Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Size: px
Start display at page:

Download "Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies"

Transcription

1 Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG 5'-GATGGTCTTGGCATAGTCAT ACOX1 5'-CAAGACCCAAGAGTTCATT 5'-TTCAGGTAGCCATTATCCA AKT2 5'-GAATGCCAGCTGATGAAGACTGA 5'-CTACATGGAAGGTCCTCTCGATGA ChREBP 5'-AAAGGCCTCAAGTTGCTATG 5'-AGACAACAGCCTCAGGTTTC CPT-1a 5'-GGATGGACACTGTAAAGGAGACA 5'-CACTGCTTAGGGATGTGTCTATGA Cyclophilin A 5' AAGGTGAAAGAAGGCATGAGC 5'-AGTTGTCCACAGTCGGAAATG DGAT1 5'-GTGTGTGGTGATGCTGATCC 5'-GATGCAATAATCACGCATGG DGAT2 5'-AGGCCCTATTTGGCTACGTT 5'-GATGCCTCCAGACATCAGGT ELOVL6 5'-TGCCATGTTCATCACCTTGT 5'-TGCTGCATCCAGTTGAAGAC FAS 5'-CCGAGTCAGAGAACCTACAG 5'-CTTCCATCTCCTGTCATCAT G6Pase 5'-ATTCCGGTGTTTGAACGTCAT 5'-CCACAGCAATGCCTGACAAGA GK 5'-GGACTTCTCCGAGATGCTATCAAGA 5'-GCGGTCTTCATAGTAGCAGGAGATC GPAT 5'-CACACGAGCAGGAAAGATGA 5'-GGACTGCATAGATGCTGCAA IR 5'-CTCTGTCCGCATCGAGAAGA 5'-CAATGTAGTTGTCCTCCACAGAATC IRS1 5'-GATAGCGAGGCTGAGCAAGA 5'-CCTGCCAGACCTCCTTGAA LCAD 5'-GCATCAACATCGCAGAGAAA 5'-ACGCTTGCTCTTCCCAAGTA LXR-α 5'-GCAGGACCAGCTCCAAGTAG 5'-GGCTCACCAGCTTCATTAGC LXR-β 5'-ATTAAGGAAGAGGGGCAGGA 5'-TGACCACGATGTAGGCAGAG MCAD 5'-GCTAGTGGAGCACCAAGGAG 5'-CCAGGCTGCTCTCTGGTAAC PC 5'-AGGTGGCCAAAGAGAATGGTATG 5'-CAGCAGCATGTTTGGCAAGTAGT PEPCK 5'-GTGTCATCCGCAAGCTGAAGA 5'-GGCACTGTGTCTCTCTGCTCTTG PGC-1α 5'-CAGCCTCTTTGCCCAGATCTT 5'-CTCAAATATGTTCGCAGGCTCA PGC-1β 5'-AGGTGTTCGGTGAGATTGTA 5'-CCAGATGAGGGAAGGGAC PPARγ 5'-TGACCCAATGGTTGCTGATTACA 5'-CAATGGCCATGAGGGAGTTAGA SCD1 5'-GCGATACACTCTGGTGCTCA 5'-CCCAGGGAAACCAGGATATT SREBP2 5'-CCGCTCTCGAATCCTCTTAT 5'-CAGCACCTGACTCCAGTGAC

2 ACC1, acetyl-coa carboxylase 1 ACLY, ATP citrate lyase ACOX1, acyl-coa oxidase 1 CPT1a, carnitine palmitoyltransferase 1a ChREBP, carbohydrate responsive element binding protein DGAT1 (2), diacylglycerol acyltransferase 1 (2) ELOVL6, ELOVL fatty acid elongase 6 FAS, fatty acid synthase G6Pase, glucose 6-phosphatase GK, glucokinase GPAT, glycerol phosphate acyltransferase IR, insulin receptor IRS1, insulin receptor substrate 1 LCAD, long-chain acyl-coa dehydrogenase LXR-α β, liver X receptor-α (β) MCAD, medium-chain acyl-coa dehydrogenase PC, pyruvate carboxylase PEPCK, phosphoenolpyruvate carboxykinase PGC-1α, (1β) peroxisome proliferator activated receptor gamma coactivator 1α (1β) PGK, phosphoglycerine kinase PPARγ, peroxisome proliferator-activated receptor γ SCD1, stearoyl-coa desaturase 1 SREBP-1c, sterol regulatory element-binding protein 1c SREBP2, sterol regulatory element-binding protein 2

3 Supplemental Table 2 Primers used for qrt-pcr experiments to quantitate the hepatic expression of G q - coupled receptors in ob/ob mice and WT littermates GENE SYMBOL Primer sequences Amplicon size (bp) Adra1b Forward: 5 CGGACGCCAACCAACTACTT 157 (α 1b -adrenergic Reverse: 5 AACACAGGACATCAACCGCTG Agtr1a Forward: 5 ATGCTTGGGGCAACTTCACTA 224 (AT 1a angiotensin II Reverse: 5 GCAGCAAGAGAAGGGCTTCA Avpr1a Forward: 5 GCTGGCGGTGATTTTCGTG 231 (V 1a vasopressin Reverse: 5 GCAAACACCTGCAAGTGCT Avpr1b Forward: 5 GAGCCTTCTTGGACTGCTACC 156 (V 1b vasopressin Reverse: 5 TACAGCCAGGTTGCCTCCT Chrm3 Forward: 5 CCTCGCCTTTGTTTCCCAAC 129 (M 3 muscarinic acetylcholine Reverse: 5 TTGAGGAGAAATTCCCAGAGGT Edg5 (S1p2) Forward: 5 ATGGGCGGCTTATACTCAGAG 137 (S1P 2 lysophospholipid Reverse: 5 GCGCAGCACAAGATGATGAT F2r Forward: 5 TGAACCCCCGCTCATTCTTTC 105 ((PAR 1 thrombin Reverse: 5 CCAGCAGGACGCTTTCATTTTT GPR91 (Succinate receptor 1) Forward: 5 TCTTGTGAGAATTGGTTGGCAA Reverse: 5 CATCTCCATAGGTCCCCTTATCA 250

4 Supplemental Table 3 List of GPCRs (or potential GPCRs) expressed in mouse hepatocytes Hepatocytes were isolated from adult C57BL/6 WT mice (3-month old males) and GPCR mrna expression levels were quantitated by TaqMan real-time qrt-pcr analysis. GPCRs that are able to activate G proteins of the G q family are highlighted in bold. For experimental details, see Research Design and Methods. Only genes with C t values <31 are listed. Data are given as means ± SEM of three independent experiments. GENE SYMBOL FULL NAME C t Edg1 (S1p1) S1P 1 lysophospholipid receptor 25.5 ± 0.4 Gcgr Glucagon receptor 25.7 ± 0.2 GPR91 (Sucnr1) GPR91 (succinate receptor type 1) 26.8 ± 0.5 Agtr1a AT 1a angiotensin II receptor 26.9 ± 0.1 Avpr1b V 1b vasopressin receptor 27.1 ± 0.9 Gprc5c Orphan receptor 27.5 ± 0.5 Gpr146 Orphan receptor 27.5 ± 0.5 Tm7sf3 Orphan receptor 27.6 ± 0.4 Adra1b α 1b -adrenergic receptor 27.6 ± 0.5 P2ry5 Orphan receptor (novel LPA receptor subtype) 28.1 ± 0.4 Lgr4 Orphan receptor 28.6 ± 0.3 Gabbr2 GABA B2 receptor 29 ± 0.1 F2r PAR 1 thrombin receptor 29.2 ± 0.8 Avpr1a V 1a vasopressin receptor 29.2 ± 0.7 Gpr137 Orphan receptor 29.2 ± 0.4 Gpr125 Orphan receptor 29.5 ± 0.4

5 Fzd7 Frizzled ± 0.2 Gpr108 Orphan receptor 30 ± 0.6 GPR182 Orphan receptor 30.1 ± 0.3 Edg5 (S1p2) S1P 2 lysophospholipid receptor 30.6 ± 0.9 Mrgpra7 Mas-related GPCR member A ± 0.9 Fzd5 Frizzled ± 0.2 Chrm3 M 3 muscarinic acetylcholine receptor 30.9 ± 0.4

6 Supplemental Figure 1. (A) Body weight, (B) blood glucose, and (C) serum insulin levels of Hep-Rq mice and their WT littermates. Data are given as means ± SEM (n=6 or 7 per group; freely fed 8-week-old males).

7 Supplemental Figure 2. Effect of CNO treatment of WT mice on liver gene expression levels. WT mice (freely fed 3-month-old males) received two i.p. injections of CNO (10 mg/kg) or saline that were given 2 hr apart. Hepatic gene expression data were obtained by real-time qrt-pcr, as described under Materials and Methods. Gene expression data were normalized relative to the expression of cyclophilin A RNA (internal control). Data are expressed as fold change in gene expression in CNO-treated versus saline-treated WT mice. The data shown are means ± SEM (n = 5 per group). Full gene names are given in Supplemental Table 1.

8 Supplemental Figure 3. V 1b vasopressin receptor RNA expression levels are unchanged in ob/ob islets as compared to lean littermates. Total RNA was prepared from pancreatic islets of ob/ob mice and lean littermates (mouse age: ~3 months). Islet gene expression data were obtained by real-time qrt-pcr, as described under Materials and Methods for hepatic gene expression. Data are expressed as means ± SEM of three independent experiments each performed in duplicate or triplicate.

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

ANSC/NUTR 618 Lipids & Lipid Metabolism

ANSC/NUTR 618 Lipids & Lipid Metabolism I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

AN ABSTRACT OF THE DISSERTATION OF. Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012.

AN ABSTRACT OF THE DISSERTATION OF. Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012. AN ABSTRACT OF THE DISSERTATION OF Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012. Title: Polyunsaturated Fatty Acid Synthesis and Type 2 Diabetes Complications Abstract

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate

More information

Hepatic steatosis, the excessive accumulation of

Hepatic steatosis, the excessive accumulation of STEATOHEPATITIS/METABOLIC LIVER DISEASE Abrogation of Hepatic ATP-Citrate Lyase Protects Against Fatty Liver and Ameliorates Hyperglycemia in Leptin Receptor-Deficient Mice Qiong Wang, 1 * Lei Jiang, 1

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

EXPRESSION OF FATTY ACID OXIDATION-RELATED GENES IN Acsl4 L -/- PRIMARY HEPATOCYTES. Dennis Lin

EXPRESSION OF FATTY ACID OXIDATION-RELATED GENES IN Acsl4 L -/- PRIMARY HEPATOCYTES. Dennis Lin EXPRESSION OF FATTY ACID OXIDATION-RELATED GENES IN Acsl4 L -/- PRIMARY HEPATOCYTES Dennis Lin Senior Honors Thesis Department of Nutrition University of North Carolina at Chapel Hill April 2018 Approved

More information

Supplementary Figure S1

Supplementary Figure S1 Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao

More information

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013 Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure

More information

By: Dr Hadi Mozafari 1

By: Dr Hadi Mozafari 1 By: Dr Hadi Mozafari 1 Gluconeogenesis is the process of converting noncarbohydrate precursors to glucose or glycogen. The major substrates are the glucogenic amino acids, and lactate, glycerol, and propionate.

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb) Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer

More information

Fatty acids synthesis

Fatty acids synthesis Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view

More information

Molecular mechanisms involved in hepatic steatosis and insulin resistance

Molecular mechanisms involved in hepatic steatosis and insulin resistance MINI REVIEW Molecular mechanisms involved in hepatic steatosis and insulin resistance Takashi Matsuzaka, Hitoshi Shimano* ABSTRACT Increased hepatic lipid content is associated with hepatic as well as

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F

Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A Expression of representative subunits of the mitochondrial respiratory chain was analyzed by real time

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity

Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity Yun Wang,*,1 Daniela Botolin,*,1 Jinghua Xu,,1 Barbara Christian,* Ernestine Mitchell,* Bolleddula Jayaprakasam,

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

Multiple choice: Circle the best answer on this exam. There are 12 multiple choice questions, each question is worth 3 points.

Multiple choice: Circle the best answer on this exam. There are 12 multiple choice questions, each question is worth 3 points. CHEM 4420 Exam 4 Spring 2015 Dr. Stone Page 1 of 6 Name Use complete sentences when requested. There are 120 possible points on this exam. Therefore there are 20 bonus points. Multiple choice: Circle the

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

The Effect of High-Fat Diet and Exercise on Non-Alcoholic Fatty Liver Disease and Glycemic Control. Abinas Uthayakumar

The Effect of High-Fat Diet and Exercise on Non-Alcoholic Fatty Liver Disease and Glycemic Control. Abinas Uthayakumar The Effect of High-Fat Diet and Exercise on Non-Alcoholic Fatty Liver Disease and Glycemic Control Abinas Uthayakumar A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENTS OF THE

More information

Leen Alsahele. Razan Al-zoubi ... Faisal

Leen Alsahele. Razan Al-zoubi ... Faisal 25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase

More information

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

More information

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,

More information

0.40. Biochemistry of Carbohydrates

0.40. Biochemistry of Carbohydrates 0.40 Biochemistry of Carbohydrates Biochemistry of Carbohydrates ATP ADP Glycolysis The Breakdown of Glucose Primary Energy Source of Cells Central Metabolic Pathway All Reactions Occur in Cytoplasm Two

More information

CARBOHYDRATE METABOLISM 1

CARBOHYDRATE METABOLISM 1 CARBOHYDRATE METABOLISM 1 web 2017 József Mandl Strategy of metabolism 1 Strategy of metabolism to extract energy ( hydrogen ) from the environment to store the energy excess to store hydrogen CH 3 O 2

More information

Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination

Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination Int. J. Mol. Sci. 2016, 17, 1139; doi:.3390/ijms17071139 S1 of S5 Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination Zhaoqun Yao, Fang

More information

SUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.!

SUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.! SUPPLEMENTARY,INFORMATIONS,,,, mtorc,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD, SébastienM.Labbé,,MathildeMouchiroud,,AlexandreCaron,,BlandineSecco,, Elizaveta

More information

Moh Tarek. Razi Kittaneh. Jaqen H ghar

Moh Tarek. Razi Kittaneh. Jaqen H ghar 14 Moh Tarek Razi Kittaneh Jaqen H ghar Naif Karadsheh Gluconeogenesis is making glucose from non-carbohydrates precursors. Although Gluconeogenesis looks like Glycolysis in many steps, it is not the simple

More information

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal 24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of

More information

ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES. Carbohydrate Metabolism

ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES. Carbohydrate Metabolism ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES I. Glycolysis A. Pathway Regulation of glycolysis Hexokinase: Activated by glucose. Inhibited by G6P. 6-Phosphofructokinase: Inhibited by ATP, especially

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer

More information

Dr. Mohnen s notes on GLUCONEOGENESIS

Dr. Mohnen s notes on GLUCONEOGENESIS Dr. Mohnen s notes on GLUCONEOGENESIS Note: Even though we did not get through all of these slides during lecture, I advise you to look them all through because they will be helpful to you as you learn

More information

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,100 116,000 120M Open access books available International authors and editors Downloads Our

More information

Integration of Metabolism

Integration of Metabolism Integration of Metabolism Metabolism is a continuous process. Thousands of reactions occur simultaneously in order to maintain homeostasis. It ensures a supply of fuel, to tissues at all times, in fed

More information

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal

More information

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse

More information

(de novo synthesis of glucose)

(de novo synthesis of glucose) Gluconeogenesis (de novo synthesis of glucose) Gluconeogenesis Gluconeogenesis is the biosynthesis of new glucose. The main purpose of gluconeogenesis is to maintain the constant blood Glc concentration.

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

More information

Biochemistry Sheet 27 Fatty Acid Synthesis Dr. Faisal Khatib

Biochemistry Sheet 27 Fatty Acid Synthesis Dr. Faisal Khatib Page1 بسم رلاهللا On Thursday, we discussed the synthesis of fatty acids and its regulation. We also went on to talk about the synthesis of Triacylglycerol (TAG). Last time, we started talking about the

More information

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives

More information

Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state

Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Related Commentary, page 2267 Research article Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Marc Foretz, 1,2 Sophie Hébrard,

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

INTEGRATION OF METABOLISM

INTEGRATION OF METABOLISM SIBC511- INTEGRATION OF METABOLISM Assistant Professor Dr. Chatchawan Srisawat INTEGRATION OF METABOLISM INTEGRATION OF METABOLISM Dietary intake Fed state Fasting state The metabolism of carbohydrate,

More information

The Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress

The Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress Wayne State University Wayne State University Dissertations 1-1-2015 The Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress Roberto Mendez Wayne State University, Follow this and additional

More information

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential

More information

The Effect of Dietary Fatty Acid

The Effect of Dietary Fatty Acid The Effect of Dietary Fatty Acid Composition on Skeletal Muscle and Hepatic Fatty Acid and Glucose Metabolism in Male and Female Mice Lisa Kate Philp B.Sc. (Biomedical Science), B.Sc. (Hons) Discipline

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

islets scored 1 week month months

islets scored 1 week month months Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:

More information

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin

More information

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier

More information

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

The role of apolipoprotein D in lipid metabolism and metabolic syndrome UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated

More information

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal

More information

Energy storage in cells

Energy storage in cells Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen

More information

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

More information

Metabolism Gluconeogenesis/Citric Acid Cycle

Metabolism Gluconeogenesis/Citric Acid Cycle Metabolism Gluconeogenesis/Citric Acid Cycle BIOB111 CHEMISTRY & BIOCHEMISTRY Session 21 Session Plan Gluconeogenesis Cori Cycle Common Metabolic Pathway The Citric Acid Cycle Stoker 2014, p859 Gluconeogenesis

More information

Cornstarch

Cornstarch Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

More information

The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis

The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis Review Article Endocrinol Metab 2017;32:6-10 https://doi.org/10.3803/enm.2017.32.1.6 pissn 2093-596X eissn 2093-5978 The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis Young-Ah Moon Department of

More information

Steven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of.

Steven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of. Reduced SCD1 activity decreases fatty acid re-esterification and alters markers of glyceroneogenesis and lipolysis in murine white adipose tissue and 3T3-L1 adipocytes by Steven Michael Dragos A Thesis

More information

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle

More information

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han,, Domenico Accili, Alan R. Tall J Clin Invest. 2009;119(4):1029-1041. https://doi.org/10.1172/jci36523. Research

More information

Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle:

Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle: BCH 4054 February 22, 2002 HOUR TEST 2 NAME_ Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle: CO 2 + 3ATP + 2NADPH 1/3 glyceraldehyde-3-p + 3ADP + 2NADP + Give the structures

More information

SREBP-1 integrates the actions of thyroid hormone, insulin, camp, and medium-chain fatty acids on ACC transcription in hepatocytes

SREBP-1 integrates the actions of thyroid hormone, insulin, camp, and medium-chain fatty acids on ACC transcription in hepatocytes SREBP-1 integrates the actions of thyroid hormone, insulin, camp, and medium-chain fatty acids on ACC transcription in hepatocytes Yanqiao Zhang, Liya Yin, and F. Bradley Hillgartner 1 Department of Biochemistry

More information

Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism

Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao

More information

Integration & Hormone Regulation

Integration & Hormone Regulation Integration Branchpoints in metabolism where metabolites can go several directions 1. Glucose 6-phosphate Energy needed (low energy charge): glycolysis Low blood sugar: high [glucagon], low [insulin] glycogen

More information

A Tryptophan Hydroxylase Inhibitor Increases Hepatic FGF21 Production and Decreases Hepatic Gluconeogenesis Independently of Insulin in db/db Mice

A Tryptophan Hydroxylase Inhibitor Increases Hepatic FGF21 Production and Decreases Hepatic Gluconeogenesis Independently of Insulin in db/db Mice A Tryptophan Hydroxylase Inhibitor Increases Hepatic FGF21 Production and Decreases Hepatic Gluconeogenesis Independently of Insulin in db/db Mice Katsunori Nonogaki, Takao Kaji, Mari Murakami ABSTRACT

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Mogat1 deletion does not ameliorate hepatic steatosis in lipodystrophic ( Agpat2 / ) or obese ( ob / ob ) mice

Mogat1 deletion does not ameliorate hepatic steatosis in lipodystrophic ( Agpat2 / ) or obese ( ob / ob ) mice Mogat1 deletion does not ameliorate hepatic steatosis in lipodystrophic ( Agpat2 ) or obese ( ob / ob ) mice Anil K. Agarwal, 1, * Katie Tunison, 2, * Jasbir S. Dalal, 2,3, * Chi-Liang Eric Yen, 4, Robert

More information

Role of BAF60a/BAF60c in chromatin remodeling and hepatic lipid metabolism

Role of BAF60a/BAF60c in chromatin remodeling and hepatic lipid metabolism Zhang et al. Nutrition & Metabolism (2016) 13:30 DOI 10.1186/s12986-016-0090-1 REVIEW Role of BAF60a/BAF60c in chromatin remodeling and hepatic lipid metabolism Ping Zhang, Lulu Li, Zhengxi Bao and Feiruo

More information

The endocrine Fibroblast Growth Factor family:

The endocrine Fibroblast Growth Factor family: The endocrine Fibroblast Growth Factor family: Possible insulin-sensitizing therapeutics Summary: This thesis focuses on the endocrine members of the Fibroblast Growth Factor (FGF) family. The 23 FGFs,

More information

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,

More information

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the

More information

Chronic overexpression of PNPLA3 I148M in mouse liver causes hepatic steatosis

Chronic overexpression of PNPLA3 I148M in mouse liver causes hepatic steatosis Research article Chronic overexpression of PNPLA3 I148M in mouse liver causes hepatic steatosis John Zhong Li, 1 Yongcheng Huang, 1 Ruchan Karaman, 1 Pavlina T. Ivanova, 2 H. Alex Brown, 2 Thomas Roddy,

More information

Regulation of Glucose Metabolism by Intracellular Compounds

Regulation of Glucose Metabolism by Intracellular Compounds Regulation of Metabolism by Intracellular ompounds Hexokinase ( ) -6- H ribose-5- or fructose-6- -6-phosphate () ( ) H -6-phosphate GI GM UD-glucose pyrophosphorylase 1-phosphate UD- hosphorylase synthase

More information

Transcriptomic analysis of hepatic responses to testosterone deficiency in miniature pigs fed a high-cholesterol diet

Transcriptomic analysis of hepatic responses to testosterone deficiency in miniature pigs fed a high-cholesterol diet Cai et al. BMC Genomics (2015) 16:59 DOI 10.1186/s12864-015-1283-0 RESEARCH ARTICLE Open Access Transcriptomic analysis of hepatic responses to testosterone deficiency in miniature pigs fed a high-cholesterol

More information

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water

More information

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S2. b-galactosidase staining of SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the

More information

3. (1) CLA 0% 0.1% 1%CLA C57BL/6 1%CLA 10% 30% 60% C57BL/6 19 CLA CLA 1%CLA 0.1%CLA 2- 1%CLA CLA. SREBP1 mrna SREBP1 ACC SCD1 FAS 60% 1 GLUT4 GLUT4

3. (1) CLA 0% 0.1% 1%CLA C57BL/6 1%CLA 10% 30% 60% C57BL/6 19 CLA CLA 1%CLA 0.1%CLA 2- 1%CLA CLA. SREBP1 mrna SREBP1 ACC SCD1 FAS 60% 1 GLUT4 GLUT4 49 1. ( ) 21 7 7 2. 1 10% CLA 0% 0.1% 1%CLA C57BL/6 19 2 10% 30% 60% 1%CLA C57BL/6 19 1-CLA CLA CLA 0.1% 1%CLA 0.1%CLA 2-1%CLA CLA SREBP1 mrna SREBP1 ACC SCD1 FAS 60% 1 GLUT4 CLA 1% SREBP1 GLUT4 2 db/db

More information

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Research article Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han, Chien-Ping Liang, Marit Westerterp, Takafumi Senokuchi, Carrie L. Welch, Qizhi Wang, Michihiro

More information

Week 3 The Pancreas: Pancreatic ph buffering:

Week 3 The Pancreas: Pancreatic ph buffering: Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions

More information

PGC-1alpha deficiency causes multi-system energy metabolic derangements: Muscle dysfunction, abnormal weight control and hepatic steatosis

PGC-1alpha deficiency causes multi-system energy metabolic derangements: Muscle dysfunction, abnormal weight control and hepatic steatosis Washington University School of Medicine Digital Commons@Becker Open Access Publications 2005 PGC-1alpha deficiency causes multi-system energy metabolic derangements: Muscle dysfunction, abnormal weight

More information