Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle
|
|
- Wendy Berry
- 6 years ago
- Views:
Transcription
1 Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle
2 Metabolic Remodeling: Fatty Acids Carbohydrates PCr/ATP
3 Glucose vs. fatty acids: Glucose: O2 efficient substrate, 11% saving in P:O C inefficient, 2/3 carbon enters TCA availability to the cardiac myocyte is subjected to insulin regulation Fatty acids: O2 inefficient substrate, requires 11% or more O2 than glucose high availability and C efficient, every carbon is oxidized FAO is dependent on mitochondrial function reactive lipid species Fatty Acids Carbohydrates PCr/ATP
4 Shifting Substrate Preference to Glucose by overexpressing GLUT1 1 % Oxidation 8 6 carb 4 2 fat WT TG FS% TG
5 Overexpressing GLUT1 delays the transition to failure and Improves Long-term Survival Post Ascending Aortic Constriction WT WT-AAC Animal Survival GLUT1-TG TG-AAC WT-Sham WT-Band TG-Sham TG-Band Days
6 Glucose is not toxic. A greater than endogenous capacity for glucose utilization is needed to compensate for impaired FAO in the adult heart. PPARα -/- mice whole body knockout x GLUT1 TG mice cardiac specific PPARα -/- GLUT1 TG
7 Contributions of glucose vs. fatty acids to the oxidative metabolism Baseline High workload
8 . n i m / g H m 3 m 1 Rate Pressure Product (1 3 mmhg/min) RPP high workload 25 min. glucose mixed substrates +/+ WT WT -/- PPARα WT -/- -/- TG +/+ GLUT1 TG PPARα -/- GLUT1
9 [ATP] [ATP] (mm) M m /+ WT WT -/- WT -/- TG +/+ GLUT1 TG PPARα -/- PPARα -/- GLUT1 2 glucose high workload 25 min. mixed substrates
10 Normalized FAO? Maladaptive: Limited capacity for ATP synthesis use of glucose and use of fatty acids Further facilitates glucose utilization (GLUT1-TG) Adaptive: O 2 demand
11 Strategies: Enhance FAO via the PPARα mechanisms Cardiac PPARα-TG: cardiomyopathy Pharmacological activation: worse or no effects on cardiac function in hypertrophied heart High fat diet Delays the development of heart failure in certain models while worsens the outcome in others FA uptake >> FAO Mitochondrial FAO Manipulate long-chain fatty acid entry
12 Targeting Acetyl-CoA Carboxylase (ACC2) to Specifically Increase FAO Lipid synthesis MCD Acetyl CoA Fatty Acids ACS Malonyl CoA Malonyl CoA Acyl CoA CPT1 ACC1 ACC2 β-oxidation TCA Mitochondrion
13 Cardiac-specific deletion of ACC2 decreases Malonyl-CoA level ACC2 C57 f/wt f/f -/+ -/- Fold Change (from Control) ACC1 mrna. ACC2H -/- ACC2H-/- Heart Gastroc Liver nmol/g dry weight Malonyl CoA ACC2H -/-
14 Effects of ACC2 Deletion on Cardiac Metabolism % Oxidation TAG Content Glycogen Content Relative Contribution to Acetyl-CoA (%) 1 Glucose Fatty Acids Other 5 ACC2H-/- TAG (ug/mg) ACC2H -/- Glucose (µmol/g) ACC2H -/- MVO 2 MVO 2 /RPP µmol of O 2 /min/g ww ACC2H -/- 1 ACC2H-/ Glucose-Pyruvate Mixed Substrate nmol/g protein Acylcarnitines 8 6 ACC2H -/- 4 2 C3 C4 C5 C8 C14 C16 nmol/mmhgx1 3 /g w.w 3 Glc+pyr mixed substrate 2 1 ACC2H -/- ACC2H -/- ACC2H -/- Fold Change (Relative to Control) Gene Expression glut1 glut4 mcd pdk4 cd36 ppara pparg cpt1b mcad ucp3 pgc1a pgc1b erra tfam Glucose Metabolism Lipid Metabolism Mitochondrial Biogenesis
15 High Workload Challenge in Isolated Perfused Heart PCr (mm) ATP (mm) Phosphocreatine Baseline High Workload ATP ACC2H -/- ACC2H-/- HR (bpm) LVDevP (mmhg) Cardiac Function High Workload BL Heart Rate ACC2H-/- ACC2H-/- Pi (mm) Baseline High Workload Inorganic Phosphate + Baseline High Workload ACC2H-/- EDP (mmhg) High Workload BL Diastolic Function High Workload BL ACC2H -/-
16 Aging: Fatty acid metabolism is maintained with normal function and morphology up to 12 months of age Wall Thickness Contribution to Acetyl-CoA (%) Substrate Utilization 2mos 12mos 2mos 12mos Fatty Acids Glucose ACC2H -/- LVPW;d (mm) Fractional Shortening (%) months 12 months In-vivo Function 2 months 12 months ACC2H -/- ACC2H -/-
17 Pressure Overload: TAC Function % Contribution to Acetyl-CoA 1 5 Sham TAC Sham TAC ACC2H-/- Fatty Acids Glucose Other FS (%) BL 4wk 8wk Sham TAC ACC2H -/- -Sham ACC2H -/- -TAC 13 C3-Alanine/ 13 C1-Glucose (AU) Alanine Sham TAC Sham TAC ACC2H-/- Sham TAC Sham TAC ACC2H-/- Anaplerosis/Citrate Synthase Anaplerosis Sham TAC Sham TAC ACC2H-/- RPP (mmhgbpm1 3 ) C-C3Lactate/ 13 C-C1Glucose (AU) Lactate Sham TAC Sham TAC ACC2H-/- PCr/ATP PCr/ATP Sham TAC Sham TAC ACC2H-/- Fatty Acids PCr/ATP Carbohydrates
18 Reduced Hypertrophy and Fibrosis in ACC2H-/- 4 weeks Post-TAC Fold Change (from Control) BNP HW:TL (mg/mm) 1 5 HW/TL Myocyte Area % Fibrosis Cross Sectional Area ( µm 2 ) % Fibrosis Sham TAC Sham TAC Sham TAC Sham TAC Sham TAC Sham TAC ACC2H-/- ACC2H-/- ACC2H-/- Sham TAC Sham TAC ACC2H-/- Sham -/- Sham Sham -/- Sham TAC -/- TAC TAC -/- TAC
19 Optimal energy metabolism Capacity: to meet the high energy demand Balance: uptake = utilization Flexibility: able to utilize what is available No one-size-fit-all substrate for the heart
20 Acknowledgement Ivan Luptak Jie Yan Stephen Kolwicz Jr. Lorena Garcia-Menendez Miranda Nabben Mei Shen Jessica D Agostino Francesco Aiello Yanqiu Xing Liqun Zou Bo Løfgren Biao Lei Georgios Karamanlidis Danos Christodoulou Maengjo Kim Queena Yu Yu-Ying Yang Sung Won Choi Rick M. Mortensen University of Michigan Dan Kelly Washington University, St. Louis Gary Lopaschuk University of Alberta Ronglih Liao Joanne Ingwall Jim Balschi Luigino Nascimben Jun Yoshioka, Richard Lee Brigham and Women s Hospital David Olson Beth Israel Deaconess Med Center Robert Synovec University of Washington
Medical Biochemistry and Molecular Biology department
Medical Biochemistry and Molecular Biology department Cardiac Fuels [Sources of energy for the Cardiac muscle] Intended learning outcomes of the lecture: By the end of this lecture you would be able to:-
More informationMetabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
More informationLipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals
Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram
More informationIntegrative Metabolism: Significance
Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell
More informationCHY2026: General Biochemistry. Lipid Metabolism
CHY2026: General Biochemistry Lipid Metabolism Lipid Digestion Lipid Metabolism Fats (triglycerides) are high metabolic energy molecules Fats yield 9.3 kcal of energy (carbohydrates and proteins 4.1 kcal)
More informationModifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden
Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential
More informationFatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders
Deficiency Disorders in Pediatrics Published online: December 9, 216 Fatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders Gary D. Lopaschuk Department of Pediatrics, University
More informationLecture 29: Membrane Transport and metabolism
Chem*3560 Lecture 29: Membrane Transport and metabolism Insulin controls glucose uptake Adipose tissue and muscles contain a passive glucose transporter GluT4 which takes up glucose from blood. (This is
More informationMitochondrial Energy Metabolism:
Mitochondrial Energy Metabolism: How Fa8y Acids and Other Fuels Keep Our Bodies Running David M. Koeller, MD Professor of Pediatrics Director, CDRC Metabolic Clinic What is Energy? What is Energy? What
More informationTest next Thursday, the 24 th will only cover the lecture
Test next Thursday, the 24 th will only cover the lecture material, not lab stuff! Objectives Understand how muscles differ Fiber types Understand how we fuel muscle Glycogen Fats How many ATP from each
More informationTHE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals
Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle
More informationTala Saleh. Razi Kittaneh ... Nayef Karadsheh
Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty
More informationIn glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic
Glycolysis 1 In glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic glycolysis. If this pyruvate is converted instead
More informationRESPIRATION Worksheet
A.P. Bio L.C. RESPIRATION Worksheet 1. In the conversion of glucose and oxygen to carbon dioxide and water a) which molecule becomes reduced? b) which molecule becomes oxidized? c) what happens to the
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationGood and bad consequences of altered fatty acid metabolism in heart failure: evidence from mouse models
Cardiovascular Research (2015) 106, 194 205 doi:10.1093/cvr/cvv105 REVIEW Good and bad consequences of altered fatty acid metabolism in heart failure: evidence from mouse models Desiree Abdurrachim 1,
More informationEffects of sitagliptin on cardiac metabolism in mice
Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures
More informationOVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S
LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationSynthesis of Fatty Acids and Triacylglycerol
Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:
More informationnumber Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
More informationGlucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism
Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the
More informationFatty acid breakdown
Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of
More informationEnergy metabolism - the overview
Energy metabolism - the overview Josef Fontana EC - 40 Overview of the lecture Important terms of the energy metabolism The overview of the energy metabolism The main pathways of the energy metabolism
More informationIncreased Glucose Uptake and Oxidation in Mouse Hearts Prevent High Fatty Acid Oxidation but Cause Cardiac Dysfunction in Diet-Induced Obesity
Increased Glucose Uptake and Oxidation in Mouse Hearts Prevent High Fatty Acid Oxidation but Cause Cardiac Dysfunction in Diet-Induced Obesity Jie Yan, MD, PhD; Martin E. Young, DPhil; Lei Cui, MD; Gary
More informationName Class Date. 1. Cellular respiration is the process by which the of "food"
Name Class Date Cell Respiration Introduction Cellular respiration is the process by which the chemical energy of "food" molecules is released and partially captured in the form of ATP. Carbohydrates,
More informationIntermediary metabolism. Eva Samcová
Intermediary metabolism Eva Samcová Metabolic roles of tissues Four major tissues play a dominant role in fuel metabolism : liver, adipose, muscle, and brain. These tissues do not function in isolation.
More informationPhysiological Chemistry II Exam IV Dr. Melissa Kelley April 13, 2004
Name Write your name on the back of the exam Physiological Chemistry II Exam IV Dr. Melissa Kelley April 13, 2004 This examination consists of forty-four questions, each having 2 points. The remaining
More informationContents. METABOLIC IMAGING Evaluating metabolic changes in heart disease by magnetic resonance spectroscopy Michiel ten Hove and Stefan Neubauer 18
Contents EDITORIAL Metabolic profile in heart disease Mario Marzilli 3 BASIC ARTICLE Understanding the metabolic phenotype of heart disease Rong Tian 5 MAIN CLINICAL ARTICLE Clinical implications of energetic
More informationLecture 5: Cell Metabolism. Biology 219 Dr. Adam Ross
Lecture 5: Cell Metabolism Biology 219 Dr. Adam Ross Cellular Respiration Set of reactions that take place during the conversion of nutrients into ATP Intricate regulatory relationship between several
More informationFatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
More informationIntroduction to Carbohydrate metabolism
Introduction to Carbohydrate metabolism Some metabolic pathways of carbohydrates 1- Glycolysis 2- Krebs cycle 3- Glycogenesis 4- Glycogenolysis 5- Glyconeogenesis - Pentose Phosphate Pathway (PPP) - Curi
More informationRole of fatty acids in the development of insulin resistance and type 2 diabetes mellitus
Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating
More informationANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES. Carbohydrate Metabolism
ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES I. Glycolysis A. Pathway Regulation of glycolysis Hexokinase: Activated by glucose. Inhibited by G6P. 6-Phosphofructokinase: Inhibited by ATP, especially
More informationSynthesis of Fatty Acids and Triacylglycerol
Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty
More informationIntegration & Hormone Regulation
Integration Branchpoints in metabolism where metabolites can go several directions 1. Glucose 6-phosphate Energy needed (low energy charge): glycolysis Low blood sugar: high [glucagon], low [insulin] glycogen
More informationMuscle Metabolism. Dr. Nabil Bashir
Muscle Metabolism Dr. Nabil Bashir Learning objectives Understand how skeletal muscles derive energy at rest, moderate exercise, and strong exercise. Recognize the difference between aerobic and anaerobic
More informationManipulation of the Nutrient Sensors (AMPK/TOR) with Anaplerotic Diet Therapy (Triheptanoin) An Alternative to Diet Restriction
Manipulation of the Nutrient Sensors (AMPK/TOR) with Anaplerotic Diet Therapy (Triheptanoin) An Alternative to Diet Restriction CharlesR.Roe,MD Institute of Metabolic Disease Baylor University Medical
More informationA cell has enough ATP to last for about three seconds.
Energy Transformation: Cellular Respiration Outline 1. Energy and carbon sources in living cells 2. Sources of cellular ATP 3. Turning chemical energy of covalent bonds between C-C into energy for cellular
More informationEnergy Transformation: Cellular Respiration Outline 1. Sources of cellular ATP 2. Turning chemical energy of covalent bonds between C-C into energy
Energy Transformation: Cellular Respiration Outline 1. Sources of cellular ATP 2. Turning chemical energy of covalent bonds between C-C into energy for cellular work (ATP) 3. Importance of electrons and
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
I. verall concepts A. Definitions ANSC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose and lactate) 1) Uses glucose
More informationRoles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular
Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O
More informationAhmad Ulnar. Faisal Nimri ... Dr.Faisal
24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of
More information4. Which step shows a split of one molecule into two smaller molecules? a. 2. d. 5
1. Which of the following statements about NAD + is false? a. NAD + is reduced to NADH during both glycolysis and the citric acid cycle. b. NAD + has more chemical energy than NADH. c. NAD + is reduced
More informationHow Did Energy-Releasing Pathways Evolve? (cont d.)
How Did Energy-Releasing Pathways Evolve? (cont d.) 7.1 How Do Cells Access the Chemical Energy in Sugars? In order to use the energy stored in sugars, cells must first transfer it to ATP The energy transfer
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
More informationControl. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationnumber Done by Corrected by Doctor F. Al-Khateeb
number 23 Done by A. Rawajbeh Corrected by Doctor F. Al-Khateeb Ketone bodies Ketone bodies are used by the peripheral tissues like the skeletal and cardiac muscles, where they are the preferred source
More informationAnaerobic Pathways. Glycolysis
Anaerobic Pathways Glycolysis Glucose + 2 ATP 4 ATP + 2 Pyruvate No oxygen required Fairly low energy yield Lactate byproduct Resting levels low Tolerances 40 mmole/kg in humans, 200 mmole/kg in sea turtles
More informationAGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine
AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION Kitt Falk Petersen, M.D. Yale University School of Medicine % of Population Prevalence of Diabetes and Glucose Intolerance 45 40 35 30 25 20 15 10 5
More information23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in
Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
Fatty Acid ynthesis I. verall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism Fatty Acid ynthesis 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors
More informationRole of the Pyruvate
Role of the Pyruvate Dehydrogenase Complex in the Regulation of Blood Glucose Robert A. Harris Indiana University School of Medicine Indianapolis, Indiana Kyungpook National University School of Medicine
More informationHow Cells Release Chemical Energy. Chapter 7
How Cells Release Chemical Energy Chapter 7 7.1 Overview of Carbohydrate Breakdown Pathways All organisms (including photoautotrophs) convert chemical energy of organic compounds to chemical energy of
More informationCh 9: Cellular Respiration
Ch 9: Cellular Respiration Cellular Respiration An overview Exergonic reactions and catabolic pathway Energy stored in bonds of food molecules is transferred to ATP Cellular respiration provides the energy
More informationg) Cellular Respiration Higher Human Biology
g) Cellular Respiration Higher Human Biology What can you remember about respiration? 1. What is respiration? 2. What are the raw materials? 3. What are the products? 4. Where does it occur? 5. Why does
More informationChapter 14. Energy conversion: Energy & Behavior
Chapter 14 Energy conversion: Energy & Behavior Why do you Eat and Breath? To generate ATP Foods, Oxygen, and Mitochodria Cells Obtain Energy by the Oxidation of Organic Molecules Food making ATP making
More informationnumber Done by Corrected by Doctor Nayef Karadsheh
number 13 Done by Asma Karameh Corrected by Saad hayek Doctor Nayef Karadsheh Gluconeogenesis This lecture covers gluconeogenesis with aspects of: 1) Introduction to glucose distribution through tissues.
More informationBIOCHEMISTRY. Glycolysis. by Dr Jaya Vejayan Faculty of Industrial Sciences & Technology
BIOCHEMISTRY Glycolysis by Dr Jaya Vejayan Faculty of Industrial Sciences & Technology email: jayavejayan@ump.edu.my Chapter Description Overview This chapter is related to carbohydrate catabolism. It
More informationBiol 219 Lec 7 Fall 2016
Cellular Respiration: Harvesting Energy to form ATP Cellular Respiration and Metabolism Glucose ATP Pyruvate Lactate Acetyl CoA NAD + Introducing The Players primary substrate for cellular respiration
More informationRespiration. Respiration. How Cells Harvest Energy. Chapter 7
How Cells Harvest Energy Chapter 7 Respiration Organisms can be classified based on how they obtain energy: autotrophs: are able to produce their own organic molecules through photosynthesis heterotrophs:
More informationCellular Metabolism 6/20/2015. Metabolism. Summary of Cellular Respiration. Consists of all the chemical reactions that take place in a cell!
Cellular Metabolism Biology 105 Lecture 6 Chapter 3 (pages 56-61) Metabolism Consists of all the chemical reactions that take place in a cell! Cellular metabolism: Aerobic cellular respiration requires
More informationChapter 7 Cellular Respiration and Fermentation*
Chapter 7 Cellular Respiration and Fermentation* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. Life Is Work
More informationBiosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM
Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives
More informationMILK BIOSYNTHESIS PART 3: FAT
MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl
More informationCellular Metabolism 9/24/2013. Metabolism. Cellular Metabolism. Consists of all the chemical reactions that take place in a cell!
Cellular Metabolism Biology 105 Lecture 6 Chapter 3 (pages 56-61) Metabolism Consists of all the chemical reactions that take place in a cell! Cellular Metabolism Aerobic cellular respiration requires
More informationMoh Tarek. Razi Kittaneh. Jaqen H ghar
14 Moh Tarek Razi Kittaneh Jaqen H ghar Naif Karadsheh Gluconeogenesis is making glucose from non-carbohydrates precursors. Although Gluconeogenesis looks like Glycolysis in many steps, it is not the simple
More informationCellular Respiration
Cellular I can describe cellular respiration Cellular respiration is a series of metabolic pathways releasing energy from a foodstuff e.g. glucose. This yields energy in the form of ATP adenosine P i P
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.
More informationCellular Metabolism. Biology 105 Lecture 6 Chapter 3 (pages 56-61)
Cellular Metabolism Biology 105 Lecture 6 Chapter 3 (pages 56-61) Metabolism Consists of all the chemical reactions that take place in a cell! Cellular Metabolism Aerobic cellular respiration requires
More informationExercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders. Cary O. Harding, MD Molecular & Medical Gene5cs
Exercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders Cary O. Harding, MD Molecular & Medical Gene5cs Acknowledgements OHSU Melanie Gillingham, PhD, RD Annie Behrend, MS, RD Autumn Fletcher,
More information6. How Are Fatty Acids Produced? 7. How Are Acylglycerols and Compound Lipids Produced? 8. How Is Cholesterol Produced?
Lipid Metabolism Learning bjectives 1 How Are Lipids Involved in the Generationand Storage of Energy? 2 How Are Lipids Catabolized? 3 What Is the Energy Yield from the xidation of Fatty Acids? 4 How Are
More informationBiosynthesis of Fatty Acids
Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty
More informationDEPARTMENT OF SCIENCE COURSE OUTLINE Fall 2018 BC 2000 INTRODUCTORY BIOCHEMISTRY 3 (3-0-0) 45 HOURS FOR 15 WEEKS
DEPARTMENT OF SCIENCE COURSE OUTLINE Fall 2018 BC 2000 INTRODUCTORY BIOCHEMISTRY 3 (3-0-0) 45 HOURS FOR 15 WEEKS INSTRUCTOR: Beatrice Amar Ph.D. PHONE: 780-539-2031 OFFICE: J208 E-MAIL: Bamar@gprc.ab.ca
More informationCellular Respiration Harvesting Chemical Energy ATP
Cellular Respiration Harvesting Chemical Energy ATP 2009-2010 Ch.8.3 Section Objectives: Compare and contrast cellular respiration and fermentation. Explain how cells obtain energy from cellular respiration.
More informationCellular Metabolism. Biol 105 Lecture 6 Read Chapter 3 (pages 63 69)
Cellular Metabolism Biol 105 Lecture 6 Read Chapter 3 (pages 63 69) Metabolism Consists of all of the chemical reactions that take place in a cell Metabolism Animation Breaking Down Glucose For Energy
More informationMuscles 3: Contractions, Adaptations & Energy Use
Muscles 3: Contractions, Adaptations & Energy Use Contractions Isotonic: Muscle changes length in response to resistance Concentric: muscle tension exceeds resistance & muscle shortens Eccentric: Resistance
More informationUnit 2: Metabolic Processes
How is energy obtained biologically? Recall: Red Ox Reactions Unit 2: Metabolic Processes Oxidation Is the chief mechanism by which chemical potential energy is released This energy comes from reduced
More informationBiochemistry #02. The biochemical basis of skeletal muscle and bone disorders Dr. Nabil Bashir Bara Sami. 0 P a g e
]Type text[ ]Type text[ ]Type text[ Biochemistry #02 The biochemical basis of skeletal muscle and bone disorders Dr. Nabil Bashir Bara Sami 0 P a g e Greetings everyone, ladies and gentlemen The biochemical
More informationCellular Respiration Checkup Quiz. 1. Of the following products, which is produced by both anaerobic respiration and aerobic respiration in humans?
1. Of the following products, which is produced by both anaerobic respiration and aerobic respiration in humans? I. Pyruvate II. III. ATP Lactate A. I only B. I and II only C. I, II and III D. II and III
More informationClass XI Chapter 14 Respiration in Plants Biology. 1. It is a biochemical process. 1. It is a physiochemical process.
Question 1: Differentiate between (a) Respiration and Combustion (b) Glycolysis and Krebs cycle (c) Aerobic respiration and Fermentation (a) Respiration and combustion Respiration Combustion 1. It is a
More informationChapter 7 How Cells Release Chemical Energy
Chapter 7 How Cells Release Chemical Energy 7.1 Mighty Mitochondria More than forty disorders related to defective mitochondria are known (such as Friedreich s ataxia); many of those afflicted die young
More informationDr. Mohnen s notes on GLUCONEOGENESIS
Dr. Mohnen s notes on GLUCONEOGENESIS Note: Even though we did not get through all of these slides during lecture, I advise you to look them all through because they will be helpful to you as you learn
More informationDEPARTMENT OF SCIENCE
DEPARTMENT OF SCIENCE COURSE OUTLINE Winter 2017-18 BC 2000 INTRODUCTORY BIOCHEMISTRY 3 (3-0-0) 45 HOURS FOR 15 WEEKS INSTRUCTOR: Philip Johnson PHONE: 780-539-2863 OFFICE: J224 E-MAIL: PJohnson@gprc.ab.ca
More informationLIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
More information2/25/2015. Anaerobic Pathways. Glycolysis. Alternate Endpoints. Gluconeogenesis fate of end products
Anaerobic Pathways Glycolysis Glucose + 2 ATP 4 ATP + 2 Pyruvate No oxygen required Fairly low energy yield Lactate byproduct Resting levels low Tolerances 40 mmole/kg in humans, 200 mmole/kg in sea turtles
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationHigher Biology. Unit 2: Metabolism and Survival Topic 2: Respiration. Page 1 of 25
Higher Biology Unit 2: Metabolism and Survival Topic 2: Respiration Page 1 of 25 Sub Topic: Respiration I can state that: All living cells carry out respiration. ATP is the energy currency of the cell
More informationDEPARTMENT OF SCIENCE
DEPARTMENT OF SCIENCE COURSE OUTLINE Fall 2017 BC 2000 INTRODUCTORY BIOCHEMISTRY 3 (3-0-0) 45 HOURS FOR 15 WEEKS INSTRUCTOR: Philip Johnson PHONE: 780-539-2863 OFFICE: J224 E-MAIL: PJohnson@gprc.ab.ca
More informationQuestion 1: Differentiate between (a) Respiration and Combustion (b) Glycolysis and Krebs cycle (c) Aerobic respiration and Fermentation (a) Respiration and combustion Respiration Combustion 1. It is a
More informationMuscles 3: Contractions, Adaptations & Energy Use
Muscles 3: Contractions, Adaptations & Energy Use Contractions Isotonic: Muscle changes length in response to resistance Concentric: muscle tension exceeds resistance & muscle shortens Eccentric: Resistance
More informationDECLARATION OF CONFLICT OF INTEREST
DECLARATION OF CONFLICT OF INTEREST A potential anti-hypertrophic agent Riham Abouleisa Cardiac hypertrophy is a compensatory response to maintain function during increased stress. A sustained hypertrophic
More informationLipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies
Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:
More informationMitochondria and ATP Synthesis
Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis 1. Mitochondria are sites of ATP synthesis in cells. 2. ATP is used to do work; i.e. ATP is an energy source. 3. ATP hydrolysis releases energy
More information2/4/17. Cellular Metabolism. Metabolism. Cellular Metabolism. Consists of all of the chemical reactions that take place in a cell.
Metabolism Cellular Metabolism Consists of all of the chemical reactions that take place in a cell. Can be reactions that break things down. (Catabolism) Or reactions that build things up. (Anabolism)
More informationEnergy stores in different organs for a 155 lb male, in Calories
Energy stores in different organs for a 155 lb male, in Calories Organ Glucose/ Glycogen Triacyl Glycerols* Liver 400 450 400 Brain 8 0 0 Mobile Proteins Muscle 1,200 450 24,000 Adipose Tissue 80 135,000
More information