Chow KD CR HFD. Fed Fast Refed

Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.

Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient

SUPPLEMENTARY INFORMATION

DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5

Cos7 (3TP) (K): TGFβ1(h): (K)

IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity

SUPPLEMENTARY INFORMATION

doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy

Effects of exercise training on hepatic steatosis in high fat diet-induced obese mice

Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid

Supplementary Figure S1

Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk

Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage

Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,

SUPPLEMENTARY INFORMATION

% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -

* * * * * liver kidney ileum. Supplementary Fig.S1

Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).

TNF-α (pg/ml) IL-6 (ng/ml)

Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity

SUPPLEMENTARY INFORMATION

DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6

The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch

Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko

SUPPLEMENTARY INFORMATION

X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized

SUPPLEMENTARY INFORMATION

{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1

(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2

Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)

2018 American Diabetes Association. Published online at

Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison

Dietary carbohydrates and metabolic outcomes: assessing the totality, consistency and quality of epidemiologic observations and clinical interventions

Dietary carbohydrates and metabolic outcomes: assessing the totality, consistency and quality of epidemiologic observations and clinical interventions Simin Liu Department of Epidemiology Brown University

SUPPLEMENTARY INFORMATION

2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly

SUPPLEMENTARY INFORMATION

DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5

SUPPLEMENTARY INFORMATION

DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3

Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )

Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion

RESEARCH ARTICLE. Supplemental Figure 5

11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16

AMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis

SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd

Supplementary Figure 1

Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.

Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO

DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1

Adipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm

Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi

supplementary information

DOI:.38/n83 k Mouse Ch8 lous 8 9 Stop CHD8L 75 CHD8L Chromoomins Helise/ATPse omin DNA ining omin 5 kd NIH 3T3 MEF 93T HeL HCT UOS SOS.. CHD8L IB: CHD8 8 5 L S Reltive mrna mount 3... Reltive mrna mount.8.

EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS

EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent

Supplementary Information

Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

SUPPLEMENTARY INFORMATION

doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel

*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU

RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA

SUPPLEMENTARY INFORMATION

doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry

Chronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats

Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho

Supplementary figure 1

Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22

Supplemental Figures and Legends

Supplementl Figures n Legens Epigeneti trgeting of Hegehog trnsriptionl output through BET romoomin inhiition Yujie Tng 1,2, Shrreh Gholmin 2, Simone Shuert 1,2, Mine I. Willrson 3, Alex Lee 4, Prtiti

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

Supplementary Information

Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry

SUPPLEMENTARY INFORMATION

Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.

Supplementary Figure S1_Cottini

Supplementry Figure S1_Cottini γ-h2a.x Krp OCIMy5 KMS11 Krps62 RPMI8226 INA6-1 µm Cleve C3 γ-h2a.x DAPI Merge OCIMy5 H929 JJN3 UTMC2 KMS11 KMS12PE KMS18 KMS2 RPMI8226 INA6 U266 KMS34 Krps62 1 2 3 4 5 6

Shamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004

A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of

SUPPLEMENTARY INFORMATION

DOI:./n BJ RAS:ER Herrnz et l Supplementry Figure HFFF RAS:ER.. mrna Expression..... ILα ILβ IL IL CCL INH VEGF mrna Expression..... ILα ILβ IL IL CCL INH VEGF + OHT Torin NVP-BEZ + OHT shmtor. shmtor.

Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence

Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2

SUPPLEMENTARY INFORMATION

DOI:.3/n95 Thymus Kiney (kd) TA T7 T TA T7 T Hert TA T7 T: +Dox Cylin B (kd) Thymus Kiney Hert TA T5 T TA T5 T TA T5 T: +Dox Cylin B Poneu S Poneu S CnB T7 CnB T Thymus (kd) + Liver Colon + + (kd) Thymus

Interplay of LRRK2 with chaperone-mediated autophagy

Interply of with hperone-medited utophgy Smnth J Orenstein,, Sheng-Hn Kuo,, Inmuld Tsset,,, Espernz Aris,, Hiroshi Kog,, Irene Fernndez-Crs, Etty Cortes,5, Lwrene S Honig,5, Willim Duer 6, Antonell Consiglio,7,

SUPPLEMENTARY INFORMATION

doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!

a! b! c! Diamet (μm) 2 2 1 WT Nogo-A/B-deficient -9-8 -7 - -5-4 PE (LogM) Diamet (μm) 2 2 1-12-11-1 -9-8 -7 - -5 U-419 (LogM) Diamet (μm) 2 2 1-8 -7 - -5 S1P (LogM) d! WT! Nogo-A/B-deficient! MLE! enos!

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)

2.5. AMPK activity

Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2

Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry

D14 D 10 D 7. Untreated CYTOXAN 5-FU

Dipeptidylpeptidse Negtively Regultes Colony Stimulting Fctor Activity nd Stress Hemtopoiesis. Hl E. Broxmeyer, Jonthn Hoggtt, Hether A. O Lery, Chrlie Mntel, Brhmnnd R. Chitteti, Scott Cooper, Steven

Supplementary information to accompany the manuscript entitled:

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementry informtion to ompny the mnusript entitled: A mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity

Microtubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome

Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh

THE EFFECT OF DIFFERENT LEVELS OF OLIVE OIL IN RATION SUPPLEMENTATION ON SOME BIOCHEMICAL AND PRODUCTIVE TRAITS IN BROILERS

I.J.S.N., VOL.9 (1) 2018: 137-142 ISSN 2229 6441 TH T O IRNT LVLS O OLIV OIL IN RTION SUPPLMNTTION ON SOM IOHMIL N PROUTIV TRITS IN ROILRS huh Smir Hdi, s wzy l- khlisy ep. of Veterinry Puli Helth/ollege

Supplementary Figure 1

Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,

SUPPLEMENTARY INFORMATION

doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.

Effects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats

Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nnno.211.41 Sili nd titnium dioxide nnoprtiles use pregnny omplitions in mie Kohei Ymshit, Ysuo Yoshiok, Kzum Higshisk, Kzuy Mimur, Yuki Morishit, Mstoshi Nozki, Tokuyuki

Supplementary Figure S1

Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight

Supplementary Figure S1

Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus

PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis

Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet

Ancah Caesarina Novi Marchianti Emi Arimura Miharu Ushikai Masahisa Horiuchi

Environ Helth Prev Med (214) 19:339 347 DOI 1.17/s12199-14-4-z REGULAR ARTICLE Voluntry exerise under food restrition ondition dereses blood brnhed-hin mino id levels, in ddition to improvement of gluose

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

LHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb

SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION

Genetic influence on immune phenotype revealed strain-specific variations in peripheral blood lineages

Physiol Genomics 34: 304 314, 2008. First published June 10, 2008; doi:10.1152/physiolgenomics.00185.2007. Genetic influence on immune phenotype revealed strain-specific variations in peripheral blood

Clinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number

EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess

Nature Medicine doi: /nm.3150

Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

DOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion

Primers used for real time qpcr

Supplementry Tble 1. Primers used for rel time qpcr Gene Accession number Forwrd/reverse primers Tgfα Tgfβ1 Hgf Cyclin A2 Cyclin B1 Cyclin D1 Cyclin E1 FoxM1 p21 Lrt Cyp26A1 CrbpI Rrβ Bcmo1 Bcmo2 NM_31199

International Journal of Pharma and Bio Sciences

Int J Phrm Bio Si 2013 Ot; 4(4): (B) 427-436 Reserh Artile BioChemistry Interntionl Journl of Phrm nd Bio Sienes ISSN 0975-6299 SILDENAFIL ALLEVIATES INSULIN SENSITIVITY VIA ATTENUATING OXIDATIVE STRESS

Lipid Composition of Egg Yolk and Serum in Laying Hens Fed Diets Containing Black Cumin (Nigella sativa)

Interntionl Journl of Poultry Siene 5 (6): 574-578, 2006 ISSN 682-8356 Asin Network for Sientifi Informtion, 2006 Lipid Composition of Egg Yolk nd Serum in Lying Hens Fed Diets Contining Blk Cumin (Nigell

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons

nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized

A liver HIF-2α/IRS2 pathway sensitizes hepatic insulin signaling and is modulated by VEGF inhibition

A liver HIF-2α/IRS2 pthwy sensitizes hepti insulin signling n is moulte y VEGF inhiition Kevin Wei1,1, Stephnie M. Pieewiz1,1, Lis M. MGinnis1,1, Cullen M. Tniguhi2, Stnley J. Wiegn3, Keith Anerson3, Crol

Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens

Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

ARTICLE. Keywords AMPK. Cholesterol. Insulin resistance. Intestine. Isoflavones. Liver. LXRα. LXRβ. Mice. Soy protein

Dietologi () 55:469 478 DOI.7/s5--599-9 ARTICLE Soy protein isoflvones ifferentilly regulte liver X reeptor isoforms to moulte lipi metolism n holesterol trnsport in the liver n intestine in mie M. González-Grnillo

Fates-shifted is an F box protein that targets Bicoid for degradation and regulates developmental fate determination in Drosophila embryos

ARTICLES Ftes-shifted is n F ox protein tht trgets Bioid for degrdtion nd regultes developmentl fte determintion in Drosophil emryos Juno Liu 1 nd Jun M 1,2,3 Bioid (Bd) is morphogeneti protein tht instruts

CEACAM1 regulates insulin clearance in liver

CEACAM1 regultes insulin lerne in liver Mtthew N. Poy 1, Yn Yng 1, Khijeh Rezei 1, Mts A. Fernström 1, Arhm D. Lee 2, Yoshiki Kio 3, Snr K. Erikson 4 & Soni M. Njjr 1 Pulishe online: 19 Ferury 2002, DOI:

The Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression

Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative

Inhibition of Dexamethasone-induced Fatty Liver Development by Reducing mir-17-5p Levels

originl rtile Inhiition of Dexmethsone-inue Ftty Liver Development y Reuing -5p Levels Willim W Du,, Fengqiong Liu 3, Sze Wn Shn,, Xini Ciny M,, Shn Gupt,, Tinru Jin 4, Dvi Spner, Sergey N Krylov 5, You

Effect of age and moderate food restriction on insulin sensitivity in Wistar rats: role of adiposity

131 Effet of ge nd moderte food restrition on insulin sensitivity in Wistr rts: role of diposity Fernndo Esrivá, M Luí Gvete, Ysmín Fermín 1, Corli Pérez 1, Nild Gllrdo 2, Crmen Alvrez, Antonio Andrés

The nucleotide exchange factor SIL1 is required for glucose-stimulated insulin secretion from mouse pancreatic beta cells in vivo

Dietologi (1) 7:11 119 DOI 1.17/s1-1-33-z ARTICLE The nuleotide exhnge ftor SIL1 is required for gluose-stimulted insulin seretion from mouse pnreti et ells in vivo Arne A. Ittner & Josefine Bertz & Tse

Thioredoxin-interacting protein links oxidative stress to inflammasome activation

A rt i l e s Thioredoxin-interting protein links oxidtive stress to inflmmsome tivtion Rongin Zhou 1, Aury Trdivel 1, Bernrd Thorens 2, Inpyo Choi 3 & Jürg Tshopp 1 29 Nture Ameri, In. All rights reserved.

Effect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant

Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6

Supplementary Information

Supplementry Informtion A new lss of plnt lipid is essentil for protetion ginst phosphorus depletion Yozo Okzki 1, Hitomi Otsuki 1, Tomoko Nrisw 1, Mkoto Koyshi 1, Storu Swi 2, Yukiko Kmide 1, Miyko Kusno

Effect of Diets Containing Sucrose vs. D-tagatose in Hypercholesterolemic Mice

nture pulishing group ARTICLES Effet of Diets Contining Surose vs. D-tgtose in Hyperholesterolemi Mie S r B. Poli e 1, J. C l y Hr r is 2, Roert A. Lodder 1, 2 nd Lis A. Cssis 1 Effets of funtionl sweeteners

Intervention with citrus flavonoids reverses obesity, and improves metabolic syndrome and

Intervention with itrus flvonoids reverses oesity, nd improves metoli syndrome nd theroslerosis in oese Ldlr -/- mie Authors: Amy C. Burke 1,2, Brin G. Sutherlnd 1, Dwn E. Telford 1,3, Mris R. Morrow 1,

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT

Title of Experiment: Author, Institute and address:

Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion

Beta-Glucan-Rich Extract from

Evidene-Bsed Complementry nd Alterntive Mediine Volume 2013, Artile ID 185259, 10 pges http://dx.doi.org/10.1155/2013/185259 Reserh Artile Bet-Glun-Rih Extrt from Pleurotus sjor-ju (Fr.) Singer Prevents