NOTE: This table will be discontinued after this lot.
|
|
|
- Hugh Riley
- 6 years ago
- Views:
Transcription
1 AS Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6 NE% % 54.0 ± 12.0 NE# 10 3 /µl 2.1 ± 0.5 NOTE: This table will be discontinued after this lot. LY% % 32.0 ± 10.0 LY# 10 3 /µl 1.3 ± 0.5 MO% % 5.0 ± 5.0 MO# 10 3 /µl 0.2 ± 0.2 EO% % 8.0 ± 8.0 EO# 10 3 /µl 0.3 ± 0.3 BA% % 1.0 ± 1.0 BA# 10 3 /µl 0.1 ± 0.1 RBC 10 6 /µl 2.53 ± 0.12 HGB g/dl 6.7 ± 0.4 HGB g/l 67 ± 4 HGB mmol/l 4.2 ± 0.3 HCT % 21.5 ± 1.5 HCT L/L ± MCV fl 85.0 ± 5.0 MCH pg 26.5 ± 1.8 MCH fmol 1.64 ± 0.11 MCHC g/dl 31.2 ± 2.4 MCHC g/l 312 ± 24 MCHC mmol/l 19.3 ± 2.3 RDW % 16.0 ± 5.0 PLT 10 3 /µl 80 ± 20 MPV fl 8.7 ± 2.0 * PCT % ± * PCT ml/l 0.7 ± 0.3 * PDW 16.5 ± 3.0 AS Rev. 11/14
2 AS Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 2 ++ Lot No.: Exp. Date: LOT Parameter Mean Range WBC 10 3 /µl 9.9 ± 1.5 NE% % 60.0 ± 12.0 NE# 10 3 /µl 5.9 ± 1.2 NOTE: This table will be discontinued after this lot. LY% % 25.0 ± 10.0 LY# 10 3 /µl 2.5 ± 1.1 MO% % 6.0 ± 6.0 MO# 10 3 /µl 0.6 ± 0.6 EO% % 8.0 ± 8.0 EO# 10 3 /µl 0.8 ± 0.8 BA% % 1.0 ± 1.0 BA# 10 3 /µl 0.1 ± 0.1 RBC 10 6 /µl 4.16 ± 0.18 HGB g/dl 12.1 ± 0.5 HGB g/l 121 ± 5 HGB mmol/l 7.5 ± 0.3 HCT % 38.9 ± 2.0 HCT L/L ± MCV fl 93.5 ± 5.0 MCH pg 29.1 ± 1.8 MCH fmol 1.80 ± 0.12 MCHC g/dl 31.1 ± 2.4 MCHC g/l 311 ± 24 MCHC mmol/l 19.3 ± 1.8 RDW % 15.0 ± 5.0 PLT 10 3 /µl 255 ± 50 MPV fl 8.6 ± 2.0 * PCT % ± * PCT ml/l 2.2 ± 0.5 * PDW 16.3 ± 3.0 AS Rev. 11/14
3 AS Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL Lot No.: Exp. Date: LOT Parameter Mean Range WBC 10 3 /µl 21.8 ± 2.8 NE% % 68.0 ± 12.0 NE# 10 3 /µl 14.9 ± 2.7 NOTE: This table will be discontinued after this lot. LY% % 17.5 ± 10.0 LY# 10 3 /µl 3.8 ± 2.2 MO% % 8.0 ± 8.0 MO# 10 3 /µl 1.7 ± 1.7 EO% % 5.5 ± 5.5 EO# 10 3 /µl 1.2 ± 1.2 BA% % 1.0 ± 1.0 BA# 10 3 /µl 0.2 ± 0.2 RBC 10 6 /µl 5.45 ± 0.24 HGB g/dl 16.8 ± 0.8 HGB g/l 168 ± 8 HGB mmol/l 10.4 ± 0.5 HCT % 56.4 ± 2.8 HCT L/L ± MCV fl ± 5.0 MCH pg 30.8 ± 1.8 MCH fmol 1.91 ± 0.16 MCHC g/dl 29.8 ± 2.4 MCHC g/l 298 ± 24 MCHC mmol/l 18.5 ± 1.8 RDW % 14.5 ± 5.0 PLT 10 3 /µl 445 ± 70 MPV fl 8.7 ± 2.0 * PCT % ± * PCT ml/l 3.8 ± 0.8 * PDW 16.2 ± 3.0 AS Rev. 11/14
4 ASSAY VALUES AND EXPECTED RANGES + Beckman Coulter UniCel DxH TM 800/600 QCP DATA MONTHS: DEC, JAN, FEB LEVEL 1 LEVEL 2 LEVEL 3 Lot No.: LOT Lot No.: LOT Lot No.: LOT Parameter Mean Range Mean Range Mean Range WBC 10 3 /µl 4.0 ± ± ± 2.8 NE% % 66.0 ± ± ± 15.0 NE# 10 3 /µl 2.6 ± ± ± 3.4 LY% % 18.0 ± ± ± 10.0 LY# 10 3 /µl 0.7 ± ± ± 2.2 MO% % 4.0 ± ± ± 12.0 MO# 10 3 /µl 0.2 ± ± ± 2.7 EO% % 11.0 ± ± ± 6.5 EO# 10 3 /µl 0.4 ± ± ± 1.5 BA% % 1.0 ± ± ± 1.5 BA# 10 3 /µl 0.1 ± ± ± 0.3 RBC 10 6 /µl 2.53 ± ± ± 0.24 HGB g/dl 6.7 ± ± ± 0.8 HGB g/l 67 ± ± ± 8 HGB mmol/l 4.2 ± ± ± 0.5 HCT % 22.1 ± ± ± 2.8 HCT L/L ± ± ± MCV fl 87.5 ± ± ± 5.0 MCH pg 26.5 ± ± ± 1.8 MCH fmol 1.64 ± ± ± 0.16 MCHC g/dl 30.3 ± ± ± 2.4 MCHC g/l 303 ± ± ± 24 MCHC mmol/l 18.8 ± ± ± 1.8 RDW % 16.0 ± ± ± 5.0 RDW-SD fl 50.5 ± ± ± 10.0 PLT 10 3 /µl 80 ± ± ± 70 MPV fl 8.7 ± ± ± 2.0 * PCT % ± ± ± * PCT ml/l 0.7 ± ± ± 0.8 * PDW 16.5 ± ± ± 3.0
5 NOTE: This table will be discontinued after this lot. ASSAY VALUES AND EXPECTED RANGES ++ Beckman Coulter GEN S TM QCP DATA MONTHS: DEC, JAN, FEB LEVEL 1 LEVEL 2 LEVEL 3 Lot No.: LOT Lot No.: LOT Lot No.: LOT Parameter Mean Range Mean Range Mean Range WBC 10 3 /µl 3.9 ± ± ± 2.8 NE% % 55.0 ± ± ± 12.0 NE# 10 3 /µl 2.1 ± ± ± 2.6 LY% % 34.0 ± ± ± 10.0 LY# 10 3 /µl 1.3 ± ± ± 2.2 MO% % 2.0 ± ± ± 4.0 MO# 10 3 /µl 0.1 ± ± ± 0.8 EO% % 8.0 ± ± ± 5.0 EO# 10 3 /µl 0.3 ± ± ± 1.1 BA% % 1.0 ± ± ± 1.0 BA# 10 3 /µl 0.1 ± ± ± 0.2 RBC 10 6 /µl 2.53 ± ± ± 0.24 HGB g/dl 6.7 ± ± ± 0.8 HGB g/l 67 ± ± ± 8 HGB mmol/l 4.2 ± ± ± 0.5 HCT % 21.5 ± ± ± 2.8 HCT L/L ± ± ± MCV fl 85.0 ± ± ± 5.0 MCH pg 26.5 ± ± ± 1.8 MCH fmol 1.64 ± ± ± 0.16 MCHC g/dl 31.2 ± ± ± 2.4 MCHC g/l 312 ± ± ± 24 MCHC mmol/l 19.3 ± ± ± 1.8 RDW % 16.0 ± ± ± 5.0 PLT 10 3 /µl 80 ± ± ± 70 MPV fl 8.7 ± ± ± 2.0 * PCT % ± ± ± * PCT ml/l 0.7 ± ± ± 0.8 * PDW 16.5 ± ± ± 3.0
6 ASSAY VALUES AND EXPECTED RANGES +++ Beckman Coulter LH 700 Series QCP DATA MONTHS: DEC, JAN, FEB LEVEL 1 LEVEL 2 LEVEL 3 Lot No.: LOT Lot No.: LOT Lot No.: LOT Parameter Mean Range Mean Range Mean Range WBC 10 3 /µl 3.9 ± ± ± 2.8 NE% % 54.5 ± ± ± 12.0 NE# 10 3 /µl 2.1 ± ± ± 2.6 LY% % 32.0 ± ± ± 10.0 LY# 10 3 /µl 1.2 ± ± ± 2.2 MO% % 5.0 ± ± ± 7.5 MO# 10 3 /µl 0.2 ± ± ± 1.6 EO% % 7.5 ± ± ± 5.0 EO# 10 3 /µl 0.3 ± ± ± 1.1 BA% % 1.0 ± ± ± 1.0 BA# 10 3 /µl 0.1 ± ± ± 0.2 RBC 10 6 /µl 2.53 ± ± ± 0.24 HGB g/dl 6.7 ± ± ± 0.8 HGB g/l 67 ± ± ± 8 HGB mmol/l 4.2 ± ± ± 0.5 HCT % 21.5 ± ± ± 2.8 HCT L/L ± ± ± MCV fl 85.0 ± ± ± 5.0 MCH pg 26.5 ± ± ± 1.8 MCH fmol 1.64 ± ± ± 0.16 MCHC g/dl 31.2 ± ± ± 2.4 MCHC g/l 312 ± ± ± 24 MCHC mmol/l 19.3 ± ± ± 1.8 RDW % 16.0 ± ± ± 5.0 * RDW-SD fl 50.5 ± ± ± 10.0 PLT 10 3 /µl 80 ± ± ± 70 MPV fl 8.7 ± ± ± 2.0 ** PCT % ± ± ± ** PCT ml/l 0.7 ± ± ± 0.8 ** PDW 16.5 ± ± ± 3.0 * For Coulter LH 780 Only *
7 ASSAY VALUES AND EXPECTED RANGES ++++ Beckman Coulter LH 500 QCP DATA MONTHS: DEC, JAN, FEB LEVEL 1 LEVEL 2 LEVEL 3 Lot No.: LOT Lot No.: LOT Lot No.: LOT Parameter Mean Range Mean Range Mean Range WBC 10 3 /µl 3.9 ± ± ± 2.8 NE% % 49.5 ± ± ± 12.0 NE# 10 3 /µl 1.9 ± ± ± 2.6 LY% % 35.5 ± ± ± 10.0 LY# 10 3 /µl 1.4 ± ± ± 2.2 MO% % 4.0 ± ± ± 10.0 MO# 10 3 /µl 0.2 ± ± ± 2.1 EO% % 8.0 ± ± ± 5.5 EO# 10 3 /µl 0.3 ± ± ± 1.2 BA% % 3.0 ± ± ± 3.0 BA# 10 3 /µl 0.1 ± ± ± 0.6 RBC 10 6 /µl 2.53 ± ± ± 0.24 HGB g/dl 6.7 ± ± ± 0.8 HGB g/l 67 ± ± ± 8 HGB mmol/l 4.2 ± ± ± 0.5 HCT % 21.5 ± ± ± 2.8 HCT L/L ± ± ± MCV fl 85.0 ± ± ± 5.0 MCH pg 26.5 ± ± ± 1.8 MCH fmol 1.64 ± ± ± 0.16 MCHC g/dl 31.2 ± ± ± 2.4 MCHC g/l 312 ± ± ± 24 MCHC mmol/l 19.3 ± ± ± 1.8 RDW % 16.0 ± ± ± 5.0 PLT 10 3 /µl 80 ± ± ± 70 MPV fl 8.7 ± ± ± 2.0 * PCT % ± ± ± * PCT ml/l 0.7 ± ± ± 0.8 * PDW 16.5 ± ± ± 3.0
8 LOT DxH 800 Only Beckman Coulter UniCel DxH 800/600 Beckman Coulter LH 750 Series Beckman Coulter LH 780 Series Beckman Coulter LH 500
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
HM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
BLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S.
BLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S. Introducing the DxH 500, an Open-vial Hematology System *. Quality 5-part Differential in a Compact Design The first
Advanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
Brief Communication Diagnostic Hematology
Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges
Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
LabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
3. Blood Cell Histograms:
LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative
INFECTION/ INFLAMMATION
HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital
e-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia
50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and
Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for
Differential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für
Differential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für
Icd code for cbc with differential/ platelet
Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential
How useful are complete blood count and reticulocyte reports to clinicians in Addis Ababa hospitals, Ethiopia?
Birhaneselassie et al. BMC Hematology 2013, 13:11 RESEARCH ARTICLE Open Access How useful are complete blood count and reticulocyte reports to clinicians in Addis Ababa hospitals, Ethiopia? Misganaw Birhaneselassie
Differential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für
SediVue Dx Urine Sediment Analyser. Fresh samples / Revolutionary technology / A new standard of care. The Complete Diagnostic Solution
SediVue Dx Urine Sediment Analyser Fresh samples / Revolutionary technology / A new standard of care SediVue Dx Urine Sediment Analyser Improving the standard of care Automation ensures consistent, accurate
Changes of hematological references depends on storage period and temperature conditions in rats and dogs
ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature
Performance Evaluation of the Plateletworks in the Measurement of Blood Cell Counts as compared to the Beckman Coulter Unicel DXH 800
The Journal of ExtraCorporeal Technology Technique Articles Performance Evaluation of the Plateletworks in the Measurement of Blood Cell Counts as compared to the Beckman Coulter Unicel DXH 800 Erick McNair,
Evaluation of haematology analyzer CELL-DYN 3700 SL
Evaluation of haematology analyzer CELL-DYN 3700 SL Enver Suljevi}, Muhamed Fazli}, Jozo ]ori} i Emina Kiseljakovi} Institute for Clinical Chemistry and Biochemistry, Clinical Centre of University of Sarajevo
Mpv blood test results explained
P ford residence southampton, ny Mpv blood test results explained MPV is a medical term for mean platelets volume, mean platelet volume is a value in the CBC blood test to determine the estimated average
2013/11/29 Version 2
1 2013/11/29 Version 2 2 3 4 5 6 7 8 9 99 1 2 3 4 5 6 7 8 9 10 10 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219 /99.pdf 99 1 2 3 4 5 6 7 8 9 10 11 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219
Hematological Effects of Cadmium in Hybrid Isa brown
Available online at www.pelagiaresearchlibrary.com European Journal of Experimental Biology, 2012, 2 (6):2049-2054 Hematological Effects of Cadmium in Hybrid Isa brown * Imer Haziri 1, Bujar Mane 2, Arben
Continuing Education Questions
FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one
Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
NORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice
JKMU Journal of Kerman University of Medical Sciences, 2017; 24(2): 132-140 The Effects of Fruit Hydro alcoholic Extract on Oxidative Stress, Total Antioxidant Capacity and Haematological Parameters in
A Study on the Relationship between CBC and EEG for Epilepsy Patients
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2015, 47(4):225-229 http://dx.doi.org/10.15324/kjcls.2015.47.4.225 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 47, No. 4, Dec. 2015 225 A Study on
Changes to CBC Reference Ranges
September 28, 2016 July, 2017 Changes to CBC Reference Ranges At Dynacare, our vision is to be Canada s health and wellness solutions leader. As part of our commitment and continuous efforts to enhance
Clinical use of flow cytometry
Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following
REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
ACCREDITATION DOCUMENT
Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation
Hematological effects of mercury in hybrid birds Isa brown
Available online at www.pelagiaresearchlibrary.com European Journal of Experimental Biology, 2013, 3(1):185-190 Hematological effects of mercury in hybrid birds Isa brown ISSN: 2248 9215 CODEN (USA): EJEBAU
Date Time By Code Description Qty (Variance) Photo
Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.
Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
CELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)
Week 4 - PROBLEM SET ( 200 points ) INSTRUCTIONS: Report all numerical answers to 1 decimal place. Do not round values used for calculations. Must show calculations and units for full credit. (1) A standard
Date By Code Description Qty (Variance) Photo
Shield Stone Pet Hospital 1610 East Shields Avenue Fresno, CA 93704 559-222-2800 Patient Chart Printed: 08-09-18 at 12:21p CLIENT INFORMATION Name JOSE SILVA (12823) Address 3940 N MAROA FRESNO, CA 93704
10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
Control Data of Rat
BrlHan:WIST@Tac(GALAS) Control Data of BrlHan:WIST@Tac(GALAS) Rat Taconic Biosciences -1- BrlHan:WIST@Tac(GALAS) Environmental Conditions and Investigation Items Environmental Conditions (Isolated Barrier
5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN
DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:
COMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
CASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD I Friday, November 15, 2013 STUDENT COPY MHD I, Session XII, Student Copy Page 2 Case 1 CHIEF COMPLAINT: I am very
ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9
ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti
V.N. Karazin Kharkiv National University
V.N. Karazin Kharkiv National University INTERNAL MEDICINE DEPARTMENT Speakers: students of VI course Orotusin Opeyemi Adeola Oyewo Ifeoluwa Tomilayo Scientific advisers: assos.prof. Shevchuk M.I., assis.
q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9
etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:
CASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I Autoimmunity November 10, 2016 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am
DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur
DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010
Performance evaluation of Celltac G: a new automated hematology analyzer
Original Article Performance evaluation of Celltac G: a new automated hematology analyzer Masaaki Sugiyama 1, Tsukasa Kobayashi 1, Yuki Jisyage 2, Shigeko Yamamoto 2, Yutaka Nagai 2,3 and Hiroshi Kondo
California Association for Medical Laboratory Technology
California Association for Medical Laboratory Technology HEMATOLOGY CASE STUDIES: PLATELETS Distance Learning Program Course # DL-985 Helen M. Sowers, MA, CLS, Dept of Biological Science (retired) CSU,
Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for. High-Efficiency Tracking Orthotopic Colorectal Tumor in
Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for High-Efficiency Tracking Orthotopic Colorectal Tumor in Mouse Hongda Chen, a,c Xiaodong Li, b Fuyao Liu, a Huimao
CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)
AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin
Biological Variations of Hematologic Parameters Determined by UniCel DxH 800 Hematology Analyzer
Biological Variations of Hematologic Parameters Determined by UniCel DxH 800 Hematology Analyzer Pianhong Zhang, PhD; Huqiang Tang, MS, MPH; Keqing Chen, MS; Yingying Chen, BS; Dongsheng Xu, MD, PhD Context.
Hematopathology Case Study
www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated
Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
Kathleen Finnegan MS MT(ASCP)SHCM
Kathleen Finnegan MS MT(ASCP)SHCM Discuss the history of hematology automation and digital differentials. Discuss the HemoFAXS Hematology Analysis System by Tissue Gnostics. Review automated microscopy
Step 2. Common Blood Tests, and the Coulter Counter Readout
Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their
Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
Complete Blood Count (CBC)
Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction
Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired
Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make
6/6/2016 pg. 1 of 24
Last Reviewed: (Updated 06.06.16) By: Dr. Heidi Budke LTR29828 (BVH and ACC shared reference ranges) Hematology Reference Ranges: WBC LH750 AND 0-1 Day 9.0-30.0 DXH800 1-3 Days 9.4-34.0 4 Days - 1 Month
Case Study. Accidental Diagnosis of Multiple Myeloma in a 44-Year-Old White Woman due to Erroneous Results via Chemical Analyzers.
Accidental Diagnosis of Multiple Myeloma in a 44-Year-Old White Woman due to Erroneous Results via Chemical Analyzers Ola Bashiti, MLS(ASCP) CM Laboratory Medicine 47:1:5-11 CLINICAL HISTORY Patient: 44-year-old
EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS
EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary
The Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD
Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
A nationwide multicentre study in Turkey for establishing reference intervals of haematological parameters with novel use of a panel of whole blood
Original papers A nationwide multicentre study in Turkey for establishing reference intervals of haematological parameters with novel use of a panel of whole blood Yesim Ozarda* 1, Kiyoshi Ichihara 2,
Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
Laboratory for diagnosis of THALASSEMIA
SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia
* Final Report * ED Triage Entered On: 01/16/2014 8:45 EST Performed On: 01/16/2014 8:42 EST by
Result date: Result status: 16 January 2014 8:42 EST Auth (Verified) * Final Report * ED Triage Entered On: 01/16/2014 8:45 EST Performed On: 01/16/2014 8:42 EST by Assessment I Chief Complaint : Diarrhea
Now what do you have to learn?
So you have this thing Now what do you have to learn? Susan J. Leclair, Ph.D, CLS(NCA) Chancellor Professor Department of Medical Laboratory Science University of Massachusetts Dartmouth Massachusetts
XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016
XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient
Meet Moxie. Moxie looks great. Looks can be deceiving. Moxie is visible through die-cut.
Practice what s possible with support from IDEXX Focused on veterinary practices For over 20 years, IDEXX has been a pet health company dedicated to serving you and your staff. The industry s broadest
Effect of the addition of the antioxidant taurine on the complete blood count of whole blood stored at room temperature and at 4 C for up to 7 days
Original Article Effect of the addition of the antioxidant taurine on the complete blood count of whole blood stored at room temperature and at 4 C for up to 7 days Mahmoud Mohammed Sirdah 1 Abdelnasser
SAFETY ASSESSMENT OF L-DOPA AND HYOSCINE HYDROBROMIDE IN COMBINATION: ACUTE AND SUB-ACUTE ORAL TOXICITY STUDIES
Innovare Academic Sciences International Journal of Pharmacy and Pharmaceutical Sciences ISSN- 0975-1491 Vol 7, Issue 7, 2015 Original Article SAFETY ASSESSMENT OF L-DOPA AND HYOSCINE HYDROBROMIDE IN COMBINATION:
Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital
HEMATOPATHOLOGY Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital JOAN-LLUIS VIVES-CORRONS, MD, ISABEL BESSON, PHD, JOSEP MARIA JOU, MD, AND GABRIELA GUTIERREZ, MB The
Haematology Comparability Document
South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document
Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Blood Sciences (Haematology) Pathology Building Queen Alexandra Hospital Portsmouth PO6 3LY United Kingdom Contact: Mrs Victoria Hunt Tel:
EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION
EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click
Hepatitis A virus (HAV)
Volume 3, Issue 1 (Jan 2010) Editor s note Happy New Year and welcome to the first issue of QA Highlights of year 2010! In this issue, we are happy to bring to you Hepatitis Infection and Clinical Detection
CASE-BASED SMALL GROUP DISCUSSION
MHD II, Session XII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD II April 21, 2014 STUDENT COPY Helpful Resource: ACP Medicine online available through LUHS Library Infectious
MHD II Session 3 STUDENT COPY
MHD II, Session 3, Student Copy - Page 1 MHD II Session 3 January 15, 2016 STUDENT COPY MHD II, Session 3, Student Copy - Page 2 CASE HISTORY 1 Cc: Terrible diarrhea for 1 ½ days A 66 year-old woman presents
Direct Response Diagnostics
Direct Response Diagnostics Overview of Point-of-care Systems www.sysmex.nl www.sysmex.be Introduction Product overview/table of contents In 2003 Sysmex launched the poch-100i. It was the first Sysmex
Paper ID: ART
analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in
Clinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
Influence of deep-freezing on the autofluorescent properties of human plasma proteins
ORIGINAL ARTICLE Joanna Sikora 1, Małgorzata Ostrowska 2, Michał Kasprzak 1, 3, Jacek Fisz 4, Grażyna Odrowąż-Sypniewska 5, Jacek Kubica 1 1 Department of Cardiology and Internal Medicine 2 Department
Clinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
SMALL GROUP DISCUSSION
MHD II, Session 1 Student Copy Page 1 SMALL GROUP DISCUSSION MHD II Session 1 Gastroinestinal Monday, January 9, 2017 STUDENT COPY MHD II, Session 1 Student Copy Page 2 CASE 1 CHIEF CONCERN: "I'm passing
Rapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA