Solid-Phase Purification of Synthetic DNA Sequences. Serge L. Beaucage, Ph.D. Chief, Laboratory of Biological Chemistry FDA-CDER
|
|
|
- Andra Wheeler
- 6 years ago
- Views:
Transcription
1 Solid-Phase Purification of Synthetic DNA Sequences Serge L. Beaucage, Ph.D. Chief, Laboratory of Biological Chemistry FDA-CDER
2 The one who follows the crowd will usually go no further than the crowd. Those who walk alone are likely to find themselves in places no one has ever been before. Albert Einstein
3 Synthetic DNA/RNA Sequence Applications DNA primers for PCR amplification DNA primers for DNA sequencing DNA probes for diagnostic applications DNA sequences for total gene assembly and gene therapy applications DNA sequences for gene editing (CRISPR/cas9) DNA sequences for therapeutic applications (antisense and steric blockers, DNA aptamers, DNA decoys) RNA sequences for therapeutic applications: shrna, ribosymes, sirna, mirna, RNA aptamers, ncrnas
4 Solid-Phase DNA Synthesis
5
6 Synthetic DNA Purification Methods Method High-throughput Scalable Cost effective Affinity chromatography of 5 - biotinylated DNA sequences using NeutrAvidin-coated microspheres Potentially No No RP-HPLC-based hydrophobic interaction No Yes No HPLC-based ion-exchange/ion-pair No Yes No Enzymatic hydrolysis of shorter than full-length nucleic acid sequences Catching shorter than full-length sequences through a polymerization process Potentially No No Potentially Yes Yes Polyacrylamide gel electrophoresis Potentially No Yes
7 High-Throughput, Efficient and Scalable Solid-Phase Purification of Synthetic DNA Sequences Grajkowski, A., Cieślak, J. and Beaucage, S. L. J. Org. Chem., 2016, 81,
8 The Concept
9 Preparation of the Capture Support: Si ONH 2
10 Synthesis of the Capture Linker
11 Synthesis of the 5 -Functionalized Deoxyribonuclosides and Their 3 -Phosphoramidite Derivatives
12 Synthesis of the 5 -Functionalized DNA Sequences a CLF, capture linker function; PS, phosphorothioate diester; P, phosphate diester
13
14 Solid-Phase purification of the DNA sequence 10a A: RP-HPLC analysis of unpurified 5 - functionalized DNA sequence 10a B: RP-HPLC analysis of the solid-phase capture of 10a C:RP-HPLC and PAGE analysis of the released DNA sequence 12a from the capture support
15 Solid-Phase purification of the DNA sequence 10b A: RP-HPLC analysis of unpurified 5 - functionalized DNA sequence 10b B: RP-HPLC analysis of the solid-phase capture of 10b C:RP-HPLC and PAGE analysis of the released DNA sequence 12b from the capture support
16 Solid-Phase purification of the DNA sequence 10c A: RP-HPLC analysis of unpurified 5 - functionalized DNA sequence 10c B: RP-HPLC analysis of the solid-phase capture of 10c C:RP-HPLC and PAGE analysis of the released DNA sequence 12c from the capture support
17 Solid-Phase purification of the DNA sequence 10d A: RP-HPLC analysis of unpurified 5 - functionalized DNA sequence 10d B: RP-HPLC analysis of the solid-phase capture of 10d C:RP-HPLC and PAGE analysis of the released DNA sequence 12d from the capture support
18 Solid-Phase purification of the DNA sequence 10e A: RP-HPLC analysis of unpurified 5 - functionalized DNA sequence 10e B: RP-HPLC analysis of the solid-phase capture of 10e C:RP-HPLC and PAGE analysis of the released DNA sequence 12e from the capture support
19 Solid-Phase purification of the DNA sequence 10f A: RP-HPLC analysis of unpurified 5 - functionalized DNA sequence 10f B: RP-HPLC analysis of the solid-phase capture of 10f C:RP-HPLC and PAGE analysis of the released DNA sequence 12f from the capture support
20 Scalability of the Solid-Phase Purification of DNA Sequence 10a (10-Fold Scale-up Purification) A: RP-HPLC analysis of unpurified 5 - functionalized DNA sequence 10a (10 µmol) C: RP-HPLC and PAGE analysis of the released DNA sequence 12a from the linearly scaled-up capture support. D: Photograph of the solid-phase purified DNA sequence 10a after precipitation in THF.
21 Collaborators Andrzej Grajkowski Jacek Cieślak
Metabion GmbH, Germany
Metabion GmbH, Germany CUSTOM OLIGO NUCLEOTIDE SYNTHESIS DNA Single Tube Format (price per base) Scale Standard Yield OPC Purified Yield HPLC Purified Yield (µmol) Rs (OD 260 ) Rs (OD 260 ) Rs (OD 260
Service and Collaboration
Summary Section 7 Introduction 68 Exosome and Microvesicle Isolation 69 EV protein quantification, sceening and profiling 69 Nanoparticle Tracking Analysis (NTA) 70 EV Nucleic Acid isolation 70 Nucleic
Cell-free Expression Microarrays
Proteomics Cell-free Expression Cell-free Expression Microarrays Cell-free expression involves the rapid, in situ synthesis of proteins from their corresponding DNA templates directly on the microarray
BIOCHEMISTRY & MEDICINE:
BIOCHEMISTRY & MEDICINE: INTRODUCTION Biochemistry can be defined as the science of the chemical basis of life (Gk bios "life"). The cell is the structural unit of living systems. Thus, biochemistry can
Supplementary Figure 1
Supplementary Figure 1 Isolation of mt-trnas and RNA-MS analysis of mt-trna Asn from M. nudus (a)m. nudus mt-trnas were isolated by RCC and resolved by 10% denaturing PAGE. The gel was stained with SYBR
Agilent Technologies Prep LC Columns
Agilent Technologies Prep LC Columns Agilent Technologies Prep LC Columns Agilent Technologies has always taken seriously its responsibility to ensure your success. That s why all our instruments and supplies
Supporting Information
Translation of DNA into Synthetic N-Acyloxazolidines Xiaoyu Li, Zev. J. Gartner, Brian N. Tse and David R. Liu* Department of Chemistry and Chemical Biology, Harvard University, Cambridge, Massachusetts
Biology. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall
Biology 1 of 37 2 of 37 The Chemistry of Carbon The Chemistry of Carbon Organic chemistry is the study of all compounds that contain bonds between carbon atoms. 3 of 37 Macromolecules Macromolecules Macromolecules
Ambient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays
Ambient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays C. Litterst 1, H. Martinez, B. Iverson and R. Nuňez 1 Bio-Rad Laboratories, Life Science
Ali Alabbadi. Bann. Bann. Dr. Belal
31 Ali Alabbadi Bann Bann Dr. Belal Topics to be discussed in this sheet: Particles-to-PFU Single-step and multi-step growth cycles Multiplicity of infection (MOI) Physical measurements of virus particles
MBB 694:407, 115:511. Please use BLOCK CAPITAL letters like this --- A, B, C, D, E. Not lowercase!
MBB 694:407, 115:511 First Test Severinov/Deis Tue. Sep. 30, 2003 Name Index number (not SSN) Row Letter Seat Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions
Identification of Microbes Lecture: 12
Diagnostic Microbiology Identification of Microbes Lecture: 12 Electron Microscopy 106 virus particles per ml required for visualization, 50,000-60,000 magnification normally used. Viruses may be detected
XTRAKT FFPE Kit / Manual
XTRAKT FFPE Kit / Manual For manual extraction of RNA, mirna and/or DNA from Formalin Fixed Paraffin Embedded (FFPE) tissue samples Catalog No. # XTK2.0-96 For research use only. Not intended for diagnostic
L I F E S C I E N C E S
1a L I F E S C I E N C E S 5 -UUA AUA UUC GAA AGC UGC AUC GAA AAC UGU GAA UCA-3 5 -TTA ATA TTC GAA AGC TGC ATC GAA AAC TGT GAA TCA-3 3 -AAT TAT AAG CTT TCG ACG TAG CTT TTG ACA CTT AGT-5 OCTOBER 31, 2006
WHY IS THIS IMPORTANT?
CHAPTER 2 FUNDAMENTAL CHEMISTRY FOR MICROBIOLOGY WHY IS THIS IMPORTANT? An understanding of chemistry is essential to understand cellular structure and function, which are paramount for your understanding
LIPIDS and RELATED COMPOUNDS
LIIDS and RELATED CMUDS 1. Waxes esters of long chain carboxylic acids (fatty acids) and long chain alcohols 2. Fats (animal) and oils (vegetable) triacylglycerols: triesters of glycerol and fatty acids
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:
Chapter 2 The Chemistry of Life Part 2
Chapter 2 The Chemistry of Life Part 2 Carbohydrates are Polymers of Monosaccharides Three different ways to represent a monosaccharide Carbohydrates Carbohydrates are sugars and starches and provide
HPLC '88. Poster Presentation. Isolation of Thymosin B4 from Thymosin Fraction 5 by Reverse Phase HPLC
Essentials in HPLC '88 Poster Presentation Isolation of Thymosin B4 from Thymosin Fraction 5 by Reverse Phase HPLC M. Badamchian, M.P. Strickler, M.J. Stone, A.L. Goldstein for Waters.bioresearchThe absolute,
SYNOPSIS STUDIES ON THE PREPARATION AND CHARACTERISATION OF PROTEIN HYDROLYSATES FROM GROUNDNUT AND SOYBEAN ISOLATES
1 SYNOPSIS STUDIES ON THE PREPARATION AND CHARACTERISATION OF PROTEIN HYDROLYSATES FROM GROUNDNUT AND SOYBEAN ISOLATES Proteins are important in food processing and food product development, as they are
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
SC-L-H shared(37) Specific (1)
A. Brain (total 2) Tissue-specific (2) Brain-heart shared (8) Specific (2) CNS-heart shared(68) Specific () Heart (total 4) Tissue-specific () B-L-H shared (37) specific () B. Brain (total 2) Tissue-specific
The chemistry of life
The chemistry of life All living organisms are comprised of organic molecules. Organic molecules contain CARBON and HYDROGEN which is not true of inorganic molecules. Carbon is central to life on Earth
Introduction to Proteomics 1.0
Introduction to Proteomics 1.0 CMSP Workshop Pratik Jagtap Managing Director, CMSP Objectives Why are we here? For participants: Learn basics of MS-based proteomics Learn what s necessary for success using
Extracellular Vesicle RNA isolation Kits
Extracellular Vesicle RNA isolation Kits Summary Section 4 Introduction 42 Exo-TotalRNA and TumorExo-TotalRNA isolation kits 43 Extracellular Vesicle RNA extraction kits Ordering information Products can
2 3 Carbon Compounds Slide 1 of 37
1 of 37 The Chemistry of Carbon The Chemistry of Carbon Organic chemistry is the study of all compounds that contain bonds between carbon atoms. Carbon atoms have four valence electrons that can join with
Santosh Patnaik, MD, PhD! Assistant Member! Department of Thoracic Surgery! Roswell Park Cancer Institute!
Santosh Patnaik, MD, PhD Assistant Member Department of Thoracic Surgery Roswell Park Cancer Institute MicroRNA biology, techniques and applications History Biogenesis Nomenclature Tissue specificity Mechanisms
Interaktionen von RNAs und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig May 5, 2017 RNA-protein binding vs. DNA-protein binding Is binding of proteins to RNA the same as binding of proteins to DNA? Will the same rules
CONSIDERATIONS IN PROTEIN INGREDIENT USE: THE IMPACT OF PROCESSING AND MOLECULAR INTERACTIONS
CONSIDERATIONS IN PROTEIN INGREDIENT USE: THE IMPACT OF PROCESSING AND MOLECULAR INTERACTIONS Baraem (Pam) Ismail Associate Professor Department of Food Science and Nutrition University of Minnesota May
Tunable Hydrophobicity in DNA Micelles Anaya, Milena; Kwak, Minseok; Musser, Andrew J.; Muellen, Klaus; Herrmann, Andreas; Müllen, Klaus
University of Groningen Tunable Hydrophobicity in DNA Micelles Anaya, Milena; Kwak, Minseok; Musser, Andrew J.; Muellen, Klaus; Herrmann, Andreas; Müllen, Klaus Published in: Chemistry DOI: 10.1002/chem.201001816
Benchmark study: Exiqon mircury LNA microrna arrays vs. Supplier A s DNA based capture probes. Includes comparison of:
Benchmark study: Exiqon mircury LNA microrna arrays vs. Supplier A s DNA based capture probes Includes comparison of: I. II. III. Signal levels Relative quantification False differences For complete experimental
IAM Chromatography. Introduction
IAM Chromatography IAM Drug Discovery Columns Introduction References: 1. Regis 1998-99 Chromatography Catalog A simple, rapid method to predict drug transport across biological barriers has been a long
Laboratory Testing for West Nile Virus Infections Testing Human & Non-Human Tissues
Laboratory Testing for West Nile Virus Infections Testing Human & Non-Human Tissues Robert S Lanciotti Chief; Diagnostic & Reference Laboratory Arbovirus Diseases Branch Fort Collins, Colorado Presentation
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
2.3 Carbon Compounds 12/19/2011 BIOLOGY MRS. MICHAELSEN. Lesson Overview. Carbon Compounds The Chemistry of Carbon. Lesson Overview.
2.3 The Chemistry of Carbon A. Carbon atoms have four valence electrons 1. Form strong covalent bonds with many other elements: H, O, P, S, N. 2. Living organisms are made up of carbon and these other
MagCapture Exosome Isolation Kit PS Q&A
MagCapture Exosome Isolation Kit PS Q&A Specifications and performance P.1 Comparison of the conventional method P.2 Operation methods and composition P.4 Amount of starting sample P.5 Analysis after exosomes
Chapter 3. Protein Structure and Function
Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER
Water: 1. The bond between water molecules is a(n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond
Biology 12 - Biochemistry Practice Exam KEY Water: 1. The bond between water molecules is a(n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond 2. The water properties: good solvent,
Carbon Compounds. Lesson Overview. Lesson Overview. 2.3 Carbon Compounds
Lesson Overview Carbon Compounds Lesson Overview 2.3 THINK ABOUT IT In the early 1800s, many chemists called the compounds created by organisms organic, believing they were fundamentally different from
Details of Organic Chem! Date. Carbon & The Molecular Diversity of Life & The Structure & Function of Macromolecules
Details of Organic Chem! Date Carbon & The Molecular Diversity of Life & The Structure & Function of Macromolecules Functional Groups, I Attachments that replace one or more of the hydrogens bonded to
Pharmazeutische Biologie und Phytochemie. Glycoconjugates from plants as antiadhesive Compounds against Helicobacter pylori
WESTFÄLISCHE WILHELMS-UNIVERSITÄT MÜNSTER Pharmazeutische Biologie und Phytochemie Glycoconjugates from plants as antiadhesive Compounds against Helicobacter pylori Ribes nigrum L. Abelmoschus esculentus
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
Types of macromolecules. Proteins. Amino acids 9/15/2010. Carbohydrates. Lipids. Proteins. Nucleic acids
Types of macromolecules Carbohydrates Lipids Proteins Nucleic acids Proteins Chief building blocks of life 1000s of proteins Lots of different functions, but all built the same way & from the same raw
Bio 12 Chapter 2 Test Review
Bio 12 Chapter 2 Test Review 1.Know the difference between ionic and covalent bonds In order to complete outer shells in electrons bonds can be Ionic; one atom donates or receives electrons Covalent; atoms
Lesson Overview. Carbon Compounds. Lesson Overview. 2.3 Carbon Compounds
Lesson Overview 2.3 The Chemistry of Carbon What elements does carbon bond with to make up life s molecules? Carbon can bond with many elements, including Hydrogen, Oxygen, Phosphorus, Sulfur, and Nitrogen
Biology 12 - Biochemistry Practice Exam
Biology 12 - Biochemistry Practice Exam Name: Water: 1. The bond between water molecules is a (n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond 2. The water properties: good solvent,
Chapter PURIFICATION OF ALKALINE PROTEASES
Chapter PURIFICATION OF ALKALINE PROTEASES E /xtracellular alkaline proteases produced by Bacillus sp. K 25 and bacillus pumilus K 242, were purified and the homogeneity was examined by electrophoresis.
Summary and Conclusion
Parkinson s disease is a progressive disorder of the nervous system primarily affecting the motor system of the body and is also known as Shaking palsy (Bendick, 2002). Parkinson's disease is the second
Study Guide Chapter 5 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question
Study Guide Chapter 5 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question 1) What type of covalent bond between amino acid side chains (R groups) functions
Many of the compounds we are concerned with in biology are carbon-based compounds The study of carbon-based compounds is called organic chemistry
1 2 3 4 Bio 1101 Lecture 3 Chapter 3: Molecules of Life Organic Molecules Many of the compounds we are concerned with in biology are carbon-based compounds The study of carbon-based compounds is called
Lesson Overview. Carbon Compounds. Lesson Overview. 2.3 Carbon Compounds
Lesson Overview 2.3 THINK ABOUT IT In the early 1800s, many chemists called the compounds created by organisms organic, believing they were fundamentally different from compounds in nonliving things. We
BIOLOGY 111. CHAPTER 2: The Chemistry of Life Biological Molecules
BIOLOGY 111 CHAPTER 2: The Chemistry of Life Biological Molecules The Chemistry of Life : Learning Outcomes 2.4) Describe the significance of carbon in forming the basis of the four classes of biological
Exploring Energy and Fitness Landscapes of Proteins
Exploring Energy and Fitness Landscapes of Proteins! Computer Simulations in Chemistry and Biophysics! Protein-Ligand Binding: structure based drug design! HIV Family and Kinase Family Protein Targets!
Lab Tuesday: Virus Diseases
Lab Tuesday: Virus Diseases Quiz for Bacterial Pathogens lab (pp 67-73) and Biocontrol of Crown Gall (p. 113-117), Observation of Viral Movement in Plants (p. 119), and Intro section for Viruses (pp. 75-77).
Materials and Methods , The two-hybrid principle.
The enzymatic activity of an unknown protein which cleaves the phosphodiester bond between the tyrosine residue of a viral protein and the 5 terminus of the picornavirus RNA Introduction Every day there
(A) Hydrophobic (B) Hydrophilic (C) Both A & B (D) Amphipathic (E) All of the answers above are correct.
Biochemistry - Problem Drill 03: Introduction to Biochemistry No. 1 of 10 1. Based on their affinity for water, molecules are classified into? (A) Hydrophobic (B) Hydrophilic (C) Both A & B (D) Amphipathic
Development of a Cell-penetrating Peptide that Exhibits Responsive. Changes in its Secondary Structure in the Cellular Environment
Development of a Cell-penetrating Peptide that Exhibits Responsive Changes in its Secondary Structure in the Cellular Environment iroko Yamashita, 1 Takuma Kato, 2 Makoto ba, 2 Takashi Misawa, 1 Takayuki
Biology: Life on Earth Chapter 3 Molecules of life
Biology: Life on Earth Chapter 3 Molecules of life Chapter 3 Outline 3.1 Why Is Carbon So Important in Biological Molecules? p. 38 3.2 How Are Organic Molecules Synthesized? p. 38 3.3 What Are Carbohydrates?
Biological Chemistry. Is biochemistry fun? - Find it out!
Biological Chemistry Is biochemistry fun? - Find it out! 1. Key concepts Outline 2. Condensation and Hydrolysis Reactions 3. Carbohydrates 4. Lipids 5. Proteins 6. Nucleic Acids Key Concepts: 1. Organic
Organic Compounds. (Carbon Compounds) Carbohydrates Lipids Proteins Nucleic Acids
Organic Compounds (Carbon Compounds) Carbohydrates Lipids Proteins Nucleic Acids Carbon s Bonding Behavior Outer shell of carbon has 4 electrons; can hold 8 Each carbon atom can form covalent bonds with
For purification of viral DNA and RNA from a wide range of sample materials
QIAamp virus kits For purification of viral DNA and RNA from a wide range of sample materials Automatable on QIAGEN s proven QIAamp Kits set the standard for purification of viral DNA and RNA. QIAamp virus
Chapter 5 THE STRUCTURE AND FUNCTION OF LARGE BIOLOGICAL MOLECULES
Chapter 5 THE STRUCTURE AND FUNCTION OF LARGE BIOLOGICAL MOLECULES You Must Know The role of dehydration synthesis in the formation of organic compounds and hydrolysis in the digestion of organic compounds.
Exosome DNA Extraction Kits
Exosome DNA Extraction Kits Summary Section 5 Introduction 40 EXO-DNAc 41 EXO-DNA 43 Introduction Genomic DNA Extractiom Kits Ordering informations Products can be purchased directly in our on-line shop:
Macromolecules. The four groups of biomolecules or macromolecules found in living things which are essential to life are: 1. PROTEINS 1.
Macromolecules The four groups of biomolecules or macromolecules found in living things which are essential to life are: 1. PROTEINS 1. CARBOHYDRATES 1. LIPIDS 1. NUCLEIC ACIDS Carbon Compounds All compounds
Lab Tuesday: Virus Diseases
Lab Tuesday: Virus Diseases Quiz for Bacterial Pathogens lab (pp 69-75) and Biocontrol of Crown Gall (p. 115-119), Observation of Viral Movement in Plants (p. 121), and Intro section for Viruses (pp. 77-79).
Biology Chapter 5. Biological macromolecules
Biology Chapter 5 Biological macromolecules Small molecules (like water and NaCl) have certain properties that arise from the bonds which hold atoms together in a particular arrangement. Many of the molecules
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Purification and biochemical properties of SDS-stable low molecular weight alkaline serine protease from Citrullus Colocynthis Muhammad Bashir Khan, 1,3 Hidayatullah khan, 2 Muhammad
ncounter TM Analysis System
ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance
Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..
INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
INORGANIC COMPOUNDS. Ex: Water. Compounds that may be essential to life, but are not necessarily found in living things.
INORGANIC COMPOUNDS Compounds that may be essential to life, but are not necessarily found in living things. Ex: Water Other example: CO2 - ¾ of earth - 90% of living tissue WATER Water is a POLAR compound.
Chapter 3 The Molecules of Life
Chapter 3 The Molecules of Life State Standards Standard 1.h. Standard 5.a. Standard 4.e. Organic Molecules A cell is mostly water. The rest of the cell consists mostly of carbon based molecules organic
Biology Kevin Dees. Biology Chapter 5. Biological macromolecules
Biology Chapter 5 Biological macromolecules Small molecules (like water and NaCl) have certain properties that arise from the bonds which hold atoms together in a particular arrangement. Many of the molecules
Proteins. Amino acids, structure and function. The Nobel Prize in Chemistry 2012 Robert J. Lefkowitz Brian K. Kobilka
Proteins Amino acids, structure and function The Nobel Prize in Chemistry 2012 Robert J. Lefkowitz Brian K. Kobilka O O HO N N HN OH Ser65-Tyr66-Gly67 The Nobel prize in chemistry 2008 Osamu Shimomura,
CLASS SET. Modeling Life s Important Compounds. AP Biology
Modeling Life s Important Compounds AP Biology CLASS SET OBJECTIVES: Upon completion of this activity, you will be able to: Explain the connection between the sequence and the subcomponents of a biological
Aeris. Precision Engineered Core- Shell Particles for Ultra-High Resolution BioSeparations. Aeris PEPTIDE. Aeris WIDEPORE
Aeris Precision Engineered Core- Shell Particles for Ultra-High Resolution BioSeparations Aeris is a specialized line of reversed phase core-shell UHPLC columns, built exclusively for the ultra-high performance
ABIOpure TM Viral (version 2.0)
ABIOpure TM Viral (version 2.0) DNA/RNA Extraction Handbook Cat No: M561VT50 FOR RESEARCH USE ONLY Table of Contents Contents Page Kit Components 3 Precautions 3 Stability & Storage 4 General Description
Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
130327SCH4U_biochem April 09, 2013
Option B: B1.1 ENERGY Human Biochemistry If more energy is taken in from food than is used up, weight gain will follow. Similarly if more energy is used than we supply our body with, weight loss will occur.
Supplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
AS Level Paper 1 and 2. A2 Level Paper 1 and 3 - Topics 1-4
Section 3.1: Biological Molecules 3.1.1 Monomers and Polymers 3.1.2 Carbohydrates 3.1.3 Lipids 3.1.4.1 Proteins 3.1.4.2 Enzymes 3.1.5.1 Nucleic acid structure 3.1.5.2 DNA Replication 3.1.6 ATP 3.1.7 Water
Principles of Biomedical Sciences Semester 1 Review
Unit 1 The Mystery Lesson 1.1: Investigating the Scene 1. Why is it important to be careful and methodical when investigating a crime scene? 2. What are the main parts in the experimental design process?
2 3 Carbon Compounds (Macromolecules)
2 3 Carbon Compounds (Macromolecules) Slide 1 of 37 Organic Chemistry Organic chemistry is the study of all compounds that contain bonds between carbon atoms. Slide 2 of 37 Carbon Living organisms are
Forensics Final Review. 1. Fill in the following table about search methods. Search Method Picture When it is Used Strip or Line Search
Name: Forensics Final Review Unit 1-Scientific Method, Observation, and Eyewitness Reporting 1. Fill in the following table about search methods. Search Method Picture When it is Used Strip or Line Search
Honors Biology Chapter 3: Macromolecules PPT Notes
Honors Biology Chapter 3: Macromolecules PPT Notes 3.1 I can explain why carbon is unparalleled in its ability to form large, diverse molecules. Diverse molecules found in cells are composed of carbon
Circular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
the properties of carbon
Carbon Compounds Learning Objectives Describe the unique qualities of carbon. Describe the structures and functions of each of the four groups of macromolecules. For each macromolecule you will need to
Toxicity analysis of PbSQDs using nano-sized vesicles (exosome) secretedfrom HEK293 cells
Toxicity analysis of PbSQDs using nano-sized vesicles (exosome) secretedfrom HEK293 cells EunjooKim, Ph. D. Daegu GyeongbukInstitute of Science and Technology (DGIST), Republic of Korea Quantumdots RUSNANO
Biochemical Techniques 06 Salt Fractionation of Proteins. Biochemistry
. 1 Description of Module Subject Name Paper Name 12 Module Name/Title 2 1. Objectives Understanding the concept of protein fractionation Understanding protein fractionation with salt 2. Concept Map 3.
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
Digestion and Human Health
Digestion and Human Health The Molecules of Living Systems There are three main fluid components in your body Cytoplasm in your cells Fluid between your cells Fluid in your blood The also contain many
Oligonucleotide Testing Market Analysis, Size, Share, Growth, Industry Trends and Forecast to 2024 Hexa Research
Oligonucleotide Testing Market Analysis, Size, Share, Growth, Industry Trends and Forecast to 2024 Hexa Research Oligonucleotide Testing Market is expected to witness a significant growth, pertaining to
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
OxisResearch A Division of OXIS Health Products, Inc.
OxisResearch A Division of OXIS Health Products, Inc. BIOXYTECH pl GPx Enzyme Immunoassay Assay for Human Plasma Glutathione Peroxidase For Research Use Only. Not For Use In Diagnostic Procedures. Catalog
Student Number: THE UNIVERSITY OF MANITOBA April 11, 2011, 1:00 PM - 4:00 PM Page 1 (of 3)
Name: Student Number: THE UNIVERSITY OF MANITOBA April 11, 2011, 1:00 PM - 4:00 PM Page 1 (of 3) Biochemistry II Laboratory Section Examiners: Drs. J. Galka 1. Answer ALL questions in the space provided.
Macromolecules. 3. There are several levels of protein structure, the most complex of which is A) primary B) secondary C) tertiary D) quaternary
Macromolecules 1. If you remove all of the functional groups from an organic molecule so that it has only carbon and hydrogen atoms, the molecule become a molecule. A) carbohydrate B) carbonyl C) carboxyl
DNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription