Inhibition of lipid metabolic enzymes using Mangifera indica extracts

Transcription

1 Inhiition of lipid metolic enzymes using Mngifer indic extrcts Diego A. Moreno 1, Christophe Ripoll 1, Neojs Ilic 2, Alexnder Poulev 1, Cristin Auin 3 nd Ily Rskin 1* 1 Rutgers The Stte University of New Jersey, Biotech Center, Cook College, 228 Forn Hll, 59 Dudley Rod, New Brunswick, New Jersey , U.S.A. *e-mil: rskin@esop.rutgers.edu. 2 Phytomedics Inc., 65 Stults Rod, Dyton, NJ , USA. 3 Children s Hospitl Boston, Division of Endocrinology, 300 Longwood Ave., Boston, MA 02115, U.S.A Received 28 August 2004, ccepted 27 Novemer Astrct This study ssesses the effects of mngo tree (Mngifer indic L.) extrcts (stem rk MSB nd leves ML) on lipses (pncretic lipse, lipoprotein lipse nd hormone-sensitive lipse). The MSB nd ML smples were extrcted in 95% ethnol nd the extrcts ssyed for the inhiition of pncretic lipse (PL) nd lipoprotein lipse (LPL) s well s for the inhiition of lipolysis of 3T3-L1 dipocytes. We hve lso exmined the nti-oesity ction of MSB nd ML y testing whether the extrcts prevented weight gin induced y feeding high-ft diet to mle Wistr rts for 12 weeks. Both MSB nd ML inhiited PL nd LPL, suggesting tht they my ffect oth ft sorption nd the uptke of ftty cids, if enough of the ctive components cn e sored nd entered into the circultion. The inhiition of stimulted lipolysis y MSB nd ML suggested tht the cells took up the ctive components of the extrcts. In ddition, MSB nd ML incresed fecl ft excretion nd reduced serum glucose nd insulin levels nd down-regulted some oesity-relted genes (LPL, hormone-sensitive lipse, ftty cid synthse, resistin) in liver nd epididyml ft. The precise moleculr mechnisms y which MSB nd ML inhiit lipses nd lipolysis still requires further investigtion.however, the reltive iochemicl complexity of these extrcts my produce pleiotropic ction on severl lipid nd crohydrte metolism trgets simultneously, mking MSB nd ML multifunctionl otnicl therpeutics useful in weight control. MSB nd ML or some of their components my lso provide effective iochemicl tools for studying the complex reltionships etween energy lnce, diposity nd endocrine function. Key words: Botnicls, dietry supplements, nturl products, oesity, plnt extrcts, lipse. Introduction In the United Sttes nd worldwide, the epidemic of overweight nd oesity is expnding 1, 2. Western diets re high in ft nd promote oesity 3, nd the only ville U.S.-F.D.A. pproved drug for the phrmcologicl inhiition of the digestion of dietry triglycerides is Orlistt (Xenicl ) 4. Even though, people use mny nutritionl supplements for weight loss, none of them hve een convincingly demonstrted to e sfe nd effective 5. In this sitution, it ecomes cler tht we need more effective nd etter tolerted nti-oesity tretments. Pncretic lipse (PL), lipoprotein lipse (LPL) nd hormone-sensitive lipse (HSL) re enzymes responsile for the digestion of triglycerides coming from the diet 6, the plsm lipoproteins 7 nd the dipocytes 8, 9, respectively. The existence of ethnophrmcologicl sources of phytochemicls with nti-lipse ctivity hs een investigted nd reported in different plnt species including Cssi mimosoides 10, Slci reticult 11, Slix mtsudr 12, Dioscore nipponic 13 nd Cmeli sinensis 14. Mngo (Mngifer indic L.), elonging to the fmily Ancrdicee, is widely distriuted in mny tropicl nd sutropicl regions; it is one of the most populr edile fruits in the world 15. Mngo stem rk (MSB), contining vriety of polyphenols, which included phenolic cids, phenolic esters, flvn-3-ols nd xnthone (mngiferin), hs een trditionlly used for the tretment of menorrhgi, scies, dirrhe, llergies, syphilis, dietes, cutneous infections nd nemi, using n queous extrct otined y decoction 16, 17. The leves of mngo (ML) re lso used s n ntidietic gent in Nigerin folk medicine 18. Mngiferin present in Mngifer extrcts in ddition to different Slci reticult polyphenols resulted in enhnced lipolysis nd inhiited PL nd LPL ctivities in femle Zucker rts 11. The development of otnicl drugs, following the guidelines of the U.S.-F.D.A. 19, cn e fster nd cheper thn conventionl single-entity phrmceuticls 20. The present study ws crried out to test the hypothesis tht the ioctive compounds in MSB nd ML extrcts my hve nti-oesity effects in rts through inhiition of ft metolizing enzymes (pncretic lipse nd lipoprotein lipse) nd reduced lipolysis (HSL). In n effort to clrify the nti-oesity mechnisms of MSB nd ML, we lso evluted their effects on ody weight, fecl lipids, lood nd liver chemistry s well s the expression of oesity-relted genes in liver nd epididyml ft tissue of mle Wistr rts under highft diet supplemented with MSB nd ML. Mterils nd Methods Preprtion nd chemicl nlysis of the extrcts: MSB, otined from Amzon Hers (Prmrio, Surinme) nd ML, otined from Stndrd Fruit de Hondurs S.A. (Zon Mzpn L Cei Atlntid, Hondurs), were extrcted in 95% ethnol (1:10 w:v) with mechnicl gittion for 24 h. The orgnic solvent ws then evported nd these crude extrcts freeze-dried.

2 Pncretic lipse [PL; E.C ]: Lipse-PS TM regents were otined from Sigm Dignostics (Procedure No. 805, Sigm- Aldrich, St. Louis, MO). Humn pncretic lipse (Lipse-PS stndrd, 230 U l -1 ) ws otined from Sigm Dignostics (Sigm- Aldrich, St. Louis, MO). Aliquots (30 µl) of lipse stndrd, lnk (wter s reference) nd MSB nd ML smples were dded to 400 µl of sustrte solution, mixed gently nd incuted for 5 min t 37 C. Activtor regent (300 µl) ws dded to the smples, mixed y gentle inversion nd incuted for n dditionl 3 min t 37 C. The increse in sornce t 550 nm, due to the formtion of quinone diimine dye, ws mesured to determine the ctivity in the smples 4, 6. Lipoprotein lipse [LPL; E.C ]: LPL ws mesured ccording to the method of Nilsson-Ehle nd Schotz 22. A pool of LPL ws mde y incuting humn dipose tissue frgments with 10 U ml -1 heprin (500 mg 5 ml -1 ) for 45 min t 24 C. Aliquots of this heprin elute were preincuted with vrying concentrtions of MSB nd ML (Tle 2) for 30 min t 4 C. After ddition of 3 H-triolein sustrte, smples were incuted for 60 min t 37 C nd the relesed 3 H-oleic cid ws mesured 23. Hormone-sensitive lipse [HSL, E.C ]: Lipolytic ctivity in cultured mouse 3T3-L1 dipocytes ws used s mesure of HSL ctivity 21, 24. 3T3-L1 cells were cultured with DMEM (4500 mg glucose l -1 ) supplemented with 100 g l -1 fetl ovine serum, 2 mm glutmine, 100 units ml -1 penicillin, 100 µg ml -1 streptomycin, 110 µg ml -1 sodium pyruvte nd 8 µg ml -1 iotin, in 50 g kg -1 CO 2 tmosphere t 37 C. The differentition of 3T3-L1 cells ws initited y the ddition of 10 µm dexmethsone, 0.5 mm isoutyl-methylxnthine nd 10 µg ml -1 insulin to the culture medium of confluent cells for 3 dys, followed y the cultivtion of cells without supplements for n dditionl 3 or more dys. We dded MSB nd ML extrcts s indicted in Fig. 1; fter 18 hours of incution, the stimultion of lipolysis ws ccomplished y incuting differentited dipocytes with 10 µm isoproterenol - nd 20 g l 1 ftty cid-free ovine serum lumin for 1 h. Lipolysis ws determined y mesuring glycerol relese using fluorometric 23, 24 enzymtic ssy. In vivo study: This study ws pproved y the Animl Cre nd Fcilities Committee in the Office of Reserch nd Sponsored Progrms t Rutgers University. 7-9-week-old helthy mle Wistr rts (Chrles River Lortories Inc., MA, USA) were kept, one per collection cge, in temperture-controlled room t 22 C with 12h/12h light/drkness cycle with lights on t 7:00 AM. There ws n verge of ir chnges per room per h. Rts were llowed free ccess to wter nd food nd dpted to the fcility for 1 week efore tretment. The rts were divided into three groups. The control group ws fed high-ft AIN-76A purified rodent diet (45% kcl ft, Dyets Inc. Bethlehem, PA). The other two groups were fed modified diet to mtch the energy supply of the diets nd including 10 g - kg 1 of either MSB or ML extrcts for 12 weeks. Body weight ws mesured etween 9:00-11:00 AM every Thursdy morning. Dily (24 h) food intke ws mesured on per-niml sis once per Arevitions: BWG: ody weight gin; FAS: Ftty cid synthse; FFA: Free ftty cids; HSL: Hormonesensitive lipse; ISO: Isoproterenol; LPL: Lipoprotein lipse; PL: Pncretic lipse; MSB: Mngo stem rk; ML: Mngo leves week. Feces were collected once per 2 weeks. Feces from ech rt were pooled nd dried to constnt weight. Fecl lipids were extrcted y the method of Folch et l. 25. After 12 weeks of tretment, we kept rts fsting overnight nd euthnized y decpittion for necrospy. Liver nd ft deposits (right-hlf epididyml ft depots) were excised, weighed nd immeditely frozen in liquid nitrogen nd stored t 80 C for future nlyses. Blood ws collected for iochemicl nlyses on Hitchi 747 chemistry nlyzer (Ani Lytics Inc., Githersurg, MD): glucose (Hexokinse, Roche Moleculr Biochemicls, Germny) nd insulin (Rdioinmunossy specific for rt, Linco Reserch Inc., Missouri); totl cholesterol (Cholesterol/HP ssy kit Roche Moleculr iochemicls, Indinpolis) nd triglycerides (Glycerol Phosphte Peroxidse, Roche regents). These experiments were crried out t the Cook Animl Fcility (Cook College, Rutgers University), n A.A.A.L.A.C. Intl.-ccredited fcility. Animls were cred for in ccordnce with ntionl guidelines of Pulic Helth for the Cre nd Use of Lortory Animls. Oesity-relted gene expression nlyses: Totl RNA from liver nd epididyml ft tissues ws extrcted following the TRI- Regent protocol (Sigm, St Louis, MO) nd pooled from the 6 rts per tretment efore RT-PCR nlysis. RNA ws treted with RNse-free RQ1 DNse (Promeg, Mdison, WI) nd then sumitted to reverse trnscription with superscript II H- (Invitrogen, Crsld, CA) ccording to the mnufcturer s instructions. Oesity-relted gene expression levels were quntified using Strtgene Mx 3000P TM Rel-Time PCR System (Strtgene, L Joll, CA). Primers for ech gene were designed using Primer Express ver. 2.0 (Applied Biosystems, Foster City, CA) s presented in Tle 1. Rel-time PCR nlyses were crried out in Brillint SYBR Green PCR mster mix kit (Strtgene) ccording to kit instructions. Smples were mplified using the following progrm: 2 minutes incution t 50 C; initil denturtion nd polymerse ctivtion t 95ºC for 10 min; 40 PCR cycles consisting of 15 s t 95 C nd 60 s t 60 C ech. The RNA expression ws nlyzed y Ct methods 26, using the β-ctin gene s normlizer. Amplifiction of specific trnscripts ws further confirmed y otining melting curve profiles. All smples were ssyed in duplicte nd 5 independent nlyses were performed. Sttisticl nlysis: All dt were sujected to nlysis of vrince (ANOVA). The dt (mens ± SEM) shown re men vlues nd the significnce of the differences ws compred using the Duncn s Multiple Rnge Test t Lest Significnt Difference (P<0.05) proility level. Results The MSB nd ML extrcts re composed of vriety of polyphenols 15-18, including phenolic cids, phenolic esters, flvn- 3-ols nd mngiferin (dt not shown). We tested MSB nd ML extrcts for inhiitory ction ginst PL nd oserved tht oth MSB nd ML, t concentrtion of 1 mg ml -1, cused significnt inhiition of this key lipid-metolizing enzyme (Tle 2). MSB, t 1 mg ml -1, lso reduced LPL ctivity (Tle 3) y 75% compred to the control. The ML only slightly reduced the LPL ctivity (Tle 2). Eighteen hours of incution of 3T3-L1 dipocytes with medium

3 Tle 1. Primers sequence for RT-PCR (5-3 ) of selected oesity-relted genes. Gene (ccession numer) Forwrd Reverse Medium Chin Acyl-CoA GCTAGTAAAGCCTTCACCGGATT TTAGTTCCTTTTTTCCGATGTGTATTC (NM_016986) Acyl-CoA oxidse (NM_01734) TGGCCAACTATGGTGGACATC TACCAATCTGGCTGCACGAA Ftty Acid Synthse (NM_017332) GGCATCATTGGGCACTCCTT GCTGCAAGCACAGCCTCTCT Lipoprotein Lipse (NM_012598) CTGAAAGTGAGAACATTCCCTTCA CCGTGTAAATCAAGAAGGAGTAGGTT Hormone sensitive lipse CCAAGTGTGTGAGCGCCTATT CACGCCCAATGCCTTCTG (NM_012859) UCP-2 (NM_019354) TCCGGACACAATAGTATCTTTAAG GCCTGATCCCCTTGATTTCC Adiponectin (NM_144740) CCCAGGGTCCAGATTCAACTC GGTGTAATGGTGGGCTTGCT Resistin (NM_144741) ACTGCCAGTGCGGAAGCATAG ATCAACCGTCCTCAGGAACCA Actin (NM_031144) GGGAAATCGTGCGTGACATT GCGGCAGTGGCCATCTC Tle 2. Inhiitory effects of Mngifer indic extrcts on the ctivity of humn pncretic lipse (PL) nd lipoprotein lipse (LPL). Extrct (mg ml -1 ) PL (U l -1 ) Inhiitory effect (%) LPL (U ml -1 ) (µmol glycerol relesed h -1 ml -1 ) MSB c d c 75 ML c d c 24 Inhiitory effect (%) Inhiitory effect shown s the lowering of reltive ctivity (%) compred to control (0 mg ml -1 = 100% ctivity). Vlues followed y different lowercse letters re significntly different (ANOVA) from the control t p<0.01, ccording to Duncn s Multiple Rnge Test. Results represents mens ± SEM (n = 4) Tle 3. Orgn weights nd serum prmeters of rts fed the high-ft diet fter 12 weeks of tretment using Mngifer indic extrcts. Compound Control (HFD) 1 % MSB + HFD 1% ML + HFD Liver F.W. (g rt -1 ) [2.52] [2.32] [2.46] Epididyml ft F.W. (hlf-right, g rt -1 ) [1.74] [1.75] [1.65] TC TG Glu Ins * ** * Results represents mens ± SEM (n = 6). [orgn sizes s percentge of finl ody weight] Vlues followed y different lowercse letters re significntly different (ANOVA) from the control t P<0.1 (*) nd p<0.05 (**), ccording to Duncn s Multiple Rnge Test. TC: Totl Cholesterol (mg dl -1 ); TG: Triglycerides (mg dl -1 ); Glu: Glucose (mg dl -1 ); Ins: Insulin (ng ml -1 ) supplemented with the MSB nd ML extrcts reduced the isoprotenol-stimulted glycerol relese (Fig. 1). At 1 mg ml -1 MSB nd ML inhiited isoproterenol-stimulted glycerol relese y 29% nd 34%, respectively. The 0.1 mg ml -1 ML tretment reduced the glycerol relese y 20%. Control nd experimentl rt groups in the in vivo study, continued to grow nd incresed their ody weight throughout the 12-week study. However, t the end of the experiment, the MSB-treted rts fed t 10 g kg -1 (w:w diet) showed 6.7% reduction in ody-weight gin with respect to the control (Fig. 2). No normlities were oserved in the necropsy performed t the end of the experiment. Weights of the liver nd epididyml ft depots of rts treted with MSB nd ML hve not een significntly (P<0.05) reduced (Tle 3). The differences in orgn sizes etween tretments nd control were lso not sttisticlly significnt. There were no differences in food consumption etween the treted groups nd the control (dt not shown). At ll times MSB nd ML incresed the mount of lipid present in feces of ll rts fed the high ft diet (Fig. 3). This effect ws shown to e significnt fter 1 week for MSB (P<0.01) nd fter 3 weeks for oth MSB nd ML (P<0.05). After 6 nd 12 weeks, the fecl lipid content ws not sttisticlly different from the control. Dily oservtions did not revel ny other visile ehviorl, physiologicl or nti-nutritionl effects of oth extrcts in Wistr rts. The MSB-treted rts did not show ny significnt chnge in serum lipids (totl cholesterol nd totl triglycerides) (Tle 3), while ML group showed reduced totl serum cholesterol (P<0.1). High-ft diet-fed rts gined weight rpidly in oth control nd treted groups (Fig. 2). Serum glucose levels (Tle 3) in the control group incresed eyond the norml physiologicl vlues (75-150

4 *** Control HFD MSB +HFD ML +HFD µm Relesed Glycerol (well) d c c Fecl Lipids (mg g -1 feces d.w.) d -1 rt ** 0 Figure 1. Inhiitory effect of Mngifer indic extrcts on HSL ctivity in cultured murine 3T3-L1 dipocytes. Ech column represents the men ±SEM (n= 4). Mens followed y the sme letter re not significntly different t p<0.01, ccording to Duncn s Multiple Rnge Test. NON = nonstimulted or sl lipolysis. ISO = stimulted lipolysis (without extrct). Body weight Gined (% of Initil ody weight; n= 6) NON ISO MSB (mg ml -1 ) - - ML (mg ml -1 ) Weeks on tretment Control (HFD) MSB + HFD ML + HFD Figure 2. Effect of Mngifer indic extrcts (MSB, ML) on ody-weight gin (BWG) in rts fed high-ft diet. Vlues (%) re men ±SEM (n= 6). Mens followed y the sme letter re not significntly different t p<0.05, ccording to Duncn s Multiple Rnge Test Weeks on tretment Figure 3. Fecl lipid extrcted from rts treted with Mngifer indic extrcts (MSB, ML) through the 12- week feeding study. Vlues re men ±SEM (n= 6). Duncn s Multiple Rnge Test significnce: ** (P< 0.05), nd *** (P< 0.01), vs the control. ng ml -1 ) 27, while in the MSB- nd ML-treted rts the glucose ws mintined within norml rnge. This effect ws significnt for ML, which lowered serum glucose level y 33% compred to the control. Both groups, MSB nd ML (P<0.1), showed lower insulin levels thn the control. Expression of oesity-relted genes ws investigted in the liver nd epididyml ft tissues of rts fed high-ft diet with nd without Mngifer indic extrcts (Tle 4). In the liver, expression (mrna levels) of medium chin cyl-coa (MCAD),αmylse, cyl-coa oxidse (ACO) nd ftty cid synthse (FAS) did not show ny sttisticl difference etween tretments. On the other hnd, the epididyml ft depots of oth MSB- nd MLtreted rts showed significnt reduction in LPL, HSL nd FAS. The 10 g kg -1 -ML group resulted in specificlly inhiited resistin gene expression. No effect ws found on diponectin or UCP-2 expression in ny tretment. Discussion Reducing the sorption of ft cn e n effective djunct to dieting in oese ptients, s seen in the clinicl use of Orlistt 4. Since MSB nd ML hve een shown to inhiit oth PL nd LPL, it is possile tht these extrcts ffect oth intestinl ft sorption nd the uptke of ftty cids in dipose tissue, if enough of the ctive components enter the lood strem. The HSL-lipolysis my ply centrl role in the development of insulin resistnce nd metolic syndrome 8. Thus, the inhiition of HSL hs the potentil to reduce levels of circulting FFA linked to insulin resistnce in oese ptients 2,9. The MSB nd ML extrcts decresed the isoproterenol-stimulted lipolysis in 3T3-L1 dipocytes (Fig. 1), presumly y decresing HSL ctivity. However, to dte, it is not cler if phrmcologiclly induced reduction of the relese of FFA from dipocytes would e eneficil in the tretment of oesity. The niml study ws undertken to test whether MSB nd ML would reduce ody weight of norml rts receiving high-ft diet. Rts fed high-ft diet provide n niml model for the study of humn diet-induced oesity 28. MSB nd ML rich in

5 Tle 4. Effect of tretment with Mngifer indic extrcts extrcts on gene expression in the liver nd epididyml ft tissues of mle Wistr rts. Gene HFD Control MSB +HFD ML +HFD Mngo lef Liver MCAD Amylse ACO FAS Epididyml ft LPL HSL c UCP FAS c Adiponectin Resistin Results represents mens ± SEM (n = 6). Vlues followed y different lowercse letters re significntly different (ANOVA) from the control t p<0.001, ccording to Duncn s Multiple Rnge Test. polyphenols, including mngiferin 16, 18, incresed fecl ft without significntly ffecting food intke (dt not shown), indicting tht the extrcts my e useful in ody weight control. In contrst -1-1 to the control group, the 10 g kg -MSB- nd 10 g kg -ML-treted rts mintined norml glucose levels. This effect my e due to 12 the reduction of the sorption of glucose in the intestine or 18, 29 dditionl mechnisms of ction. The MSB nd ML extrcts re composed y polyphenols, 1 including mngiferin Animls fed high-ft diet supplemented with polyphenols from Slix nd Dioscore gined significntly less ody weight nd dipose tissue thn control nimls fed on high-ft diet lone. On the other hnd, reserch hs shown reduced ody weight in Sprgue-Dwley rts given 14, 30 polyphenolic-rich green te. Nevertheless, using Slci reticult polyphenols (including mngiferin) in femle Zucker rts resulted in enhnced lipolysis, nd inhiited PL nd LPL, ut mle rts treted with the sme extrct did not show ny chnge 11 in ody weight. Fecl lipid dt (Fig. 3) suggested tht 1%-MSB nd 1%-ML incresed the mounts of ft excreted in feces, likely ecuse of the inhiition of gstrointestinl lipses. Such inhiition should result in suppression of hydrolysis nd the sorption of 14 triglyceride. Dirrhe is common side effect of PL inhiitor Orlistt (Xenicl ) in humns 4. However, rts treted with MSB nd ML did not hve dirrhe for the durtion of the experiment. The dt suggests tht the effects nd mode of ction of MSB nd ML might differ from these of Orlistt. Theoreticlly, gents tht interfere with efficient deposition of triglycerides (TG) into dipose tissue, for exmple, y inhiiting LPL ctivity, could elevte the levels of triglycerides in plsm or other tissues, which, mong other negtive helth effects, could 7 increse the risk of coronry hert disese, 31. The 1% w/w MSBnd ML-fed rts hd serum lipids (totl cholesterol or triglycerides, 27 Tle 3), within norml physiologicl vlues levels. The fct tht the extrcts lso helped the nimls to mintin norml glucose levels suggests phrmcologicl effect, which my hinder the development of Syndrome-X 28, 29. While MSB nd ML hd no significnt effects on the expression of genes relted to the lipid metolism in the liver, they significntly reduced the expression of mny of these genes in epididyml ft depots of rts fed high-ft diet (Tle 4). Both MSB nd ML downregulted the expression of LPL nd HSL, tht could further contriute to the inhiitory effects of these extrcts on lipses, ffecting the lipid metolic regultion eyond the enzyme ctivity. The down regulting effect on LPL nd HSL genes (Tle 4) could imlnce the incorportion nd relese of lipids from the cells which in turn my prevent insulin resistnce. The MSB nd ML extrcts hd no effect on UCP-2 or diponectin m-rna, ut ML strongly reduced the FAS nd resistin expression. FAS is key enzyme in ftty cid synthesis nd hs een shown to e regulted y insulin 32. Resistin ws lso ssocited with insulin resistnce nd it is up regulted in oese rodents. Dt suggest tht ML my e promising tool for modulting glucose homeostsis under high-ft diet induced oesity. Conclusions The precise moleculr mechnisms y which MSB nd ML inhiit lipses nd lipolysis still requires further investigtion. However, the reltive iochemicl complexity of these extrcts my produce pleiotropic ction on severl lipid nd crohydrte metolism trgets simultneously, mking MSB nd ML multifunctionl otnicl therpeutics useful in weight control. MSB nd ML or some of their components my lso provide effective iochemicl tools for studying the complex reltionships etween energy lnce, diposity nd endocrine function. The results encourge the future study of the ctive compounds from MSB nd ML using ctivity-guided frctiontion s well s dditionl in vivo vlidtion. A cknowledgement We grtefully cknowledge Dwn Brsemle from the Deprtment of Nutritionl Sciences (Rutgers University) nd Susn K. Fried from the Division of Gerontology (Dept of Medicine, University of Mrylnd School of Medicine), for their vlule friendship nd scientific dvice. Prtilly supported y Phytomedics, Inc. (Dyton, NJ), Rutgers, The Stte University of New Jersey, nd NJ Agriculturl Experiment Sttion. Diego A. Moreno received funding from the Post-doctorl Scholrships Arod Progrm of the Spnish Secretri de Estdo de Educcion y Universiddes (Spnish Ministry of Eduction, Culture, nd Sport). References 1 Flegl, K.M., Crroll, M.D., Ogden, C.L. nd Johnson, C.L Prevlence nd trends in oesity mong US dults, Journl Americn Medicl Assocition 288: Ynovski, S.Z. nd Ynovski, J.A Oesity. New Englnd Journl Medicine 346: Bry, G.A. nd Popkin, B.M Dietry ft ffects oesity rte. Americn Journl Clinicl Nutrition 70: Bllinger, A. nd Peikin, S.I.R Orlistt: its current sttus s n nti-oesity drug. Europen Journl Phrmcology 440: Allison, D.B., Fontine, K.R., Heshk, S., Mentore, J.L. nd Heymsfield, S.B Alterntive tretments for weight loss: criticl review. Criticl Reviews Food Science Nutrition 41: Lott, J.A. nd Lu, C.J Lipse isoforms nd mylse isoenzymes: Assys nd ppliction in the dignosis of cute pncretitis. Clinicl

6 Chemistry 37: Golderg, I.J. nd Merkel, M Lipoprotein lipse: physiology, iochemistry, nd moleculr iology. Front Biosciences 6: D Holm, C., Osterlund, T., Lurell, H. nd Contrers, J Moleculr mechnisms regulting hormone-sensitive lipse nd lipolysis. Annul Review Nutrition 20: Slee, D.H., Bht, A.S., Nguyen, T.N., Kish, M., Lundeen, K., Newmn, M.J. nd McConnell, S.J Pyrrolopyrzinedione-sed inhiitors of humn hormone-sensitive lipse. Journl Medicinl Chemistry 46: Ymmoto, M., Shimur, S., Itoh, Y., Ohsk, T., Egw, M. nd Inoue, S Anti-oesity effects of lipse inhiitor CT-II, n extrct from edile hers, Nomme Her, on rts fed high-ft diet. Interntionl Journl Oesity 24: Yoshikw, M., Shimod, H., Nishid, N., Tkd, M. nd Mtsud, H Slci reticult nd its polyphenolic constituents with lipse inhiitory nd lipolytic ctivities hve mild ntioesity effects in rts. Journl of Nutrition 132: Hn, L.-K., Sumiyoshi, M., Zhng, J., Liu, M.-X., Zhng, X.-F., Zheng, Y.-N., Okud, H. nd Kimur, Y Anti-oesity ction of Slix mtsudn leves (Prt 1). Anti-oesity ction y polyphenols of Slix mtsudn in high ft-diet treted rodent nimls. Phytotherpy Reserch 17: Kwon, C.-S., Sohn, H.-Y., Kim, S.-H., Kim, J.-H., Son, K.-H., Lee, J.- S., Lim, J.-K. nd Kim, J.-S Anti-oesity effect of Dioscore nipponic Mkino with lipse-inhiitory ctivity in rodents. Bioscience, Biotechnology nd Biochemistry 67: Wu, L.-Y., Jun, C.-C., Ho, L.-T., Hsu, Y.-P. nd Hwng, L.-S Effect of green te supplementtion on insulin sensitivity in Sprgue- Dwley Rts. Journl Agriculturl Food Chemistry 52: Ross, I.A Mngifer indic L. In Medicinl Plnts of the World, Volume 1. Chemicl Constituents, Trditionl nd Modern Uses. 2 nd Edition. Humn Press, Totow NJ, pp Nunez-Selles, A.J., Velez-Cstro, H.T., Agüero-Agüero, J., Gonzlez- Gonzlez, J., Nddeo, F., De Simone, F. nd Rstrelli, L Isoltion nd quntittive nlysis of phenolic ntioxidnts, free sugrs, nd polyols from mngo (Mngifer indic L.) stem rk queous decoction used in Cu s nutritionl supplement. Journl Agriculturl Food Chemistry 50: Grci, D., Esclnte, M., Delgdo, R., Ueir, F.M. nd Leiro, J Anthelminthic nd ntillergic ctivities of Mngifer indic L. stem rk components vimng nd mngiferin. Phytotherpy Reserch 17: Aderiige, A.O., Emudinughe, T.S. nd Lwl, B.A.S Antihyperglycemic effect of Mngifer indic in Rt. Phytotherpy Reserch 13: U.S. -F.D.A Guidnce for Industry Botnicl Drug Products. Center for Drug Evlution nd Reserch, US Food nd Drug Administrtion. URL: (Access 25 My, 2005). 20 Rinicky, D., Poulev, A., O Nel, J., Wnorowski, G., Mlek, D.E., Jäger, R. nd Rskin, I Toxicologicl evlution of the ethnolic extrct of Artemisi drcunculus L. for use s dietry supplement nd in functionl foods. Food Chemistry Toxicology 42: Moreno, D.A., Ilic, N., Poulev, A., Brsemle, D.L., Fried, S.K. nd Rskin, I Inhiitory effects of grpe seed extrct on lipses. Nutrition 19: Nilsson-Ehle, P. nd Schotz, M.C A stle, rdioctive sustrte emulsion for ssy of lipoprotein lipse. Journl Lipid Reserch 17: Brsemle, D.L., Brer, T., Wolins, N.E., Serrero, G., Blnchette- Mckie, E.J. nd Londos, C Adipose differentition-relted protein is n uiquitously expressed lipid storge droplet-ssocited protein. Journl Lipid Reseserch 38: Lurell, S. nd Tiling, G An enzymtic fluorometric micromethod for the determintion of glycerol. Clinicl Chimic Act 13: Folch, J., Lees, M. nd Slone-Stnley, G.M Simple method for isoltion nd purifiction of totl lipids from niml tissues. Journl Biologicl Chemistry 226: Winer, J., Jung, C.K.S., Shckel, I. nd Willims, P.M Development nd vlidtion of rel-time quntittive reverse trnscriptse-polymerse chin rection for monitoring gene expression in crdi myocytes in vitro. Anlyticl Biochemistry 270: Hrkness, J.E. nd Wgner, J.E The Biology nd Medicine of Rits nd Rodents. 4 th Edition. Le & Feiger Editors, Phildelphi, PA, 372 pp. 28 Akiym, T., Tchin, I., Shirohr, H., Wtne, N. nd Otsuki, M High-ft hypercloric diet induces oesity, glucose intolernce nd hyperlipidemi in norml dult mle Wistr rt. Dietes Reserch Clinicl Prctice 31: Murugnndn, S., Srinivsn, K., Gupt, S., Gupt, P.K. nd Ll, J Effect of mngiferin on hyperglycemi nd therogenicity in streptozotocin dietic rts. Journl Ethnophrmcology 97: Choo, J.J Green te reduces ody ft ccretion cused y highft diet in rts through β-drenoceptor ctivtion of thermogenesis in rown dipose tissue. Journl Nutritionl Biochemistry 11: Ouchi, N., Kihr, S., Funhshi, T., Mtsuzw, Y. nd Wlsh, K Oesity, diponectin nd vsculr inflmmtory disese. Current Opinion Lipidology 14: Sul, H.S., Lts, M.J., Moon, Y. nd Kim, K.H Regultion of the ftty cid synthse promoter y insulin. Journl of Nutrition 130: 315S-320S. 33 Vendrell, J., Broch, M., Vilrrs, N., Molin, A., Gomez, J.M., Gutierrez, C., Simon, I., Soler, J. nd Richrt, C Resistin, diponectin, ghrelin, leptin, nd proinflmmtory cytokines: reltionships in oesity. Oesity Reserch 12: