Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
|
|
- Timothy Gardner
- 6 years ago
- Views:
Transcription
1 Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG 5'-GATGGTCTTGGCATAGTCAT ACOX1 5'-CAAGACCCAAGAGTTCATT 5'-TTCAGGTAGCCATTATCCA AKT2 5'-GAATGCCAGCTGATGAAGACTGA 5'-CTACATGGAAGGTCCTCTCGATGA ChREBP 5'-AAAGGCCTCAAGTTGCTATG 5'-AGACAACAGCCTCAGGTTTC CPT-1a 5'-GGATGGACACTGTAAAGGAGACA 5'-CACTGCTTAGGGATGTGTCTATGA Cyclophilin A 5' AAGGTGAAAGAAGGCATGAGC 5'-AGTTGTCCACAGTCGGAAATG DGAT1 5'-GTGTGTGGTGATGCTGATCC 5'-GATGCAATAATCACGCATGG DGAT2 5'-AGGCCCTATTTGGCTACGTT 5'-GATGCCTCCAGACATCAGGT ELOVL6 5'-TGCCATGTTCATCACCTTGT 5'-TGCTGCATCCAGTTGAAGAC FAS 5'-CCGAGTCAGAGAACCTACAG 5'-CTTCCATCTCCTGTCATCAT G6Pase 5'-ATTCCGGTGTTTGAACGTCAT 5'-CCACAGCAATGCCTGACAAGA GK 5'-GGACTTCTCCGAGATGCTATCAAGA 5'-GCGGTCTTCATAGTAGCAGGAGATC GPAT 5'-CACACGAGCAGGAAAGATGA 5'-GGACTGCATAGATGCTGCAA IR 5'-CTCTGTCCGCATCGAGAAGA 5'-CAATGTAGTTGTCCTCCACAGAATC IRS1 5'-GATAGCGAGGCTGAGCAAGA 5'-CCTGCCAGACCTCCTTGAA LCAD 5'-GCATCAACATCGCAGAGAAA 5'-ACGCTTGCTCTTCCCAAGTA LXR-α 5'-GCAGGACCAGCTCCAAGTAG 5'-GGCTCACCAGCTTCATTAGC LXR-β 5'-ATTAAGGAAGAGGGGCAGGA 5'-TGACCACGATGTAGGCAGAG MCAD 5'-GCTAGTGGAGCACCAAGGAG 5'-CCAGGCTGCTCTCTGGTAAC PC 5'-AGGTGGCCAAAGAGAATGGTATG 5'-CAGCAGCATGTTTGGCAAGTAGT PEPCK 5'-GTGTCATCCGCAAGCTGAAGA 5'-GGCACTGTGTCTCTCTGCTCTTG PGC-1α 5'-CAGCCTCTTTGCCCAGATCTT 5'-CTCAAATATGTTCGCAGGCTCA PGC-1β 5'-AGGTGTTCGGTGAGATTGTA 5'-CCAGATGAGGGAAGGGAC PPARγ 5'-TGACCCAATGGTTGCTGATTACA 5'-CAATGGCCATGAGGGAGTTAGA SCD1 5'-GCGATACACTCTGGTGCTCA 5'-CCCAGGGAAACCAGGATATT SREBP2 5'-CCGCTCTCGAATCCTCTTAT 5'-CAGCACCTGACTCCAGTGAC
2 ACC1, acetyl-coa carboxylase 1 ACLY, ATP citrate lyase ACOX1, acyl-coa oxidase 1 CPT1a, carnitine palmitoyltransferase 1a ChREBP, carbohydrate responsive element binding protein DGAT1 (2), diacylglycerol acyltransferase 1 (2) ELOVL6, ELOVL fatty acid elongase 6 FAS, fatty acid synthase G6Pase, glucose 6-phosphatase GK, glucokinase GPAT, glycerol phosphate acyltransferase IR, insulin receptor IRS1, insulin receptor substrate 1 LCAD, long-chain acyl-coa dehydrogenase LXR-α β, liver X receptor-α (β) MCAD, medium-chain acyl-coa dehydrogenase PC, pyruvate carboxylase PEPCK, phosphoenolpyruvate carboxykinase PGC-1α, (1β) peroxisome proliferator activated receptor gamma coactivator 1α (1β) PGK, phosphoglycerine kinase PPARγ, peroxisome proliferator-activated receptor γ SCD1, stearoyl-coa desaturase 1 SREBP-1c, sterol regulatory element-binding protein 1c SREBP2, sterol regulatory element-binding protein 2
3 Supplemental Table 2 Primers used for qrt-pcr experiments to quantitate the hepatic expression of G q - coupled receptors in ob/ob mice and WT littermates GENE SYMBOL Primer sequences Amplicon size (bp) Adra1b Forward: 5 CGGACGCCAACCAACTACTT 157 (α 1b -adrenergic Reverse: 5 AACACAGGACATCAACCGCTG Agtr1a Forward: 5 ATGCTTGGGGCAACTTCACTA 224 (AT 1a angiotensin II Reverse: 5 GCAGCAAGAGAAGGGCTTCA Avpr1a Forward: 5 GCTGGCGGTGATTTTCGTG 231 (V 1a vasopressin Reverse: 5 GCAAACACCTGCAAGTGCT Avpr1b Forward: 5 GAGCCTTCTTGGACTGCTACC 156 (V 1b vasopressin Reverse: 5 TACAGCCAGGTTGCCTCCT Chrm3 Forward: 5 CCTCGCCTTTGTTTCCCAAC 129 (M 3 muscarinic acetylcholine Reverse: 5 TTGAGGAGAAATTCCCAGAGGT Edg5 (S1p2) Forward: 5 ATGGGCGGCTTATACTCAGAG 137 (S1P 2 lysophospholipid Reverse: 5 GCGCAGCACAAGATGATGAT F2r Forward: 5 TGAACCCCCGCTCATTCTTTC 105 ((PAR 1 thrombin Reverse: 5 CCAGCAGGACGCTTTCATTTTT GPR91 (Succinate receptor 1) Forward: 5 TCTTGTGAGAATTGGTTGGCAA Reverse: 5 CATCTCCATAGGTCCCCTTATCA 250
4 Supplemental Table 3 List of GPCRs (or potential GPCRs) expressed in mouse hepatocytes Hepatocytes were isolated from adult C57BL/6 WT mice (3-month old males) and GPCR mrna expression levels were quantitated by TaqMan real-time qrt-pcr analysis. GPCRs that are able to activate G proteins of the G q family are highlighted in bold. For experimental details, see Research Design and Methods. Only genes with C t values <31 are listed. Data are given as means ± SEM of three independent experiments. GENE SYMBOL FULL NAME C t Edg1 (S1p1) S1P 1 lysophospholipid receptor 25.5 ± 0.4 Gcgr Glucagon receptor 25.7 ± 0.2 GPR91 (Sucnr1) GPR91 (succinate receptor type 1) 26.8 ± 0.5 Agtr1a AT 1a angiotensin II receptor 26.9 ± 0.1 Avpr1b V 1b vasopressin receptor 27.1 ± 0.9 Gprc5c Orphan receptor 27.5 ± 0.5 Gpr146 Orphan receptor 27.5 ± 0.5 Tm7sf3 Orphan receptor 27.6 ± 0.4 Adra1b α 1b -adrenergic receptor 27.6 ± 0.5 P2ry5 Orphan receptor (novel LPA receptor subtype) 28.1 ± 0.4 Lgr4 Orphan receptor 28.6 ± 0.3 Gabbr2 GABA B2 receptor 29 ± 0.1 F2r PAR 1 thrombin receptor 29.2 ± 0.8 Avpr1a V 1a vasopressin receptor 29.2 ± 0.7 Gpr137 Orphan receptor 29.2 ± 0.4 Gpr125 Orphan receptor 29.5 ± 0.4
5 Fzd7 Frizzled ± 0.2 Gpr108 Orphan receptor 30 ± 0.6 GPR182 Orphan receptor 30.1 ± 0.3 Edg5 (S1p2) S1P 2 lysophospholipid receptor 30.6 ± 0.9 Mrgpra7 Mas-related GPCR member A ± 0.9 Fzd5 Frizzled ± 0.2 Chrm3 M 3 muscarinic acetylcholine receptor 30.9 ± 0.4
6 Supplemental Figure 1. (A) Body weight, (B) blood glucose, and (C) serum insulin levels of Hep-Rq mice and their WT littermates. Data are given as means ± SEM (n=6 or 7 per group; freely fed 8-week-old males).
7 Supplemental Figure 2. Effect of CNO treatment of WT mice on liver gene expression levels. WT mice (freely fed 3-month-old males) received two i.p. injections of CNO (10 mg/kg) or saline that were given 2 hr apart. Hepatic gene expression data were obtained by real-time qrt-pcr, as described under Materials and Methods. Gene expression data were normalized relative to the expression of cyclophilin A RNA (internal control). Data are expressed as fold change in gene expression in CNO-treated versus saline-treated WT mice. The data shown are means ± SEM (n = 5 per group). Full gene names are given in Supplemental Table 1.
8 Supplemental Figure 3. V 1b vasopressin receptor RNA expression levels are unchanged in ob/ob islets as compared to lean littermates. Total RNA was prepared from pancreatic islets of ob/ob mice and lean littermates (mouse age: ~3 months). Islet gene expression data were obtained by real-time qrt-pcr, as described under Materials and Methods for hepatic gene expression. Data are expressed as means ± SEM of three independent experiments each performed in duplicate or triplicate.
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationAN ABSTRACT OF THE DISSERTATION OF. Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012.
AN ABSTRACT OF THE DISSERTATION OF Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012. Title: Polyunsaturated Fatty Acid Synthesis and Type 2 Diabetes Complications Abstract
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationHepatic steatosis, the excessive accumulation of
STEATOHEPATITIS/METABOLIC LIVER DISEASE Abrogation of Hepatic ATP-Citrate Lyase Protects Against Fatty Liver and Ameliorates Hyperglycemia in Leptin Receptor-Deficient Mice Qiong Wang, 1 * Lei Jiang, 1
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationEXPRESSION OF FATTY ACID OXIDATION-RELATED GENES IN Acsl4 L -/- PRIMARY HEPATOCYTES. Dennis Lin
EXPRESSION OF FATTY ACID OXIDATION-RELATED GENES IN Acsl4 L -/- PRIMARY HEPATOCYTES Dennis Lin Senior Honors Thesis Department of Nutrition University of North Carolina at Chapel Hill April 2018 Approved
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationMetabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
More informationBy: Dr Hadi Mozafari 1
By: Dr Hadi Mozafari 1 Gluconeogenesis is the process of converting noncarbohydrate precursors to glucose or glycogen. The major substrates are the glucogenic amino acids, and lactate, glycerol, and propionate.
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationMouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
More informationFatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
More informationMolecular mechanisms involved in hepatic steatosis and insulin resistance
MINI REVIEW Molecular mechanisms involved in hepatic steatosis and insulin resistance Takashi Matsuzaka, Hitoshi Shimano* ABSTRACT Increased hepatic lipid content is associated with hepatic as well as
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationSupplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F
Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A Expression of representative subunits of the mitochondrial respiratory chain was analyzed by real time
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationnumber Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
More informationRegulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity
Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity Yun Wang,*,1 Daniela Botolin,*,1 Jinghua Xu,,1 Barbara Christian,* Ernestine Mitchell,* Bolleddula Jayaprakasam,
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationMultiple choice: Circle the best answer on this exam. There are 12 multiple choice questions, each question is worth 3 points.
CHEM 4420 Exam 4 Spring 2015 Dr. Stone Page 1 of 6 Name Use complete sentences when requested. There are 120 possible points on this exam. Therefore there are 20 bonus points. Multiple choice: Circle the
More informationACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
More informationThe Effect of High-Fat Diet and Exercise on Non-Alcoholic Fatty Liver Disease and Glycemic Control. Abinas Uthayakumar
The Effect of High-Fat Diet and Exercise on Non-Alcoholic Fatty Liver Disease and Glycemic Control Abinas Uthayakumar A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENTS OF THE
More informationLeen Alsahele. Razan Al-zoubi ... Faisal
25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationglucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
More information0.40. Biochemistry of Carbohydrates
0.40 Biochemistry of Carbohydrates Biochemistry of Carbohydrates ATP ADP Glycolysis The Breakdown of Glucose Primary Energy Source of Cells Central Metabolic Pathway All Reactions Occur in Cytoplasm Two
More informationCARBOHYDRATE METABOLISM 1
CARBOHYDRATE METABOLISM 1 web 2017 József Mandl Strategy of metabolism 1 Strategy of metabolism to extract energy ( hydrogen ) from the environment to store the energy excess to store hydrogen CH 3 O 2
More informationSupplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination
Int. J. Mol. Sci. 2016, 17, 1139; doi:.3390/ijms17071139 S1 of S5 Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination Zhaoqun Yao, Fang
More informationSUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.!
SUPPLEMENTARY,INFORMATIONS,,,, mtorc,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD, SébastienM.Labbé,,MathildeMouchiroud,,AlexandreCaron,,BlandineSecco,, Elizaveta
More informationMoh Tarek. Razi Kittaneh. Jaqen H ghar
14 Moh Tarek Razi Kittaneh Jaqen H ghar Naif Karadsheh Gluconeogenesis is making glucose from non-carbohydrates precursors. Although Gluconeogenesis looks like Glycolysis in many steps, it is not the simple
More informationAhmad Ulnar. Faisal Nimri ... Dr.Faisal
24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of
More informationANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES. Carbohydrate Metabolism
ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES I. Glycolysis A. Pathway Regulation of glycolysis Hexokinase: Activated by glucose. Inhibited by G6P. 6-Phosphofructokinase: Inhibited by ATP, especially
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
More informationDr. Mohnen s notes on GLUCONEOGENESIS
Dr. Mohnen s notes on GLUCONEOGENESIS Note: Even though we did not get through all of these slides during lecture, I advise you to look them all through because they will be helpful to you as you learn
More informationDietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis
Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,100 116,000 120M Open access books available International authors and editors Downloads Our
More informationIntegration of Metabolism
Integration of Metabolism Metabolism is a continuous process. Thousands of reactions occur simultaneously in order to maintain homeostasis. It ensures a supply of fuel, to tissues at all times, in fed
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationChapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002
Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse
More information(de novo synthesis of glucose)
Gluconeogenesis (de novo synthesis of glucose) Gluconeogenesis Gluconeogenesis is the biosynthesis of new glucose. The main purpose of gluconeogenesis is to maintain the constant blood Glc concentration.
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated
More informationBiochemistry Sheet 27 Fatty Acid Synthesis Dr. Faisal Khatib
Page1 بسم رلاهللا On Thursday, we discussed the synthesis of fatty acids and its regulation. We also went on to talk about the synthesis of Triacylglycerol (TAG). Last time, we started talking about the
More informationBiosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM
Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives
More informationMetformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state
Related Commentary, page 2267 Research article Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Marc Foretz, 1,2 Sophie Hébrard,
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationINTEGRATION OF METABOLISM
SIBC511- INTEGRATION OF METABOLISM Assistant Professor Dr. Chatchawan Srisawat INTEGRATION OF METABOLISM INTEGRATION OF METABOLISM Dietary intake Fed state Fasting state The metabolism of carbohydrate,
More informationThe Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress
Wayne State University Wayne State University Dissertations 1-1-2015 The Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress Roberto Mendez Wayne State University, Follow this and additional
More informationModifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden
Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential
More informationThe Effect of Dietary Fatty Acid
The Effect of Dietary Fatty Acid Composition on Skeletal Muscle and Hepatic Fatty Acid and Glucose Metabolism in Male and Female Mice Lisa Kate Philp B.Sc. (Biomedical Science), B.Sc. (Hons) Discipline
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More informationSynthesis of Fatty Acids and Triacylglycerol
Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:
More informationSalt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin
More informationMetabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients
Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationFinal Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours
Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal
More informationEnergy storage in cells
Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen
More informationSupplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
More informationMetabolism Gluconeogenesis/Citric Acid Cycle
Metabolism Gluconeogenesis/Citric Acid Cycle BIOB111 CHEMISTRY & BIOCHEMISTRY Session 21 Session Plan Gluconeogenesis Cori Cycle Common Metabolic Pathway The Citric Acid Cycle Stoker 2014, p859 Gluconeogenesis
More informationCornstarch
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the
More informationThe SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis
Review Article Endocrinol Metab 2017;32:6-10 https://doi.org/10.3803/enm.2017.32.1.6 pissn 2093-596X eissn 2093-5978 The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis Young-Ah Moon Department of
More informationSteven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of.
Reduced SCD1 activity decreases fatty acid re-esterification and alters markers of glyceroneogenesis and lipolysis in murine white adipose tissue and 3T3-L1 adipocytes by Steven Michael Dragos A Thesis
More informationTHE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals
Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle
More informationHepatic insulin signaling regulates VLDL secretion and atherogenesis in mice
Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han,, Domenico Accili, Alan R. Tall J Clin Invest. 2009;119(4):1029-1041. https://doi.org/10.1172/jci36523. Research
More informationPoints 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle:
BCH 4054 February 22, 2002 HOUR TEST 2 NAME_ Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle: CO 2 + 3ATP + 2NADPH 1/3 glyceraldehyde-3-p + 3ADP + 2NADP + Give the structures
More informationSREBP-1 integrates the actions of thyroid hormone, insulin, camp, and medium-chain fatty acids on ACC transcription in hepatocytes
SREBP-1 integrates the actions of thyroid hormone, insulin, camp, and medium-chain fatty acids on ACC transcription in hepatocytes Yanqiao Zhang, Liya Yin, and F. Bradley Hillgartner 1 Department of Biochemistry
More informationOrganochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism
Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao
More informationIntegration & Hormone Regulation
Integration Branchpoints in metabolism where metabolites can go several directions 1. Glucose 6-phosphate Energy needed (low energy charge): glycolysis Low blood sugar: high [glucagon], low [insulin] glycogen
More informationA Tryptophan Hydroxylase Inhibitor Increases Hepatic FGF21 Production and Decreases Hepatic Gluconeogenesis Independently of Insulin in db/db Mice
A Tryptophan Hydroxylase Inhibitor Increases Hepatic FGF21 Production and Decreases Hepatic Gluconeogenesis Independently of Insulin in db/db Mice Katsunori Nonogaki, Takao Kaji, Mari Murakami ABSTRACT
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationMogat1 deletion does not ameliorate hepatic steatosis in lipodystrophic ( Agpat2 / ) or obese ( ob / ob ) mice
Mogat1 deletion does not ameliorate hepatic steatosis in lipodystrophic ( Agpat2 ) or obese ( ob / ob ) mice Anil K. Agarwal, 1, * Katie Tunison, 2, * Jasbir S. Dalal, 2,3, * Chi-Liang Eric Yen, 4, Robert
More informationRole of BAF60a/BAF60c in chromatin remodeling and hepatic lipid metabolism
Zhang et al. Nutrition & Metabolism (2016) 13:30 DOI 10.1186/s12986-016-0090-1 REVIEW Role of BAF60a/BAF60c in chromatin remodeling and hepatic lipid metabolism Ping Zhang, Lulu Li, Zhengxi Bao and Feiruo
More informationThe endocrine Fibroblast Growth Factor family:
The endocrine Fibroblast Growth Factor family: Possible insulin-sensitizing therapeutics Summary: This thesis focuses on the endocrine members of the Fibroblast Growth Factor (FGF) family. The 23 FGFs,
More informationSupplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance
Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,
More informationGlucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism
Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the
More informationChronic overexpression of PNPLA3 I148M in mouse liver causes hepatic steatosis
Research article Chronic overexpression of PNPLA3 I148M in mouse liver causes hepatic steatosis John Zhong Li, 1 Yongcheng Huang, 1 Ruchan Karaman, 1 Pavlina T. Ivanova, 2 H. Alex Brown, 2 Thomas Roddy,
More informationRegulation of Glucose Metabolism by Intracellular Compounds
Regulation of Metabolism by Intracellular ompounds Hexokinase ( ) -6- H ribose-5- or fructose-6- -6-phosphate () ( ) H -6-phosphate GI GM UD-glucose pyrophosphorylase 1-phosphate UD- hosphorylase synthase
More informationTranscriptomic analysis of hepatic responses to testosterone deficiency in miniature pigs fed a high-cholesterol diet
Cai et al. BMC Genomics (2015) 16:59 DOI 10.1186/s12864-015-1283-0 RESEARCH ARTICLE Open Access Transcriptomic analysis of hepatic responses to testosterone deficiency in miniature pigs fed a high-cholesterol
More informationFigure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More information3. (1) CLA 0% 0.1% 1%CLA C57BL/6 1%CLA 10% 30% 60% C57BL/6 19 CLA CLA 1%CLA 0.1%CLA 2- 1%CLA CLA. SREBP1 mrna SREBP1 ACC SCD1 FAS 60% 1 GLUT4 GLUT4
49 1. ( ) 21 7 7 2. 1 10% CLA 0% 0.1% 1%CLA C57BL/6 19 2 10% 30% 60% 1%CLA C57BL/6 19 1-CLA CLA CLA 0.1% 1%CLA 0.1%CLA 2-1%CLA CLA SREBP1 mrna SREBP1 ACC SCD1 FAS 60% 1 GLUT4 CLA 1% SREBP1 GLUT4 2 db/db
More informationHepatic insulin signaling regulates VLDL secretion and atherogenesis in mice
Research article Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han, Chien-Ping Liang, Marit Westerterp, Takafumi Senokuchi, Carrie L. Welch, Qizhi Wang, Michihiro
More informationWeek 3 The Pancreas: Pancreatic ph buffering:
Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions
More informationPGC-1alpha deficiency causes multi-system energy metabolic derangements: Muscle dysfunction, abnormal weight control and hepatic steatosis
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2005 PGC-1alpha deficiency causes multi-system energy metabolic derangements: Muscle dysfunction, abnormal weight
More information