research use only.

Lipase Assay Kit. Catalog Number KA assays Version: 02. Intended for research use only. Lipase Assay Kit Catalog Number KA1654 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Principle of the Assay... 3 General Information...

More information

2-Deoxyglucose Assay Kit (Colorimetric)

2-Deoxyglucose Assay Kit (Colorimetric) 2-Deoxyglucose Assay Kit (Colorimetric) Catalog Number KA3753 100 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Impact of cold ischemia on cytokines after partial liver transplantation in rats

Impact of cold ischemia on cytokines after partial liver transplantation in rats Impact of cold ischemia on cytokines after partial liver transplantation in rats Q.-A. Qi, Z.-Y. Yang, K.-S. Ma, Q. Lu, S.-G. Wang, X.-W. Li, F. Xia, W. Liu and P. Bie Southwest Hospital & Institute of

More information

C57BL/6 Mice are More Appropriate. than BALB/C Mice in Inducing Dilated Cardiomyopathy with Short-Term Doxorubicin Treatment

C57BL/6 Mice are More Appropriate. than BALB/C Mice in Inducing Dilated Cardiomyopathy with Short-Term Doxorubicin Treatment Original Article C57BL/6 Mice are More Appropriate Acta Cardiol Sin 2012;28:236 240 Heart Failure & Cardiomyopathy C57BL/6 Mice are More Appropriate than BALB/C Mice in Inducing Dilated Cardiomyopathy

More information

Motility and eosin uptake of formaldehyde-treated ram

Motility and eosin uptake of formaldehyde-treated ram Motility and eosin uptake of formaldehyde-treated ram spermatozoa O. A. Osinowo, J. O. Bale, E. O. Oyedipe and L. O. Eduvie Department ofanimal Reproduction, National Animal Production Research Institute,

More information

For the rapid, sensitive and accurate detection of Cathepsin D inhibition by various compounds

For the rapid, sensitive and accurate detection of Cathepsin D inhibition by various compounds ab126779 Cathepsin D Inhibitor Screening Kit Instructions for Use For the rapid, sensitive and accurate detection of Cathepsin D inhibition by various compounds This product is for research use only and

More information

DELFIA Eu-DTPA ITC Chelate & Europium Standard

DELFIA Eu-DTPA ITC Chelate & Europium Standard AD0026P-3 (en) 1 DELFIA Eu-DTPA ITC Chelate & AD0021 Europium Standard For Research Use Only INTRODUCTION DELFIA Eu-DTPA ITC Chelate is optimized for the europium labelling of proteins and peptides for

More information

GPx Equation 1 Æ R - O - H + GSSG + H2 O

GPx Equation 1 Æ R - O - H + GSSG + H2 O OXFORD BIOMEDICAL RESEARCH P.O. Box 522, Oxford MI 48371 USA USA: 800-692-4633 Fax: 248-852-4466 www.oxfordbiomed.com Colorimetric Assay for Cellular Glutathione Peroxidase Product No. FR 17 For Research

More information

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary CellSensor HSE-bla HeLa Cell Line Cat. no. K Pathway Description Activation of the heat shock response/unfolded protein response (HSR/UPR) occurs in response to a

More information

were isolated from the freshly drawn blood of healthy donors and ACS patients using the

were isolated from the freshly drawn blood of healthy donors and ACS patients using the Supplemental Figure 1. Quality control of CD4 + T-cell purification. CD4 + T cells were isolated from the freshly drawn blood of healthy donors and ACS patients using the RosetteSep CD4 + T Cell Enrichment

More information

ab Cathepsin K Inhibitor Screening Kit (Fluorometric)

ab Cathepsin K Inhibitor Screening Kit (Fluorometric) ab185439 Cathepsin K Inhibitor Screening Kit (Fluorometric) Instructions for Use For the sensitive and accurate screening of Cathepsin K inhibitors in a variety of samples This product is for research

More information

ab ATP Synthase Enzyme Activity Microplate Assay Kit

ab ATP Synthase Enzyme Activity Microplate Assay Kit ab109714 ATP Synthase Enzyme Activity Microplate Assay Kit Instructions for Use For the quantitative measurement of ATP Synthase activity in samples from Human, Rat and Cow This product is for research

More information

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor

More information

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...

More information

Enhancing the baculovirus expression system with VANKYRIN technology. Kendra Steele, Ph.D.

Enhancing the baculovirus expression system with VANKYRIN technology. Kendra Steele, Ph.D. Enhancing the baculovirus expression system with VANKYRIN technology Kendra Steele, Ph.D. Insect cells Can express mammalian proteins Similarities with mammalian cells Eukaryotic systems How protein are

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

Spontaneous Regression Mechanisms of Lumbar Disc Herniation Role of apoptosis and macrophages during disc tissue resorption

Spontaneous Regression Mechanisms of Lumbar Disc Herniation Role of apoptosis and macrophages during disc tissue resorption Spontaneous Regression Mechanisms of Lumbar Disc Herniation Role of apoptosis and macrophages during disc tissue resorption Shigeru Kobayashi, MD,PhD, 1 Riya Kosaka MD,PhD 2, Adam Meir, FRCS, 2 1 Dept.

More information

Mechanism of Action of N-Acetylcysteine in the Protection Against the Hepatotoxicity of Acetaminophen in Rats In Vivo

Mechanism of Action of N-Acetylcysteine in the Protection Against the Hepatotoxicity of Acetaminophen in Rats In Vivo Mechanism of Action of N-Acetylcysteine in the Protection Against the Hepatotoxicity of Acetaminophen in Rats In Vivo BERNHARD H. LAUTERBURG, GEORGE B. CORCORAN, and JERRY R. MITCHELL, Baylor College of

More information