SUPPLEMENTAL TABLE AND FIGURES
|
|
|
- Reynold Short
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTAL TABLE AND FIGURES Zhang et al. (29) - Enzymes in the NAD + Salvage Pathway Regulate SIRT1 Activity at Target Gene Promoters This document contains supplemental data (1 table and 6 figures) as follows: 1) Table S1. Gene ontology analysis of NAMPT, NMNAT-1, and SIRT1 target genes...2 2) Figure S1. Comparison of different shrna constructs in target protein knockdown and gene expression regulation...5 3) Figure S2. NAD + -independent regulation of gene expression by NAMPT and NMNAT ) Figure S3. Regulation of gene expression by the NAD + -producing enzymes requires their enzymatic activity...7 5) Figure S4. Similar regulation of NAMPT- and NMNAT-1-responsive genes by SIRT ) Figure S5. Recruitment of SIRT1 and NMNAT-1 to ATXN1 and NELL2 genes...9 7) Figure S6. Knockdown of NAMPT and NMNAT-1 did not change SIRT1 recruitment to target gene promoters...1 Page page 1
2 Zhang et al. (Kraus) 29 Table S1. Gene ontology analysis of NAMPT-, NMNAT-1-, and SIRT1-regulated genes. A. NAMPT-Regulated Genes Cell Cycle Regulation % <.34 CCNE2, PLK4, MTSS1 Negative Regulation of % <.367 RDX, AMBP, NSD1 Biological Process 2 Tumor Suppressor % <.26 RB1, FHIT, NF1 Transporter % <.35 SLC4A7, SLC7A8, SLC24A3 B. NMNAT-1-Regulated Genes Development and 38 21% <.142 STX2, GJA1, MID1 Morphogenesis 5 Cell Organization and 3 16% <.31 TRAK1, LIMCH1, RAB14 Biogenesis Neuron Differentiation % <.357 AGRN, NRCAM, RTN1 Cell Signaling % <.491 SNF1LK2, SMAD5, GRB1 Ion Homeostasis % <.466 SLC9A2, CALR, ANXA1 Cell Proliferation % <.498 EPS15, COL4A3, LAMB1 Cell Adhesion % <.486 SGCE, PCDH7, PLEKHC1 Cytoskeletal Protein Binding 1 5.5% <.196 DIAPH2, MAPRE3, TRIM2 Enzyme Inhibitor Activity 8 4.4% <.178 TFPI, CSTA, THBS1 C. NAMPT and NMNAT-1 Commonly Regulated Genes Neuron Differentiation % <.254 SOCS2, RTN1, TGFB2 Cell Signaling % <.461 SMAD5, CXCR7, PLCL1 Cellular Membrane % <.473 SCNN1A, CAV1, ST3GAL5 D. SIRT1-Regulated Genes Cell Signaling % <.484 DUSP8, PPP2R1B, PIK3R1 Metabolism % <.448 GMDS, PGM3, GNE (Table S1 continues on the next page) page 2
3 Zhang et al. (Kraus) 29 Table S1 (continued) E. NAMPT and SIRT1 Commonly Regulated Genes Cellular Membrane % <.45 ITPR1, CAV1, ATP11B Metabolism % <.438 SLC35A3, PGM3, GNE F. NMNAT-1 and SIRT1 Commonly Regulated Genes Cell Adhesion % <.35 LAMB1, THBS1, NELL2 Cellular Membrane % <.321 CAV2, CAV1, ST3GAL5 Metabolism % <.472 SLC35A3, PGM3 Response to Wounding 4 13% <.482 TRGV9, LGALS3BP, TFPI G. NAMPT, NMNAT-1 and SIRT1 Commonly Regulated Genes Cellular Membrane % <.368 CAV2, CAV1, ST3GAL5 Metabolism % <.22 SLC35A3, PGM3 Associated GO terms: 1 Cell cycle, regulation of cell cycle, negative regulation of progression through cell cycle 2 Negative regulation of biological process, negative regulation of physiological process, negative regulation of cellular process, negative regulation of progression through cell cycle 3 Tumor suppressor, negative regulation of progression through cell cycle 4 Porter activity, electrochemical potential-driven transporter activity 5 Morphogenesis, development, organ morphogenesis, organ development, cellular morphogenesis 6 Neuron differentiation, positive regulation of neuron differentiation, neurogenesis, regulation of cell differentiation 7 Receptor binding, response to external stimulus, cell communication, signal transducer activity, transmembrane receptor protein tyrosine kinase signaling pathway, MAPKKK cascade, protein serine/threonine phosphatase activity, negative regulation of signal transduction, regulation of protein kinase activity, negative regulation of MAPK activity 8 Ion homeostasis, metal ion homeostasis, calcium ion binding, clustering of voltage-gated sodium channels, homeostasis 9 Cell proliferation, regulation of cell proliferation, 1 Cell adhesion, basement membrane, basal lamina, extracellular matrix 11 Integral to plasma membrane, intrinsic to plasma membrane, endomembrane system, Golgi membrane, organelle membrane, lipid raft, caveola, caveolar membrane 12 Glucosamine metabolism, UDP-N-acetylglucosamine metabolism, nucleotide-sugar metabolism, amino sugar metabolism (Table S1 continues on the next page) page 3
4 Zhang et al. (Kraus) 29 Table S1 (continued) Methods The gene list for each factor was generated based on a two-tailed Student s t-test, p-value <.5, and filtered using a fold change cutoff of log 2 < -.5 or >.5. Commonly regulated genes were identified by comparing individual gene sets. The gene sets were analyzed for enrichment of GO terms using the Functional Annotation Clustering and Functional Annotation Chart tools from the DAVID Bioinformatics Resources website ( page 4
5 Zhang et al. (Kraus) 29 FIGURES A shrna: Luc NAMPT #1 #2 Luc NMNAT-1 #1 #2 Luc SIRT1 #1 #2 Western blot: NAMPT NMNAT-1 SIRT1 B NAMPT shrna #2 (weaker KD) NMNAT-1 shrna #2 (weaker KD) SIRT1 shrna #2 (weaker KD) c.c. =.563 p = 2.35 x 1-4 NAMPT shrna #1 (stronger KD) c.c. =.636 p = 1.75 x NMNAT-1 shrna #1 (stronger KD) c.c. =.617 p = 3.67 x SIRT1 shrna #1 (stronger KD) Relative Expression Relative Expression Relative Expression Figure S1. Comparison of different shrna constructs in target protein knockdown and regulation of gene expression. For each factor studied (NAMPT, NMNAT-1, and SIRT1), two distinct shrna sequences were examined for target protein knockdown (A) and gene expression regulation (B). The expression levels of 38 genes were determined by RT-qRCR and presented as fold change relative to the luciferase knockdown control cells. For each target protein, the scatter plot (left) shows the expression fold changes of the 38 genes in response to the two different shrnas. The Pearson s correlation coefficient (c.c.) and p-value are indicated. Similarly, the bar graph (right) highlights the expression responses of a subset of the genes. Error bars, SEM; n 3 independent biological replicates STC1 LGALS3BP TFPI ATXN1 NPY1R NAMPT shrna #1 NAMPT shrna #2 POLDIP3 SCGB1D2 CMKOR1 TRGV9 SIAT9 TGFB2 SOCS2 NMNAT-1 shrna #1 NMNAT-1 shrna #2 STC1 NPY1R LGALS3BP PHF3 GLS TFF3 NAT1 PEG1 SOCS2 AREG SIRT1 shrna #1 SIRT1 shrna #2 NPY1R KITLG PKIA POLDIP3 TFF3 TMSNB PEG1 TGFB2 page 5
6 Zhang et al. (Kraus) 29 Relative Expression Luc shrna NAMPT shrna NMNAT-1 shrna NAD + CAV Figure S2. NAD + -independent regulation of gene expression by NAMPT and NMNAT-1. Effect of NAMPT or NMNAT-1 knockdown with or without exogenously added NAD + (1 mm) on the expression of an NAMPT- and NMNAT-1-regulated gene, CAV1. Gene expression levels were determined by RT-qRCR using β-actin as a reference gene. The data are normalized to CAV1 expression levels in the Luciferase (Luc) control cells. Error bars, SEM; n 3 independent biological replicates. page 6
7 Zhang et al. (Kraus) 29 TGFB2 ATXN Fold Change in Expression 1..5 ** 1..5 ** 1..5 ** 1..5 * Re-expression GFP WT Mut GFP WT Mut GFP WT Mut GFP WT Mut shrna Luc NAMPT Luc NMNAT-1 Luc NAMPT Luc NMNAT-1 Figure S3. Regulation of gene expression by the NAD + -producing enzymes requires their enzymatic activity. In the NAMPT and NMNAT-1 knockdown MCF-7 cells, expression levels of TGFB2 and ATXN1 were rescued by re-expression of the respective NAD + -producing enzyme. The expression constructs for NAMPT and NMNAT-1 used in this experiment are RNAi-resistant through introduction of silent mutations in the shrna target sequence. The catalytic mutants used are: NMNAT-1 W169A (1,2) and NAMPT H247A (3). GFP was used as a control for re-expression. The effect of wild type enzymes was compared to that of GFP control using two-tailed Student s t-test: * p<.5, ** p<.1. Error bars represent S.E.M. of at least three independent experiments. page 7
8 Zhang et al. (Kraus) 29 shrna NAMPT NMNAT-1 SIRT1 Log 2 fold change 2-2 Figure S4. Similar regulation of NAMPT- and NMNAT-1-responsive genes by SIRT1. Microarray expression analyses reveal similar expression profiles for 37 commonly regulated NAMPT and NMNAT-1 target genes upon knockdown of SIRT1 in MCF-7 cells. The genes were selected for significant regulation by both NAMPT and NMNAT-1 knockdown (p <.5, Student s t-test) with a fold change cutoff of log 2 < -.5 or >.5. page 8
9 Zhang et al. (Kraus) 29 ChIP signal (Rel. % Input) * SIRT1 ChIP F-NMNAT-1 ChIP ** ** ** ** Distance from TSS (kb) Gene ATXN1 NELL2 ATXN1 NELL2 Figure S5. Recruitment of SIRT1 and NMNAT-1 to ATXN1 and NELL2 genes. ChIPqPCR analysis of SIRT1 and FLAG-NMNAT-1 localization at upstream (approx. -1 kb), promoter and downstream (approx. +2 kb) regions of ATXN1 and NELL2 genes in MCF-7 cells. Error bars, SEM; n 3 independent biological replicates. Statistical significance was determined by two-tailed Student s t-test (* p <.5, ** p <.1). page 9
10 Zhang et al. (Kraus) 29.2 SIRT1 ChIP ChIP signal (Rel. % Input).1 Control shrna NAMPT shrna NMNAT-1 shrna ATXN1 NAT1 NELL2 STC1 Figure S6. Knockdown of NAMPT and NMNAT-1 did not change SIRT1 recruitment to target gene promoters. ChIP-qPCR analysis of SIRT1 localization at promoter regions of target genes in MCF-7 cells. Error bars, SEM; n 3 independent biological replicates. page 1
11 Zhang et al. (Kraus) 29 REFERENCES 1. Zhou, T., Kurnasov, O., Tomchick, D. R., Binns, D. D., Grishin, N. V., Marquez, V. E., Osterman, A. L., and Zhang, H. (22) J Biol Chem 277(15), Araki, T., Sasaki, Y., and Milbrandt, J. (24) Science 35(5686), Wang, T., Zhang, X., Bheda, P., Revollo, J. R., Imai, S., and Wolberger, C. (26) Nat Struct Mol Biol 13(7), page 11
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
Cellular Physiology (PHSI3009) Contents:
Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Lipidne mikrodomene. funkcija
Lipidne mikrodomene funkcija 1 Cellular processes involving lipid rafts - Signal transduction - Protein and lipid trafficking and sorting - Endosome(clathrin)-independent endocytosis: - potocytosis and
Cell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
Chapter 15: Signal transduction
Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,
Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.
Supplementary Figure 1 Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. IF images of wild-type (wt) and met-2 set-25 worms showing the loss of H3K9me2/me3 at the indicated developmental
Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a
Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Table 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis
SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Src-INACTIVE / Src-INACTIVE
Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
Propagation of the Signal
OpenStax-CNX module: m44452 1 Propagation of the Signal OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
Supplementary information
Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
1. Double bilayer of with imbedded, dispersed 2. Bilayer consists of, cholesterol, and glycolipids
Bio Chapter 7.3 Cellular Movement Notes I. Background Information A. - a mixture in which the (molecules being ) never settle out in the (water). B. In a 25% Koolaid solution, how much water is there?
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Supplementary Information
Supplementary Information Astrocytes regulate adult hippocampal neurogenesis through ephrin-b signaling Randolph S. Ashton, Anthony Conway, Chinmay Pangarkar, Jamie Bergen, Kwang-Il Lim, Priya Shah, Mina
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Thanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective
BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication
Transduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons
Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb.201510043 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Acquisition of -phluorin correlates negatively with podosome
Supplementary Figure 1 hlrrk2 promotes CAP dependent protein translation.
` Supplementary Figure 1 hlrrk2 promotes CAP dependent protein translation. (a) Overexpression of hlrrk2 in HeLa cells enhances total protein synthesis in [35S] methionine/cysteine incorporation assays.
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE
a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer
Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.
BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which
Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research
Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
Intracellular signalling cascades associated with TRP channels
Gerald Thiel Intracellular signalling cascades associated with TRP channels Current state of investigations and potential applications Saarland University, Germany Campus Saarbrücken Department of Medical
Cell Communication and Cell Signaling
Cell Communication and Cell Signaling Why is cell signaling important? Why is cell signaling important? Allows cells to communicate and coordinate functions/activities of the organism Usually involves
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
Fall Name Student ID
Name Student ID PART 1: Matching. Match the organelle to its function (11 points) 1.Proton motive force 2. Fluid Mosiac 3. Oxidative Phosphorylation 4. Pyruvate dehydrogenase 5. Electrochemical Force 6.
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
Nature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites.
Supplementary Figure 1 Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Staining with fluorescence antibodies to detect GFP (Green), β-galactosidase (magenta/white). (a, b) Class
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
7.06 Cell Biology EXAM #3 April 24, 2003
7.06 Spring 2003 Exam 3 Name 1 of 8 7.06 Cell Biology EXAM #3 April 24, 2003 This is an open book exam, and you are allowed access to books and notes. Please write your answers to the questions in the
Supplementary Material
The Open Biology Journal, 2009, Volume 2 i Table 1. Sequences of qpcr Primers and Probes Position SNP/Gene Forward primer [5' to 3'] Reverse Primer [5' to 3'] TaqMan probe [FAM5' to 3'BHQ] Left SNP_A-1648306
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)
3 (0.17) 24 (17.3) Sirt1 Hmg20 Gm4763 877 (857) c d Suppl. Figure 1. Screen validation for top candidate antagonists of Dot1L (a) Numer of genes with one (gray), two (cyan) or three (red) shrna scored
Chapter 11: Cell Communication
Name Period Chapter 11: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication
Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
Protein kinases are enzymes that add a phosphate group to proteins according to the. ATP + protein OH > Protein OPO 3 + ADP
Protein kinase Protein kinases are enzymes that add a phosphate group to proteins according to the following equation: 2 ATP + protein OH > Protein OPO 3 + ADP ATP represents adenosine trisphosphate, ADP
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling
Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules
BIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 1: Membranes Lecturer: Christopher Larbie, PhD Introduction Introduction Cells and Organelles have membranes Membranes contain lipids, proteins and polysaccharides
Chapter 11 Guided Reading: Cell Communication
Name Chapter 11 Guided Reading: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication
a 0,8 Figure S1 8 h 12 h y = 0,036x + 0,2115 y = 0,0366x + 0,206 Labeling index Labeling index ctrl shrna Time (h) Time (h) ctrl shrna S G2 M G1
(GFP+ BrdU+)/GFP+ Labeling index Labeling index Figure S a, b, y =,x +, y =,x +,,,,,,,, Time (h) - - Time (h) c d S G M G h M G S G M G S G h Time of BrdU injection after electroporation (h) M G S G M
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplementary Information
Supplementary Information Temozolomide suppresses MYC via activation of TAp63 to inhibit progression of human glioblastoma Tomohiro Yamaki, Yusuke Suenaga, Toshihiko Iuchi, Jennifer Alagu, Atsushi Takatori,
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human