LPS LPS P6 - + Supplementary Fig. 1.

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "LPS LPS P6 - + Supplementary Fig. 1."

Transcription

1 P6 LPS LPS P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW cells were stimulated with LPS in the absence or the present of pyridone 6 (P6) for 16h. The localization of cellular HMGB1 was measured by fluorescent immunostaining using confocal microscopy. Shown in the upper panel are representative images of HMGB1 immunostaining; shown in the lower panel are Means ± SEM of two independent experiments. #, p<0.05.

2 Supplementary Fig 2. Mouse macrophages were stimulated with LPS in the absence or the present of pyridone 6 (P6) for 6 h. The levels of cytokines or chemokines in the culture medium were measured by cytokine antibodies array.

3 Supplementary Fig. 3. Mouse macrophages were stimulated with LPS in the absence or the present of pyridone 6 (P6) for 6 h. The levels of IL-10 in the culture medium were assessed by ELISA.

4 A B C Supplementary Fig. 4. RAW cells were incubated with rapamycin (500 nm) for 18 h. (A, B) HMGB1 nuclear translocation was assessed by immunostaining. Shown in (A) are representative images of HMGB1 immunostaining; shown in (B) are Means ± SEM of two independent experiments. Scale bars = 20 µm. (C) Levels of HMGB1 in cell culture medium were measured by western-blot.

5 A B C Supplementary Fig. 5. RAW cells that stably express GFP-LC3 were stimulated with LPS (1 µg/ml) for 16 h in the presence or the absence of pyridone 6 (P6). (A, B) Quantitation of autophagy was performed based on the percentage of cells with GFP-LC3-positive punctate dots. Scale bars = 20 µm. Shown in (A) are representative images; shown in (B) are Means ± SEM of two independent experiments. (C) RAW cells were stimulated with LPS or rapamycin for 16 h in the presence or the absence of P6, and then the cellular levels of LC3B-II were measured by western-blot. #, p<0.05.

6 A B C Supplementary Fig. 6. RAW cells that stably express GFP-LC3 were stimulated with rapamycin (500 nm) for 16 h in the presence or the absence of pyridone 6 (P6). (A, B) Quantitation of autophagy was performed based on the percentage of cells with GFP-LC3-positive punctate dots. Scale bars = 20 µm. Shown in (A) are representative images; shown in (B) are Means ± SEM of two independent experiments. (C) RAW cells were stimulated with LPS or rapamycin for 16 h in the presence or the absence of P6, and then the cellular levels of LC3B-II were measured by western-blot.

7 Supplementary Fig. 7. RAW cells were stimulated with LPS (1 µg/ml) for 16 h in the presence or the absence of pyridone 6 (P6). HMGB1 nuclear translocation was assessed by immunostaining. Scale bars = 20 µm. Shown in upper panel are representative images of HMGB1 immunostaining; shown in lower panel are Means ± SEM of two independent experiments. #, p<0.05.

8 Supplementary Fig. 8. Activation of the JAK/STAT pathway by type 1 IFN induces HMGB1 cytoplasmic accumulation. RAW cells were stimulated with IFN-β in the absence or the present of different dose of pyridone 6 or 2-AP for 16h. The localization of cellular HMGB1 was measured by fluorescent immunostaining using confocal microscopy. Scale bars = 10 µm.

9 A B C Supplementary Fig. 9. (A) RAW cells were stimulated with LPS (1 µg/ml) for 16 h in the presence or the absence of pyridone 6 (P6). (B) Mouse peritoneal macrophages were stimulated with LPS (100 ng/ml) in the absence or the presence of IFN-β (100 U/ml) for 16 h. (C) Mouse peritoneal macrophages were stimulated with LPS (100 ng/ml) and IFN-β (100 U/ml) in the absence or the presence of IFN-β (100 U/ml) for 16 h. Levels of LDH in cell culture medium were measured by LDH assay. Results are Means ± SEM of two independent experiments. #, p<0.05.

10 Supplementary Figure 10. Mouse embryonic fibroblasts (MEFs) were stimulated with IFN-β (1000 U/ml) or Poly I:C (10 µg/ml) for 16 h. Levels of HMGB1 in cell culture medium were assessed by western-blot.

11 Intensity (counts/sec) Intensity (counts/sec) Intensity (counts/sec) Intensity (counts/sec) y3 H-K-K-K-H-P-D-A-S-V-N-F-S-E 2.0e6 1.6e6 1.2e6 8.0e5 4.0e5 y b2-nh b y b y y4-h 2 O b b5 y y6-nh y y b y b y m/z (Da) R-W-K-T-M-S-A-K-E y y y y b3 b y2-nh y5-h 2 O y b y b b5-nh b y b6-nh b6-h 2 O b m/z (Da) Y-R-P-K(Ac)-I-K(Ac)-G-E y y2-h 2 O y b3-nh 3 b y4(ac) y3(ac) b3 b m/z (Da) b4(ac) y5(ac) b y6(ac) b6(ac) y7(ac) K-S-K-K-K-K-E-E-E-E y y4 y6-nh 3 b b7+h 2 O b6 y4-nh y7-nh 3 y5 3 y3-h2 O b2 y b4 b y y6 b y7 b b3-nh b6-h 2 O m/z (Da) Supplementary Fig. 11. Acetylated lysine residues within HMGB1 protein of unstimulated THP-1 cells was assessed by high resolution liquid chromatography tandem mass spectrometric analysis (LC-MS/MS). Shown in the figure are representative MS traces.

12 Intensity (counts/sec) Intensity (counts/sec) Intensity (counts/sec) Intensity (counts/sec) y3 H-K(Ac)-K(Ac)-K(Ac)-H-P-D-A-S-V-N-F-S-E e6 1.0e6 7.5e5 5.0e5 2.5e5 y y b2 K(Ac) b3 K(Ac) y y b4 K(Ac) y6-nh y b y y y m/z (Da) R-W-K-T-M-S-A-K-E y y y y b3 b y2-nh y5-h 2 O y b y b b5-nh b y b6-nh b6-h 2 O b m/z (Da) Y-R-P-K(Ac)-I-K(Ac)-G-E y y2-h 2 O y b3-nh 3 b y4(ac) y3(ac) b3 b m/z (Da) b4(ac) y5(ac) b y6(ac) b6(ac) y7(ac) K(Ac)-S-K(Ac)-K(Ac)-K(Ac)-K(Ac)-E-E-E-E 1.6e4 1.4e4 1.2e4 1.0e y b2 b6 2+ y4 b4 K(ac) K(ac) y3 K(ac) E b5 K(ac) E-H 2 O K(ac) b y K(ac) y6 b6 y K(ac) K(ac) m/z (Da) Supplementary Fig. 12. THP-1 cells were stimulated with LPS for 3 h. Acetylated lysine residues within HMGB1 protein was assessed by high resolution liquid chromatography tandem mass spectrometric analysis (LC- MS/MS). Shown in the figure are representative MS traces.

13 Supplementary Fig. 13. THP-1 cells were stimulated with LPS for 3 h. And the acetylation of intracellular HMGB1 protein was assessed by high resolution liquid chromatography tandem mass spectrometric analysis (LC- MS/MS). Acetylated lysine residues within HMGB1 protein are shown in red.

14 Supplementary Fig. 14. JAK/STAT1 signaling is dispensable for LPS- or IFN-induced HMGB1 oxidation. Mouse peritoneal macrophages were stimulated with indicated stimuli in the absence or the presence of pyridone 6 (P6) for 6 h. The redox status of intracellular HMGB1 protein was assessed by LC-MS/MS. Shown in the panels are representative MS traces.

15 Supplementary Fig. 15. The mechanism of HMGB1 release by activated immune cells. There are two important steps for HMGB1 release from activated immune cells during infection. In the first step, LPS induces the expression of type 1 interferon. This is followed by activation of JAK/STAT1 signaling that mediates HMGB1 cytoplasmic accumulation by inducing HMGB1 hyperacetylation at the NLS sites. LPS also activates CaMKIV and promotes HMGB1 cytoplasmic accumulation by inducing HMGB1 serine phosphorylation. In the second step, endogenous danger signals or pathogens induce canonical or non-canonical inflammasome activation, which in turn activates caspase-1 or caspase-11, respectively. This is followed by pyroptosis, which mediates cytoplasmic HMGB1 release into the extracellular space.

16 Supplementary Fig. 16. Pharmacological inhibition of JAK/STAT signaling by pyridone 6 did not affect histone deacetylase activity. RAW cells were stimulated with LPS (1 µg/ml) in the presence or the absence of pyridone 6 (P6) for 6 h. Histone deacetylase activity of cell lysates was determined by histone deacetylase assay kit, and normalized by total protein levels.

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Understanding the Role of the Inflammasome in Inflammation

Understanding the Role of the Inflammasome in Inflammation Understanding the Role of the Inflammasome in Inflammation Martha O Brien, Ph.D. Assay Design Group 215 Innate Immune Response in Inflammation LPS flagellin TLR-1/2/6 TLR-4 TLR-5 Adaptor proteins PAMPs,

More information

Host cell activation

Host cell activation Dept. of Internal Medicine/Infectious and Respiratory Diseases Stefan Hippenstiel Epigenetics as regulator of inflammation Host cell activation LPS TLR NOD2 MDP TRAF IKK NF-κB IL-x, TNFα,... Chromatin

More information

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Research Foundation, 18 month progress report THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Ekaterina Ivanova, doctoral student Elena Levtchenko, MD, PhD, PI Antonella

More information

Supporting Information for:

Supporting Information for: Supporting Information for: Ultrasensitive Fluorescent Probes Reveal an dverse ction of Dipeptide Peptidase IV and Fibroblast ctivation Protein during Proliferation of Cancer Cells Qiuyu Gong,, Wen Shi,

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn. Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Stochastic Expression of the Interferon-b Gene

Stochastic Expression of the Interferon-b Gene Mingwei Zhao 1, Jiangwen Zhang 2., Hemali Phatnani 3., Stefanie Scheu 4, Tom Maniatis 1,3 * 1 Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, United States of

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

EM-X Herbal Tea Inhibits Interleukin-8 Release in Alvelor Epithelial cells

EM-X Herbal Tea Inhibits Interleukin-8 Release in Alvelor Epithelial cells EM-X Herbal Tea Inhibits Interleukin-8 Release in Alvelor Epithelial cells Okezie I. Arouma a) and Irfan Rahman b) a) Department of Neuroinflammation, Division of Neuroscience & Psychological Medicine,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

3. Results. 3.1 Elevated osmolality is required for the DBcAMP-elicited expression of robust AQP2 protein levels in IMCD cells

3. Results. 3.1 Elevated osmolality is required for the DBcAMP-elicited expression of robust AQP2 protein levels in IMCD cells 3. Results 3.1 Elevated osmolality is required for the DcAMPelicited expression of robust AQP2 protein levels in IMCD cells Primary cultured IMCD cells, derived from rat inner medullae, were used as a

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

APOLs with low ph dependence can kill all African trypanosomes

APOLs with low ph dependence can kill all African trypanosomes SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41564-17-34-1 In the format provided by the authors and unedited. APOLs with low ph dependence can kill all African trypanosomes Frédéric Fontaine 1, Laurence

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Following T-cell activation and differentiation with HTRF reagents: IL-2, IFN-γ and IL-17

Following T-cell activation and differentiation with HTRF reagents: IL-2, IFN-γ and IL-17 Following T-cell activation and differentiation with HTRF reagents: IL-2, IFN-γ and IL-17 4 th HTRF Symposium for Drug Discovery Avignon, Sept. 24-26, 28 Introduction: T-cells have effector and helper

More information

ab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric)

ab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric) ab156064 Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric) Instructions for Use For the quantitative measurement of Histone Deacetylase activity in cell lysates This product is for research

More information

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex.

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. Figure Captions Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. A) XRD, B) Particle size distribution and zeta potential distribution of LDHs and 5- FU(10)/LDH nanohybrids,

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit]

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit] MANUAL IL-1alpha (mouse) ELISA Kit [Interleukin-1 alpha (mouse) ELISA Kit] For research use only. Not for diagnostic use Version 1 (March-5-2013) Cat. No. AG-45B-0003-KI01 www.adipogen.com Table of Contents

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Caspase-11 Activation in Response to Bacterial Secretion Systems That Access the Host Cytosol

Caspase-11 Activation in Response to Bacterial Secretion Systems That Access the Host Cytosol University of Pennsylvania ScholarlyCommons Department of Microbiology Perelman School of Medicine 6-6-2013 Caspase-11 Activation in Response to Bacterial Secretion Systems That Access the Host Cytosol

More information

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

HDAC1 Inhibitor Screening Assay Kit

HDAC1 Inhibitor Screening Assay Kit HDAC1 Inhibitor Screening Assay Kit Catalog Number KA1320 96 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Lung contusion (LC) is the primary cause of mortality

Lung contusion (LC) is the primary cause of mortality Double-Stranded RNA Interacts With Toll-Like Receptor 3 in Driving the Acute Inflammatory Response Following Lung Contusion Madathilparambil V. Suresh, PhD 1 ; Bivin Thomas, MD 1 ; David Machado-Aranda,

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit STAT3 (py705) (Human/Mouse/Rat) ELISA Kit Catalog Number KA2175 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT3 (py705) (Human/Mouse/Rat) ELISA (Enzyme-Linked

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...

More information

Hypoxia Triggers AMPK Activation through Reactive Oxygen Species-Mediated Activation of Calcium Release-Activated Calcium Channels

Hypoxia Triggers AMPK Activation through Reactive Oxygen Species-Mediated Activation of Calcium Release-Activated Calcium Channels MOLECULAR AND CELLULAR BIOLOGY, Sept. 2011, p. 3531 3545 Vol. 31, No. 17 0270-7306/11/$12.00 doi:10.1128/mcb.05124-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Hypoxia Triggers

More information

ab Complex II Enzyme Activity Microplate Assay Kit

ab Complex II Enzyme Activity Microplate Assay Kit ab109908 Complex II Enzyme Activity Microplate Assay Kit Instructions for Use For the quantitative measurement of Complex II activity in samples from Human, Rat, Mouse and Cow This product is for research

More information

Transcription factors in airway diseases

Transcription factors in airway diseases & 2006 USCAP, Inc All rights reserved 0023-6837/06 $30.00 www.laboratoryinvestigation.org Peter J Barnes Section of airway diseases, National Heart & Lung Institute, Imperial College, London, UK Transcription

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

Franco Laghi Pasini University of Siena 1240

Franco Laghi Pasini University of Siena 1240 Franco Laghi Pasini University of Siena 1240 Purinergic system and the inflammatory response General overview P2X7R A2AR Rheumatoid Arthritis The odd couple AGENDA ATP: production stimuli and cellular

More information

Lecture on Innate Immunity and Inflammation

Lecture on Innate Immunity and Inflammation Lecture on Innate Immunity and Inflammation Evolutionary View Epithelial barriers to infection Four main types of innate recognition molecules:tlrs, CLRs, NLRs, RLRs NF-κB, the master transcriptional regulator

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

2. Innate immunity 2013

2. Innate immunity 2013 1 Innate Immune Responses 3 Innate immunity Abul K. Abbas University of California San Francisco The initial responses to: 1. Microbes: essential early mechanisms to prevent, control, or eliminate infection;

More information

Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD ? Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Christian S Lobsiger & Don W Cleveland (2007) Nature Neuroscience 10, 1355-1360 Astrocytes: interlinked gatekeepers of glutamate astrocytes

More information

Supplemental Information. Supernumerary Centrosomes. Nucleate Extra Cilia and Compromise. Primary Cilium Signaling. Current Biology, Volume 22

Supplemental Information. Supernumerary Centrosomes. Nucleate Extra Cilia and Compromise. Primary Cilium Signaling. Current Biology, Volume 22 Current Biology, Volume 22 Supplemental Information Supernumerary Centrosomes Nucleate Extra Cilia and Compromise Primary Cilium Signaling Moe R. Mahjoub and Tim Stearns Supplemental Inventory 1. Supplemental

More information

A copy can be downloaded for personal non-commercial research or study, without prior permission or charge

A copy can be downloaded for personal non-commercial research or study, without prior permission or charge Jabir, M. S. et al. (2014) Caspase-1 cleavage of the TLR adaptor TRIF inhibits autophagy and β-interferon production during pseudomonas aeruginosa infection. Cell Host and Microbe, 15(2), pp. 214-227.

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Common γ-chain cytokine signaling is required for macroautophagy induction during CD4 + T-cell activation

Common γ-chain cytokine signaling is required for macroautophagy induction during CD4 + T-cell activation Autophagy ISSN: 1554-8627 (Print) 1554-8635 (Online) Journal homepage: http://www.tandfonline.com/loi/kaup20 Common γ-chain cytokine signaling is required for macroautophagy induction during CD4 + T-cell

More information

MHC class I MHC class II Structure of MHC antigens:

MHC class I MHC class II Structure of MHC antigens: MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain

More information

Uncovering the mechanisms of wound healing and fibrosis

Uncovering the mechanisms of wound healing and fibrosis Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:

More information

The role of the scaffolding protein Tks5 in EGF signaling

The role of the scaffolding protein Tks5 in EGF signaling The role of the scaffolding protein Tks5 in EGF signaling PhD Thesis Anna Fekete Doctoral School in Biology Head of the School: Dr. Anna Erdei Structural Biochemistry Doctoral Program Head of the Program:

More information

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive

More information

The Detection of Allergens in Food Products with LC-MS

The Detection of Allergens in Food Products with LC-MS The Detection of Allergens in Food Products with LC-MS Something for the future? Jacqueline van der Wielen Scope of Organisation Dutch Food and Consumer Product Safety Authority: Law enforcement Control

More information

How Reactive Metabolites Induce an Immune Response that Sometimes Leads to an Idiosyncratic Drug Reaction

How Reactive Metabolites Induce an Immune Response that Sometimes Leads to an Idiosyncratic Drug Reaction How Reactive Metabolites Induce an Immune Response that Sometimes Leads to an Idiosyncratic Drug Reaction Jack Uetrecht, M.D., Ph.D. jack.uetrecht@utoronto.ca It is very difficult to study the mechanisms

More information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen, Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,

More information

BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION

BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION BALANCE BETWEEN ESTROGE AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION Nadine Dragin 1, 2, 3,, Patrice Nancy 4, José Villegas 2, 3, 5, Régine

More information

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit 2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images

More information

Supplementary Information

Supplementary Information Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,

More information

The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego

The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride

More information

Differential Signalling and Kinetics of Neutrophil Extracellular Trap Release Revealed by Quantitative Live Imaging

Differential Signalling and Kinetics of Neutrophil Extracellular Trap Release Revealed by Quantitative Live Imaging Differential Signalling and Kinetics of Neutrophil Extracellular Trap Release Revealed by Quantitative Live Imaging Maarten van der Linden 1, Geertje H.A. Westerlaken 1, Michiel van der Vlist 1, Joris

More information

Apolipoprotein A-1 ELISA

Apolipoprotein A-1 ELISA Apolipoprotein A-1 ELISA For the quantitative determination of apolipoprotein A1 in serum and plasma. For Research Use Only. Not For Use In Diagnostic Procedures. Please read carefully due to Critical

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

Imidazolium Ionic Liquids Containing Selenium: Synthesis and Antimicrobial Activity

Imidazolium Ionic Liquids Containing Selenium: Synthesis and Antimicrobial Activity Electronic Supplementary Information Imidazolium Ionic Liquids Containing lenium: Synthesis and Antimicrobial Activity Eduardo E. Alberto, Luana L. Rossato, Sydney Hartz Alves, Diego Alves and Antonio

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Optimizing Intracellular Flow Cytometry

Optimizing Intracellular Flow Cytometry Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles

More information

Cell-mediated Immunity

Cell-mediated Immunity Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

13 13 1 1 1 12 0250512 24 1 1 48 1 70250512 24 1 148 1 0250512 24 1 48 1313 7025 0512 24 1 48 1313 13 13 11 24 0250512 48 1 7 124 0250512 48 1 124 0250512 48 13 13 7124 0250512 48 1313 13 13 1350250512

More information

Structural vs. nonstructural proteins

Structural vs. nonstructural proteins Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?

More information

IFITM proteins are incorporated onto HIV-1 virion particles and negatively imprint their infectivity

IFITM proteins are incorporated onto HIV-1 virion particles and negatively imprint their infectivity Tartour et al. Retrovirology 2014, 11:103 RESEARCH Open Access IFITM proteins are incorporated onto HIV-1 virion particles and negatively imprint their infectivity Kevin Tartour 1,2,3,4,5, Romain Appourchaux

More information

JBC Papers in Press. Published on July 17, 2017 as Manuscript M

JBC Papers in Press. Published on July 17, 2017 as Manuscript M JBC Papers in Press. Published on July 17, 2017 as Manuscript M117.784090 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.m117.784090 Surface TLR3 Expression in Metastatic IECs Surface

More information

System Biology analysis of innate and adaptive immune responses during HIV infection

System Biology analysis of innate and adaptive immune responses during HIV infection System Biology analysis of innate and adaptive immune responses during HIV infection Model of T cell memory persistence and exhaustion Naive Ag+APC Effector TEM (Pfp, Gr.B, FasL, TNF) Ag stim. IL-2, IL-7,

More information

Acidic extracellular ph of tumors induces octamerbinding transcription factor 4 expression in murine fibroblasts in vitro and in vivo

Acidic extracellular ph of tumors induces octamerbinding transcription factor 4 expression in murine fibroblasts in vitro and in vivo Washington University School of Medicine Digital Commons@Becker Open Access Publications 2016 Acidic extracellular ph of tumors induces octamerbinding transcription factor 4 expression in murine fibroblasts

More information

Many G protein-coupled receptors (GPCRs) 2 are rapidly endocytosed after agonist binding, but the pathway of postendocytic

Many G protein-coupled receptors (GPCRs) 2 are rapidly endocytosed after agonist binding, but the pathway of postendocytic THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 40, pp. 29646 29657, October 5, 2007 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Hepatocyte Growth

More information

International Graduate Research Programme in Cardiovascular Science

International Graduate Research Programme in Cardiovascular Science 1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.

More information

Examples of questions for Cellular Immunology/Cellular Biology and Immunology

Examples of questions for Cellular Immunology/Cellular Biology and Immunology Examples of questions for Cellular Immunology/Cellular Biology and Immunology Each student gets a set of 6 questions, so that each set contains different types of questions and that the set of questions

More information