Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle

Size: px
Start display at page:

Download "Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle"

Transcription

1 Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle

2 Metabolic Remodeling: Fatty Acids Carbohydrates PCr/ATP

3 Glucose vs. fatty acids: Glucose: O2 efficient substrate, 11% saving in P:O C inefficient, 2/3 carbon enters TCA availability to the cardiac myocyte is subjected to insulin regulation Fatty acids: O2 inefficient substrate, requires 11% or more O2 than glucose high availability and C efficient, every carbon is oxidized FAO is dependent on mitochondrial function reactive lipid species Fatty Acids Carbohydrates PCr/ATP

4 Shifting Substrate Preference to Glucose by overexpressing GLUT1 1 % Oxidation 8 6 carb 4 2 fat WT TG FS% TG

5 Overexpressing GLUT1 delays the transition to failure and Improves Long-term Survival Post Ascending Aortic Constriction WT WT-AAC Animal Survival GLUT1-TG TG-AAC WT-Sham WT-Band TG-Sham TG-Band Days

6 Glucose is not toxic. A greater than endogenous capacity for glucose utilization is needed to compensate for impaired FAO in the adult heart. PPARα -/- mice whole body knockout x GLUT1 TG mice cardiac specific PPARα -/- GLUT1 TG

7 Contributions of glucose vs. fatty acids to the oxidative metabolism Baseline High workload

8 . n i m / g H m 3 m 1 Rate Pressure Product (1 3 mmhg/min) RPP high workload 25 min. glucose mixed substrates +/+ WT WT -/- PPARα WT -/- -/- TG +/+ GLUT1 TG PPARα -/- GLUT1

9 [ATP] [ATP] (mm) M m /+ WT WT -/- WT -/- TG +/+ GLUT1 TG PPARα -/- PPARα -/- GLUT1 2 glucose high workload 25 min. mixed substrates

10 Normalized FAO? Maladaptive: Limited capacity for ATP synthesis use of glucose and use of fatty acids Further facilitates glucose utilization (GLUT1-TG) Adaptive: O 2 demand

11 Strategies: Enhance FAO via the PPARα mechanisms Cardiac PPARα-TG: cardiomyopathy Pharmacological activation: worse or no effects on cardiac function in hypertrophied heart High fat diet Delays the development of heart failure in certain models while worsens the outcome in others FA uptake >> FAO Mitochondrial FAO Manipulate long-chain fatty acid entry

12 Targeting Acetyl-CoA Carboxylase (ACC2) to Specifically Increase FAO Lipid synthesis MCD Acetyl CoA Fatty Acids ACS Malonyl CoA Malonyl CoA Acyl CoA CPT1 ACC1 ACC2 β-oxidation TCA Mitochondrion

13 Cardiac-specific deletion of ACC2 decreases Malonyl-CoA level ACC2 C57 f/wt f/f -/+ -/- Fold Change (from Control) ACC1 mrna. ACC2H -/- ACC2H-/- Heart Gastroc Liver nmol/g dry weight Malonyl CoA ACC2H -/-

14 Effects of ACC2 Deletion on Cardiac Metabolism % Oxidation TAG Content Glycogen Content Relative Contribution to Acetyl-CoA (%) 1 Glucose Fatty Acids Other 5 ACC2H-/- TAG (ug/mg) ACC2H -/- Glucose (µmol/g) ACC2H -/- MVO 2 MVO 2 /RPP µmol of O 2 /min/g ww ACC2H -/- 1 ACC2H-/ Glucose-Pyruvate Mixed Substrate nmol/g protein Acylcarnitines 8 6 ACC2H -/- 4 2 C3 C4 C5 C8 C14 C16 nmol/mmhgx1 3 /g w.w 3 Glc+pyr mixed substrate 2 1 ACC2H -/- ACC2H -/- ACC2H -/- Fold Change (Relative to Control) Gene Expression glut1 glut4 mcd pdk4 cd36 ppara pparg cpt1b mcad ucp3 pgc1a pgc1b erra tfam Glucose Metabolism Lipid Metabolism Mitochondrial Biogenesis

15 High Workload Challenge in Isolated Perfused Heart PCr (mm) ATP (mm) Phosphocreatine Baseline High Workload ATP ACC2H -/- ACC2H-/- HR (bpm) LVDevP (mmhg) Cardiac Function High Workload BL Heart Rate ACC2H-/- ACC2H-/- Pi (mm) Baseline High Workload Inorganic Phosphate + Baseline High Workload ACC2H-/- EDP (mmhg) High Workload BL Diastolic Function High Workload BL ACC2H -/-

16 Aging: Fatty acid metabolism is maintained with normal function and morphology up to 12 months of age Wall Thickness Contribution to Acetyl-CoA (%) Substrate Utilization 2mos 12mos 2mos 12mos Fatty Acids Glucose ACC2H -/- LVPW;d (mm) Fractional Shortening (%) months 12 months In-vivo Function 2 months 12 months ACC2H -/- ACC2H -/-

17 Pressure Overload: TAC Function % Contribution to Acetyl-CoA 1 5 Sham TAC Sham TAC ACC2H-/- Fatty Acids Glucose Other FS (%) BL 4wk 8wk Sham TAC ACC2H -/- -Sham ACC2H -/- -TAC 13 C3-Alanine/ 13 C1-Glucose (AU) Alanine Sham TAC Sham TAC ACC2H-/- Sham TAC Sham TAC ACC2H-/- Anaplerosis/Citrate Synthase Anaplerosis Sham TAC Sham TAC ACC2H-/- RPP (mmhgbpm1 3 ) C-C3Lactate/ 13 C-C1Glucose (AU) Lactate Sham TAC Sham TAC ACC2H-/- PCr/ATP PCr/ATP Sham TAC Sham TAC ACC2H-/- Fatty Acids PCr/ATP Carbohydrates

18 Reduced Hypertrophy and Fibrosis in ACC2H-/- 4 weeks Post-TAC Fold Change (from Control) BNP HW:TL (mg/mm) 1 5 HW/TL Myocyte Area % Fibrosis Cross Sectional Area ( µm 2 ) % Fibrosis Sham TAC Sham TAC Sham TAC Sham TAC Sham TAC Sham TAC ACC2H-/- ACC2H-/- ACC2H-/- Sham TAC Sham TAC ACC2H-/- Sham -/- Sham Sham -/- Sham TAC -/- TAC TAC -/- TAC

19 Optimal energy metabolism Capacity: to meet the high energy demand Balance: uptake = utilization Flexibility: able to utilize what is available No one-size-fit-all substrate for the heart

20 Acknowledgement Ivan Luptak Jie Yan Stephen Kolwicz Jr. Lorena Garcia-Menendez Miranda Nabben Mei Shen Jessica D Agostino Francesco Aiello Yanqiu Xing Liqun Zou Bo Løfgren Biao Lei Georgios Karamanlidis Danos Christodoulou Maengjo Kim Queena Yu Yu-Ying Yang Sung Won Choi Rick M. Mortensen University of Michigan Dan Kelly Washington University, St. Louis Gary Lopaschuk University of Alberta Ronglih Liao Joanne Ingwall Jim Balschi Luigino Nascimben Jun Yoshioka, Richard Lee Brigham and Women s Hospital David Olson Beth Israel Deaconess Med Center Robert Synovec University of Washington

Medical Biochemistry and Molecular Biology department

Medical Biochemistry and Molecular Biology department Medical Biochemistry and Molecular Biology department Cardiac Fuels [Sources of energy for the Cardiac muscle] Intended learning outcomes of the lecture: By the end of this lecture you would be able to:-

More information

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013 Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure

More information

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram

More information

Integrative Metabolism: Significance

Integrative Metabolism: Significance Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell

More information

CHY2026: General Biochemistry. Lipid Metabolism

CHY2026: General Biochemistry. Lipid Metabolism CHY2026: General Biochemistry Lipid Metabolism Lipid Digestion Lipid Metabolism Fats (triglycerides) are high metabolic energy molecules Fats yield 9.3 kcal of energy (carbohydrates and proteins 4.1 kcal)

More information

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential

More information

Fatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders

Fatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders Deficiency Disorders in Pediatrics Published online: December 9, 216 Fatty Acid Oxidation and Its Relation with Insulin Resistance and Associated Disorders Gary D. Lopaschuk Department of Pediatrics, University

More information

Lecture 29: Membrane Transport and metabolism

Lecture 29: Membrane Transport and metabolism Chem*3560 Lecture 29: Membrane Transport and metabolism Insulin controls glucose uptake Adipose tissue and muscles contain a passive glucose transporter GluT4 which takes up glucose from blood. (This is

More information

Mitochondrial Energy Metabolism:

Mitochondrial Energy Metabolism: Mitochondrial Energy Metabolism: How Fa8y Acids and Other Fuels Keep Our Bodies Running David M. Koeller, MD Professor of Pediatrics Director, CDRC Metabolic Clinic What is Energy? What is Energy? What

More information

Test next Thursday, the 24 th will only cover the lecture

Test next Thursday, the 24 th will only cover the lecture Test next Thursday, the 24 th will only cover the lecture material, not lab stuff! Objectives Understand how muscles differ Fiber types Understand how we fuel muscle Glycogen Fats How many ATP from each

More information

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle

More information

Tala Saleh. Razi Kittaneh ... Nayef Karadsheh

Tala Saleh. Razi Kittaneh ... Nayef Karadsheh Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty

More information

In glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic

In glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic Glycolysis 1 In glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic glycolysis. If this pyruvate is converted instead

More information

RESPIRATION Worksheet

RESPIRATION Worksheet A.P. Bio L.C. RESPIRATION Worksheet 1. In the conversion of glucose and oxygen to carbon dioxide and water a) which molecule becomes reduced? b) which molecule becomes oxidized? c) what happens to the

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

Good and bad consequences of altered fatty acid metabolism in heart failure: evidence from mouse models

Good and bad consequences of altered fatty acid metabolism in heart failure: evidence from mouse models Cardiovascular Research (2015) 106, 194 205 doi:10.1093/cvr/cvv105 REVIEW Good and bad consequences of altered fatty acid metabolism in heart failure: evidence from mouse models Desiree Abdurrachim 1,

More information

Effects of sitagliptin on cardiac metabolism in mice

Effects of sitagliptin on cardiac metabolism in mice Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures

More information

OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S

OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the

More information

Fatty acid breakdown

Fatty acid breakdown Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of

More information

Energy metabolism - the overview

Energy metabolism - the overview Energy metabolism - the overview Josef Fontana EC - 40 Overview of the lecture Important terms of the energy metabolism The overview of the energy metabolism The main pathways of the energy metabolism

More information

Increased Glucose Uptake and Oxidation in Mouse Hearts Prevent High Fatty Acid Oxidation but Cause Cardiac Dysfunction in Diet-Induced Obesity

Increased Glucose Uptake and Oxidation in Mouse Hearts Prevent High Fatty Acid Oxidation but Cause Cardiac Dysfunction in Diet-Induced Obesity Increased Glucose Uptake and Oxidation in Mouse Hearts Prevent High Fatty Acid Oxidation but Cause Cardiac Dysfunction in Diet-Induced Obesity Jie Yan, MD, PhD; Martin E. Young, DPhil; Lei Cui, MD; Gary

More information

Name Class Date. 1. Cellular respiration is the process by which the of "food"

Name Class Date. 1. Cellular respiration is the process by which the of food Name Class Date Cell Respiration Introduction Cellular respiration is the process by which the chemical energy of "food" molecules is released and partially captured in the form of ATP. Carbohydrates,

More information

Intermediary metabolism. Eva Samcová

Intermediary metabolism. Eva Samcová Intermediary metabolism Eva Samcová Metabolic roles of tissues Four major tissues play a dominant role in fuel metabolism : liver, adipose, muscle, and brain. These tissues do not function in isolation.

More information

Physiological Chemistry II Exam IV Dr. Melissa Kelley April 13, 2004

Physiological Chemistry II Exam IV Dr. Melissa Kelley April 13, 2004 Name Write your name on the back of the exam Physiological Chemistry II Exam IV Dr. Melissa Kelley April 13, 2004 This examination consists of forty-four questions, each having 2 points. The remaining

More information

Contents. METABOLIC IMAGING Evaluating metabolic changes in heart disease by magnetic resonance spectroscopy Michiel ten Hove and Stefan Neubauer 18

Contents. METABOLIC IMAGING Evaluating metabolic changes in heart disease by magnetic resonance spectroscopy Michiel ten Hove and Stefan Neubauer 18 Contents EDITORIAL Metabolic profile in heart disease Mario Marzilli 3 BASIC ARTICLE Understanding the metabolic phenotype of heart disease Rong Tian 5 MAIN CLINICAL ARTICLE Clinical implications of energetic

More information

Lecture 5: Cell Metabolism. Biology 219 Dr. Adam Ross

Lecture 5: Cell Metabolism. Biology 219 Dr. Adam Ross Lecture 5: Cell Metabolism Biology 219 Dr. Adam Ross Cellular Respiration Set of reactions that take place during the conversion of nutrients into ATP Intricate regulatory relationship between several

More information

Fatty acids synthesis

Fatty acids synthesis Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view

More information

Introduction to Carbohydrate metabolism

Introduction to Carbohydrate metabolism Introduction to Carbohydrate metabolism Some metabolic pathways of carbohydrates 1- Glycolysis 2- Krebs cycle 3- Glycogenesis 4- Glycogenolysis 5- Glyconeogenesis - Pentose Phosphate Pathway (PPP) - Curi

More information

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus

Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating

More information

ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES. Carbohydrate Metabolism

ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES. Carbohydrate Metabolism ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES I. Glycolysis A. Pathway Regulation of glycolysis Hexokinase: Activated by glucose. Inhibited by G6P. 6-Phosphofructokinase: Inhibited by ATP, especially

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty

More information

Integration & Hormone Regulation

Integration & Hormone Regulation Integration Branchpoints in metabolism where metabolites can go several directions 1. Glucose 6-phosphate Energy needed (low energy charge): glycolysis Low blood sugar: high [glucagon], low [insulin] glycogen

More information

Muscle Metabolism. Dr. Nabil Bashir

Muscle Metabolism. Dr. Nabil Bashir Muscle Metabolism Dr. Nabil Bashir Learning objectives Understand how skeletal muscles derive energy at rest, moderate exercise, and strong exercise. Recognize the difference between aerobic and anaerobic

More information

Manipulation of the Nutrient Sensors (AMPK/TOR) with Anaplerotic Diet Therapy (Triheptanoin) An Alternative to Diet Restriction

Manipulation of the Nutrient Sensors (AMPK/TOR) with Anaplerotic Diet Therapy (Triheptanoin) An Alternative to Diet Restriction Manipulation of the Nutrient Sensors (AMPK/TOR) with Anaplerotic Diet Therapy (Triheptanoin) An Alternative to Diet Restriction CharlesR.Roe,MD Institute of Metabolic Disease Baylor University Medical

More information

A cell has enough ATP to last for about three seconds.

A cell has enough ATP to last for about three seconds. Energy Transformation: Cellular Respiration Outline 1. Energy and carbon sources in living cells 2. Sources of cellular ATP 3. Turning chemical energy of covalent bonds between C-C into energy for cellular

More information

Energy Transformation: Cellular Respiration Outline 1. Sources of cellular ATP 2. Turning chemical energy of covalent bonds between C-C into energy

Energy Transformation: Cellular Respiration Outline 1. Sources of cellular ATP 2. Turning chemical energy of covalent bonds between C-C into energy Energy Transformation: Cellular Respiration Outline 1. Sources of cellular ATP 2. Turning chemical energy of covalent bonds between C-C into energy for cellular work (ATP) 3. Importance of electrons and

More information

ANSC/NUTR 618 Lipids & Lipid Metabolism

ANSC/NUTR 618 Lipids & Lipid Metabolism I. verall concepts A. Definitions ANSC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose and lactate) 1) Uses glucose

More information

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O

More information

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal 24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of

More information

4. Which step shows a split of one molecule into two smaller molecules? a. 2. d. 5

4. Which step shows a split of one molecule into two smaller molecules? a. 2. d. 5 1. Which of the following statements about NAD + is false? a. NAD + is reduced to NADH during both glycolysis and the citric acid cycle. b. NAD + has more chemical energy than NADH. c. NAD + is reduced

More information

How Did Energy-Releasing Pathways Evolve? (cont d.)

How Did Energy-Releasing Pathways Evolve? (cont d.) How Did Energy-Releasing Pathways Evolve? (cont d.) 7.1 How Do Cells Access the Chemical Energy in Sugars? In order to use the energy stored in sugars, cells must first transfer it to ATP The energy transfer

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

number Done by Corrected by Doctor F. Al-Khateeb

number Done by Corrected by Doctor F. Al-Khateeb number 23 Done by A. Rawajbeh Corrected by Doctor F. Al-Khateeb Ketone bodies Ketone bodies are used by the peripheral tissues like the skeletal and cardiac muscles, where they are the preferred source

More information

Anaerobic Pathways. Glycolysis

Anaerobic Pathways. Glycolysis Anaerobic Pathways Glycolysis Glucose + 2 ATP 4 ATP + 2 Pyruvate No oxygen required Fairly low energy yield Lactate byproduct Resting levels low Tolerances 40 mmole/kg in humans, 200 mmole/kg in sea turtles

More information

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine

AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION. Kitt Falk Petersen, M.D. Yale University School of Medicine AGING, INSULIN RESISTANCE AND MITOCHONDRIAL FUNCTION Kitt Falk Petersen, M.D. Yale University School of Medicine % of Population Prevalence of Diabetes and Glucose Intolerance 45 40 35 30 25 20 15 10 5

More information

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

ANSC/NUTR 618 Lipids & Lipid Metabolism

ANSC/NUTR 618 Lipids & Lipid Metabolism Fatty Acid ynthesis I. verall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism Fatty Acid ynthesis 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors

More information

Role of the Pyruvate

Role of the Pyruvate Role of the Pyruvate Dehydrogenase Complex in the Regulation of Blood Glucose Robert A. Harris Indiana University School of Medicine Indianapolis, Indiana Kyungpook National University School of Medicine

More information

How Cells Release Chemical Energy. Chapter 7

How Cells Release Chemical Energy. Chapter 7 How Cells Release Chemical Energy Chapter 7 7.1 Overview of Carbohydrate Breakdown Pathways All organisms (including photoautotrophs) convert chemical energy of organic compounds to chemical energy of

More information

Ch 9: Cellular Respiration

Ch 9: Cellular Respiration Ch 9: Cellular Respiration Cellular Respiration An overview Exergonic reactions and catabolic pathway Energy stored in bonds of food molecules is transferred to ATP Cellular respiration provides the energy

More information

g) Cellular Respiration Higher Human Biology

g) Cellular Respiration Higher Human Biology g) Cellular Respiration Higher Human Biology What can you remember about respiration? 1. What is respiration? 2. What are the raw materials? 3. What are the products? 4. Where does it occur? 5. Why does

More information

Chapter 14. Energy conversion: Energy & Behavior

Chapter 14. Energy conversion: Energy & Behavior Chapter 14 Energy conversion: Energy & Behavior Why do you Eat and Breath? To generate ATP Foods, Oxygen, and Mitochodria Cells Obtain Energy by the Oxidation of Organic Molecules Food making ATP making

More information

number Done by Corrected by Doctor Nayef Karadsheh

number Done by Corrected by Doctor Nayef Karadsheh number 13 Done by Asma Karameh Corrected by Saad hayek Doctor Nayef Karadsheh Gluconeogenesis This lecture covers gluconeogenesis with aspects of: 1) Introduction to glucose distribution through tissues.

More information

BIOCHEMISTRY. Glycolysis. by Dr Jaya Vejayan Faculty of Industrial Sciences & Technology

BIOCHEMISTRY. Glycolysis. by Dr Jaya Vejayan Faculty of Industrial Sciences & Technology BIOCHEMISTRY Glycolysis by Dr Jaya Vejayan Faculty of Industrial Sciences & Technology email: jayavejayan@ump.edu.my Chapter Description Overview This chapter is related to carbohydrate catabolism. It

More information

Biol 219 Lec 7 Fall 2016

Biol 219 Lec 7 Fall 2016 Cellular Respiration: Harvesting Energy to form ATP Cellular Respiration and Metabolism Glucose ATP Pyruvate Lactate Acetyl CoA NAD + Introducing The Players primary substrate for cellular respiration

More information

Respiration. Respiration. How Cells Harvest Energy. Chapter 7

Respiration. Respiration. How Cells Harvest Energy. Chapter 7 How Cells Harvest Energy Chapter 7 Respiration Organisms can be classified based on how they obtain energy: autotrophs: are able to produce their own organic molecules through photosynthesis heterotrophs:

More information

Cellular Metabolism 6/20/2015. Metabolism. Summary of Cellular Respiration. Consists of all the chemical reactions that take place in a cell!

Cellular Metabolism 6/20/2015. Metabolism. Summary of Cellular Respiration. Consists of all the chemical reactions that take place in a cell! Cellular Metabolism Biology 105 Lecture 6 Chapter 3 (pages 56-61) Metabolism Consists of all the chemical reactions that take place in a cell! Cellular metabolism: Aerobic cellular respiration requires

More information

Chapter 7 Cellular Respiration and Fermentation*

Chapter 7 Cellular Respiration and Fermentation* Chapter 7 Cellular Respiration and Fermentation* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. Life Is Work

More information

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives

More information

MILK BIOSYNTHESIS PART 3: FAT

MILK BIOSYNTHESIS PART 3: FAT MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl

More information

Cellular Metabolism 9/24/2013. Metabolism. Cellular Metabolism. Consists of all the chemical reactions that take place in a cell!

Cellular Metabolism 9/24/2013. Metabolism. Cellular Metabolism. Consists of all the chemical reactions that take place in a cell! Cellular Metabolism Biology 105 Lecture 6 Chapter 3 (pages 56-61) Metabolism Consists of all the chemical reactions that take place in a cell! Cellular Metabolism Aerobic cellular respiration requires

More information

Moh Tarek. Razi Kittaneh. Jaqen H ghar

Moh Tarek. Razi Kittaneh. Jaqen H ghar 14 Moh Tarek Razi Kittaneh Jaqen H ghar Naif Karadsheh Gluconeogenesis is making glucose from non-carbohydrates precursors. Although Gluconeogenesis looks like Glycolysis in many steps, it is not the simple

More information

Cellular Respiration

Cellular Respiration Cellular I can describe cellular respiration Cellular respiration is a series of metabolic pathways releasing energy from a foodstuff e.g. glucose. This yields energy in the form of ATP adenosine P i P

More information

ANSC/NUTR 618 Lipids & Lipid Metabolism

ANSC/NUTR 618 Lipids & Lipid Metabolism I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

More information

Cellular Metabolism. Biology 105 Lecture 6 Chapter 3 (pages 56-61)

Cellular Metabolism. Biology 105 Lecture 6 Chapter 3 (pages 56-61) Cellular Metabolism Biology 105 Lecture 6 Chapter 3 (pages 56-61) Metabolism Consists of all the chemical reactions that take place in a cell! Cellular Metabolism Aerobic cellular respiration requires

More information

Exercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders. Cary O. Harding, MD Molecular & Medical Gene5cs

Exercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders. Cary O. Harding, MD Molecular & Medical Gene5cs Exercise and rhabdomyolysis in long chain fa4y acid oxida5on disorders Cary O. Harding, MD Molecular & Medical Gene5cs Acknowledgements OHSU Melanie Gillingham, PhD, RD Annie Behrend, MS, RD Autumn Fletcher,

More information

6. How Are Fatty Acids Produced? 7. How Are Acylglycerols and Compound Lipids Produced? 8. How Is Cholesterol Produced?

6. How Are Fatty Acids Produced? 7. How Are Acylglycerols and Compound Lipids Produced? 8. How Is Cholesterol Produced? Lipid Metabolism Learning bjectives 1 How Are Lipids Involved in the Generationand Storage of Energy? 2 How Are Lipids Catabolized? 3 What Is the Energy Yield from the xidation of Fatty Acids? 4 How Are

More information

Biosynthesis of Fatty Acids

Biosynthesis of Fatty Acids Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty

More information

DEPARTMENT OF SCIENCE COURSE OUTLINE Fall 2018 BC 2000 INTRODUCTORY BIOCHEMISTRY 3 (3-0-0) 45 HOURS FOR 15 WEEKS

DEPARTMENT OF SCIENCE COURSE OUTLINE Fall 2018 BC 2000 INTRODUCTORY BIOCHEMISTRY 3 (3-0-0) 45 HOURS FOR 15 WEEKS DEPARTMENT OF SCIENCE COURSE OUTLINE Fall 2018 BC 2000 INTRODUCTORY BIOCHEMISTRY 3 (3-0-0) 45 HOURS FOR 15 WEEKS INSTRUCTOR: Beatrice Amar Ph.D. PHONE: 780-539-2031 OFFICE: J208 E-MAIL: Bamar@gprc.ab.ca

More information

Cellular Respiration Harvesting Chemical Energy ATP

Cellular Respiration Harvesting Chemical Energy ATP Cellular Respiration Harvesting Chemical Energy ATP 2009-2010 Ch.8.3 Section Objectives: Compare and contrast cellular respiration and fermentation. Explain how cells obtain energy from cellular respiration.

More information

Cellular Metabolism. Biol 105 Lecture 6 Read Chapter 3 (pages 63 69)

Cellular Metabolism. Biol 105 Lecture 6 Read Chapter 3 (pages 63 69) Cellular Metabolism Biol 105 Lecture 6 Read Chapter 3 (pages 63 69) Metabolism Consists of all of the chemical reactions that take place in a cell Metabolism Animation Breaking Down Glucose For Energy

More information

Muscles 3: Contractions, Adaptations & Energy Use

Muscles 3: Contractions, Adaptations & Energy Use Muscles 3: Contractions, Adaptations & Energy Use Contractions Isotonic: Muscle changes length in response to resistance Concentric: muscle tension exceeds resistance & muscle shortens Eccentric: Resistance

More information

Unit 2: Metabolic Processes

Unit 2: Metabolic Processes How is energy obtained biologically? Recall: Red Ox Reactions Unit 2: Metabolic Processes Oxidation Is the chief mechanism by which chemical potential energy is released This energy comes from reduced

More information

Biochemistry #02. The biochemical basis of skeletal muscle and bone disorders Dr. Nabil Bashir Bara Sami. 0 P a g e

Biochemistry #02. The biochemical basis of skeletal muscle and bone disorders Dr. Nabil Bashir Bara Sami. 0 P a g e ]Type text[ ]Type text[ ]Type text[ Biochemistry #02 The biochemical basis of skeletal muscle and bone disorders Dr. Nabil Bashir Bara Sami 0 P a g e Greetings everyone, ladies and gentlemen The biochemical

More information

Cellular Respiration Checkup Quiz. 1. Of the following products, which is produced by both anaerobic respiration and aerobic respiration in humans?

Cellular Respiration Checkup Quiz. 1. Of the following products, which is produced by both anaerobic respiration and aerobic respiration in humans? 1. Of the following products, which is produced by both anaerobic respiration and aerobic respiration in humans? I. Pyruvate II. III. ATP Lactate A. I only B. I and II only C. I, II and III D. II and III

More information

Class XI Chapter 14 Respiration in Plants Biology. 1. It is a biochemical process. 1. It is a physiochemical process.

Class XI Chapter 14 Respiration in Plants Biology. 1. It is a biochemical process. 1. It is a physiochemical process. Question 1: Differentiate between (a) Respiration and Combustion (b) Glycolysis and Krebs cycle (c) Aerobic respiration and Fermentation (a) Respiration and combustion Respiration Combustion 1. It is a

More information

Chapter 7 How Cells Release Chemical Energy

Chapter 7 How Cells Release Chemical Energy Chapter 7 How Cells Release Chemical Energy 7.1 Mighty Mitochondria More than forty disorders related to defective mitochondria are known (such as Friedreich s ataxia); many of those afflicted die young

More information

Dr. Mohnen s notes on GLUCONEOGENESIS

Dr. Mohnen s notes on GLUCONEOGENESIS Dr. Mohnen s notes on GLUCONEOGENESIS Note: Even though we did not get through all of these slides during lecture, I advise you to look them all through because they will be helpful to you as you learn

More information

DEPARTMENT OF SCIENCE

DEPARTMENT OF SCIENCE DEPARTMENT OF SCIENCE COURSE OUTLINE Winter 2017-18 BC 2000 INTRODUCTORY BIOCHEMISTRY 3 (3-0-0) 45 HOURS FOR 15 WEEKS INSTRUCTOR: Philip Johnson PHONE: 780-539-2863 OFFICE: J224 E-MAIL: PJohnson@gprc.ab.ca

More information

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo

More information

2/25/2015. Anaerobic Pathways. Glycolysis. Alternate Endpoints. Gluconeogenesis fate of end products

2/25/2015. Anaerobic Pathways. Glycolysis. Alternate Endpoints. Gluconeogenesis fate of end products Anaerobic Pathways Glycolysis Glucose + 2 ATP 4 ATP + 2 Pyruvate No oxygen required Fairly low energy yield Lactate byproduct Resting levels low Tolerances 40 mmole/kg in humans, 200 mmole/kg in sea turtles

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

Higher Biology. Unit 2: Metabolism and Survival Topic 2: Respiration. Page 1 of 25

Higher Biology. Unit 2: Metabolism and Survival Topic 2: Respiration. Page 1 of 25 Higher Biology Unit 2: Metabolism and Survival Topic 2: Respiration Page 1 of 25 Sub Topic: Respiration I can state that: All living cells carry out respiration. ATP is the energy currency of the cell

More information

DEPARTMENT OF SCIENCE

DEPARTMENT OF SCIENCE DEPARTMENT OF SCIENCE COURSE OUTLINE Fall 2017 BC 2000 INTRODUCTORY BIOCHEMISTRY 3 (3-0-0) 45 HOURS FOR 15 WEEKS INSTRUCTOR: Philip Johnson PHONE: 780-539-2863 OFFICE: J224 E-MAIL: PJohnson@gprc.ab.ca

More information

Question 1: Differentiate between (a) Respiration and Combustion (b) Glycolysis and Krebs cycle (c) Aerobic respiration and Fermentation (a) Respiration and combustion Respiration Combustion 1. It is a

More information

Muscles 3: Contractions, Adaptations & Energy Use

Muscles 3: Contractions, Adaptations & Energy Use Muscles 3: Contractions, Adaptations & Energy Use Contractions Isotonic: Muscle changes length in response to resistance Concentric: muscle tension exceeds resistance & muscle shortens Eccentric: Resistance

More information

DECLARATION OF CONFLICT OF INTEREST

DECLARATION OF CONFLICT OF INTEREST DECLARATION OF CONFLICT OF INTEREST A potential anti-hypertrophic agent Riham Abouleisa Cardiac hypertrophy is a compensatory response to maintain function during increased stress. A sustained hypertrophic

More information

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:

More information

Mitochondria and ATP Synthesis

Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis 1. Mitochondria are sites of ATP synthesis in cells. 2. ATP is used to do work; i.e. ATP is an energy source. 3. ATP hydrolysis releases energy

More information

2/4/17. Cellular Metabolism. Metabolism. Cellular Metabolism. Consists of all of the chemical reactions that take place in a cell.

2/4/17. Cellular Metabolism. Metabolism. Cellular Metabolism. Consists of all of the chemical reactions that take place in a cell. Metabolism Cellular Metabolism Consists of all of the chemical reactions that take place in a cell. Can be reactions that break things down. (Catabolism) Or reactions that build things up. (Anabolism)

More information

Energy stores in different organs for a 155 lb male, in Calories

Energy stores in different organs for a 155 lb male, in Calories Energy stores in different organs for a 155 lb male, in Calories Organ Glucose/ Glycogen Triacyl Glycerols* Liver 400 450 400 Brain 8 0 0 Mobile Proteins Muscle 1,200 450 24,000 Adipose Tissue 80 135,000

More information