PCSK9 RNAi Therapeutics. Kevin FitzGerald

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "PCSK9 RNAi Therapeutics. Kevin FitzGerald"

Transcription

1 PCSK9 RNAi Therapeutics Kevin FitzGerald

2 Presenter Disclosure Information PSCK9 RNAi Therapeutics The following relationships exist related to this presentation:» Kevin Fitzgerald and Alnylam team members: Holds stock options in Alnylam Pharmaceuticals» University of Texas Southwestern Medical Center: Engaged in research for Alnylam» Tekmira Pharmaceuticals/UBC Engaged in research for Alnylam Pharmaceuticals 2

3 RNAi Therapy for Hypercholesterolemia Rationale for PCSK9 Hypercholesterolemia/PCSK9 Well validated target» Gain and loss of function mutations Rodent and Human (gf) and (lf) mutations PCSK9 expressed in liver (delivery) Early clinical markers of activity possible (PCSK9, LDLc, ApoB) Alnylam PCSK9 program Discovery of pm active PCSK9 sirnas Formulations or conjugates for delivery Proof of concept» Multiple rodent models, NHP s Collaboration with UT Southwestern» Horton, Hobbs, Brown and Goldstein Liver VLDL Rem PCSK9 Pathway PCSK9 LDL receptor LDL VLDL Rem Peripheral cells LDL 3

4 RNAi Product Platform Turning sirnas into Drugs Bioinformatics, in vitro assays Phosphorothioate 2 OMe, 2 F Cholesterol, others Select» In silico design» In vitro assays Stabilize» Chemistry Deliver» Formulations» Conjugates Incorporate minimal number of modifications required for appropriate pharmaceutical properties 4

5 Target/GAPDH relative to control treated No Evidence of Off-Target Silencing by PCS-B Endogenous Genes at High Concentration of PCS-B2 in vitro (Hep3B, RNAiMax, 1uM) Control ORMDL2 BMP6 TAPT1 MYEF2 LOC RFT1 PCSK9 PCS-B2 PCS-B2 pm IC 50 5

6 Lack of PCS-B2 Cytokine Induction Panel of 7 Cytokines, IFN-, IP-10, IFN-, TNF, IL-6, IL-1ra, G-CSF (hpbmc) 13 Donors Medium Medium plus transfection reagent Neg Control sirna Control sirna1 Control sirna2 Control sirna3 PCS-B IFN- IP-10 IFN- TNF- IL-6 IL-1ra G-CSF 6

7 Viability relative to control PCS-B2 Has No Effect On Cell Proliferation In 4 Different Cell Lines (Hep3B, Cos7 Cells Example) Hep3B Day Neg-Ctrl (nm) Pos-Ctrl (nm) PCS-A1 (nm) PCS-A4 (nm) PCS-B2 (nm) 7

8 Lipid Nanoparticles for Systemic RNAi Multi-component lipid formulation» Cationic lipid» Structural lipid» PEG lipid» Cholesterol Highly efficient for liver delivery» Hepatocyte-specific gene silencing achieved Low surface charge Small uniform size particle <100 nm 8

9 Liver PCSK9 mrna and serum Tc levels* RNAi Silencing of PCSK9 in Rats 1.6 PCSK9 mrna Tc LNP-siRNA (mg/kg) Day 0 3 N=6/group PCSK9 mrna Total chol. LDLR * * * ** ** RACE (Liver) LNP-PCS-A2 LNP-Ctrl PBS 0 PBS LNP-Ctrl LNP-PCS-A2 (mg/kg) (mg/kg) P PBS LNP-Ctrl LNP-PCS-A2 PBS LDLR TFR Predicted PCR band Seq. Confirmed Lane Frank-Kamenetsky et. al., Proc. Natl Acad. Sci., Aug

10 Serum Tc level* Liver cholesterol and TG levels* RNAi Silencing of PCSK9 Decreases Total Cholesterol in Rats Duration and Lack of Fatty Liver LNP-siRNA 5mg/kg Day 0 N=6/group X Hepatic cholesterol and triglycerides Total serum cholesterol d3 Hepatic cholesterol Hepatic TG Days post-injection * P<.05 (ANOVA) at up to day 16 LNP-PCS-A2 LNP-Ctrl PBS LNP-Ctrl LNP-PCS-A2 (mg/kg) (mg/kg) Proc. Natl Acad. Sci., Aug

11 Relative to PBS=1 PCSK9 mrna is down modulated in hcetp/hapob100 Transgenic Mice LDL particle number lowering Particle, nmol/l LNPX-PCS sirna (5mg/kg) Day 0 N=4/group 3 liver PCSK9 mrna NMR LipoProfile: LDL and HDL particle number 1.2 PCSK9/GAPDH Control PCS-A2 0 LDL HDL Control Total Particle Number LDL HDL PCS-A2 Total Particle Number 11

12 Plasma PCSK9 levels relative to pre-dose Serum LDLc relative to pre-dose RNAi Silencing of LDLc and PCSK9 Protein Non-Human Primates Acute and durable effects after a single 30 minute infusion PCSK9 plasma levels reduced by up to 70% of pre-dose levels Rapid reductions in LDL cholesterol levels by 40-60% ** = P<.01 *** = P< ** = P<.01 *** = P<.001 ** *** *** ** *** *** *** *** *** *** *** *** *** *** *** *** *** 0.5 *** *** *** PBS LNP-PCS-A2 LNP-PCS-B2 0 PBS LNP-PCS-A2 LNP-PCS-B2 Day Post-injection Day Post-injection Proc. Natl Acad. Sci., Aug

13 % Residual Factor VII LNP- formulated FVII sirna LNP Progress Efficacy Improvement Over Time serum FVII protein Day C DLinDMA DLinDAP 60 DLin-KC2-DMA-a DLin-KC2-DMA-b DLin-K-DMA 98N12-5(I) ED FVII sirna Dose (mg/kg) 13

14 Total Cholesterol Relative to PBS=1 relative to PBS= PCSK9/GAPDH Cholesterol Dose Sparing Paradigm and Multiple Injections LNP formulated PCS-A2 (mg/kg) PBS 3mg/kg bolus+ PBS once a week 3mg/kg bolus mg/kg per week days post initial bolus Initial 3mg/kg bolus Maintenance: 1 x wk Rats were bled one day prior to repeated dosing 14

15 relative to PBS=1 Dose Response in Rats PCS-A2 ED50 <0.1 mg/kg in Newer Formulations LNP E- formulated PCS-A2 sirna Day 0 3 liver PCSK9 mrna, total serum cholesterol PCSK9/GAPDH Cholesterol LNP E-formulated PCS-A2 sirna (mg/kg) 15

16 PCSK9 protein, ng/ml LDLc, mg/dl PCSK9 Gene Silencing with 2 nd Generation LNPs Primate Model ALN-PCS demonstrates potent efficacy in primates Employs 2 nd generation LNPs Rapid and durable dose-dependent reduction in PCSK9 protein PCSK9 silencing results in >50% reductions in LDLc LNP-control (1.00 mpk) 0.03 mpk 0.10 mpk 0.30 mpk 1.00 mpk sirna Dosing Day sirna Dosing Day 16

17 LNP-PCS-B2 Treatment with LNP-PCS-B2 Does Not Affect HDLc Levels NHP LNP-control (1.00 mpk) 0.03 mpk mpk 0.30 mpk 1.00 mpk

18 5 Different sirnas Formulated Nanoparticles Inhibit 5 Different Hepatic mrnas in Dose Dependent Manner Mice 72h Target mrna, relative to LNP12-Luc Control PCSK9 ED50, mg/kg ApoB FVII Xbp1 LNP-X-siRNAs Pool of SORT sirna mg/kg PNAS publication in press 18

19 Target mrna 10 Different Formulated sirnas in One Nanoparticle Inhibit 10 Different Hepatic mrnas Mice, 0.1mg/kg of each sirna, 48h 1.5 Luc Pool of PCSK9 FVII ApoB TTR Xbp1 SORT1 TTC39B Rab5c ITG 1 ApoC3 LNP-siRNA-Pool of 10 19

20 Summary PCSK9 Program RNAi therapeutic targeting PCSK9: Results in rapid, significant, and sustained lowering of LDLc levels, but not HDLc Lead molecules are active in all pre-clinical models tested:» pm and specific Rats» Total cholesterol lowering; RNAi based and LDLR mechanisms» <3 weeks duration on single dose» Steatosis free NHP study:» LDLc decreased ~40-60% with no effects on HDL cholesterol at doses >0.1mg/kg Dose sparing paradigms may be possible Combinations possible to treat metabolic syndrome» Up to ten targets in same formulation 20

21 ALN-PCS Team Alnylam Pharmaceuticals M. Frank-Kamenetsky T. Racie L. Qin A. Akinc V. Sharma L. Nechev S. Shulga-Morskaya K. Mills S. Millstein J. Wong T. Lei R. Duncan G. Wang R. Kallanthottathil M. Maier C. Gamba-Vitalo M. Kretschmer M. Jayaraman R. Myers K. Charisse M. Manoharan V. Kotelianski A. de Fougerolles University of Texas SW J. Horton A. Grefhorst N. Anderson Tekmira S. Semple A. Lee L. Jeffs E. Yaworski P. Lutwyche I. MacLachlan MIT Dan Anderson 21

AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics. March 1, 2012 Akin Akinc, PhD

AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics. March 1, 2012 Akin Akinc, PhD AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics March 1, 2012 Akin Akinc, PhD Lead Selection Alnylam RNAi Product Platform Turning

More information

ALN-PCSsc, an RNAi Investigational Agent That Inhibits PCSK9 Synthesis With the Potential for Effective Bi-Annual Dosing: Interim Results

ALN-PCSsc, an RNAi Investigational Agent That Inhibits PCSK9 Synthesis With the Potential for Effective Bi-Annual Dosing: Interim Results ALN-PCSsc, an RNAi Investigational Agent That Inhibits PCSK9 Synthesis With the Potential for Effective Bi-Annual Dosing: Interim Results Kevin Fitzgerald, PhD Co-authors: Amy Simon 1, Suellen White 1,

More information

Digestive Disease Week RNAi Therapeutics Ameliorate Liver Disease Associated with Alpha-1 Antitrypsin Deficiency. May 6, 2014 Alfica Sehgal

Digestive Disease Week RNAi Therapeutics Ameliorate Liver Disease Associated with Alpha-1 Antitrypsin Deficiency. May 6, 2014 Alfica Sehgal Digestive Disease Week RNAi Therapeutics Ameliorate Liver Disease Associated with Alpha-1 Antitrypsin Deficiency May 6, 2014 Alfica Sehgal Alpha-1 Antitrypsin (AAT) AAT is a serine proteinase inhibitor

More information

Alnylam RNAi Roundtable. May 13, 2011

Alnylam RNAi Roundtable. May 13, 2011 Alnylam RNAi Roundtable May 13, 2011 Agenda & Introductions Welcome Cynthia Clayton» Senior Director, Investor Relations and Corporate Communications Program Overview Akshay Vaishnaw, M.D., Ph.D. (Moderator)»

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Metabolism and Atherogenic Properties of LDL

Metabolism and Atherogenic Properties of LDL Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

TKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection

TKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection TKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection Amy Lee, Arbutus Biopharma DIA/FDA Oligonucleotide-Based Therapeutics Conference September 9 Washington, DC Disclaimer The views and opinions

More information

Kynamro. Kynamro (mipomersen) Description

Kynamro. Kynamro (mipomersen) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: December 2, 2016 Kynamro Description Kynamro (mipomersen)

More information

PCSK9 Inhibition: From Genetics to Patients

PCSK9 Inhibition: From Genetics to Patients PCSK9 Inhibition: From Genetics to Patients John Chapman BSc, Ph.D., D.Sc., FESC Research Professor, University of Pierre and Marie Curie Director Emeritus, INSERM Dyslipidemia and Atherosclerosis Research

More information

Liposome Mediated Delivery of sirna to Hepatic Stellate Cells Alfica Sehgal, Mohammad Zafari, Boris Klebanov, Greg Hinkle, Satya Kuchimanchi, Sarfraz

Liposome Mediated Delivery of sirna to Hepatic Stellate Cells Alfica Sehgal, Mohammad Zafari, Boris Klebanov, Greg Hinkle, Satya Kuchimanchi, Sarfraz Liposome Mediated Delivery of sirn to Hepatic Stellate ells lfica Sehgal, Mohammad Zafari, oris Klebanov, Greg Hinkle, Satya Kuchimanchi, Sarfraz Shaikh, Martin Maier, Jonathan O Shea, Lauren Speciner,

More information

Kynamro. Kynamro (mipomersen) Description

Kynamro. Kynamro (mipomersen) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: September 15, 2017 Kynamro Description Kynamro

More information

Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013

Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013 Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013 Conflicts CMO for The FH Foundation Pre-talk quiz What is cascade screening? 1. screening all family members 2.

More information

Inhibition of PCSK9: The Birth of a New Therapy

Inhibition of PCSK9: The Birth of a New Therapy Inhibition of PCSK9: The Birth of a New Therapy Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Disclosures Dr. Kastelein

More information

Nature Genetics: doi: /ng.3561

Nature Genetics: doi: /ng.3561 Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8

More information

PCSK9 Inhibitors Current Status

PCSK9 Inhibitors Current Status PCSK9 Inhibitors Current Status Ryan T. Whitney, MD FACC Bryan Heart Fall Conference 2015 Disclosures, Conflicts, and Nefarious Connections I own no stock in the companies mentioned in this talk. I am

More information

Dose-dependent effects of sirna-mediated inhibition of SCAP on PCSK9, LDLR and

Dose-dependent effects of sirna-mediated inhibition of SCAP on PCSK9, LDLR and Dose-dependent effects of sirna-mediated inhibition of SCAP on PCSK9, LDLR and plasma lipids in mouse and rhesus monkey Kristian K. Jensen 1, 8*, Marija Tadin-Strapps 2*, Sheng-ping Wang 1, James Hubert

More information

PK and PD Properties of Antisense Oligonucleotides: Bridging Nonclinical to Clinical

PK and PD Properties of Antisense Oligonucleotides: Bridging Nonclinical to Clinical PK and PD Properties of Antisense ligonucleotides: Bridging Nonclinical to Clinical Rosie Z. Yu, Ph.D. Pharmacokinetics & Clinical Pharmacology Isis Pharmaceuticals, Inc. Carlsbad, CA USA 2 Antisense Mechanism

More information

N-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP

N-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA

More information

Cholesterol; what are the future lipid targets?

Cholesterol; what are the future lipid targets? Cholesterol; what are the future lipid targets? lipidologist out-of-business in 5-10 years? G.Kees Hovingh dept of vascular medicine, Academic Medical Center g.k.hovingh@amc.uva.nl Disclosure - Consultant

More information

Advances in Lipid Nanoparticles for sirna Delivery

Advances in Lipid Nanoparticles for sirna Delivery Pharmaceutics 2013, 5, 498-507; doi:10.3390/pharmaceutics5030498 OPEN ACCESS pharmaceutics ISSN 1999-4923 www.mdpi.com/journal/pharmaceutics Review Advances in Lipid Nanoparticles for sirna Delivery Yuen

More information

Problem patients in primary care Patient 4: Peripheral artery disease

Problem patients in primary care Patient 4: Peripheral artery disease Problem patients in primary care Patient 4: Peripheral artery disease Dr Terry McCormack Hambleton Richmond Whitby Clinical Commissioning Group Research Lead 01/05/2014 Delivering clinical research to

More information

Rational design of cationic lipids for sirna delivery

Rational design of cationic lipids for sirna delivery ational design of cationic lipids for sina delivery Sean C Semple 1,6, Akin Akinc 2,6, Jianxin Chen 1,5, Ammen P Sandhu 1, Barbara L Mui 1,5, Connie K Cho 1, Dinah W Y Sah 2, Derrick Stebbing 1, Erin J

More information

Disclosure. This study was sponsored by Pfizer, Inc. All authors are employees of Pfizer, Inc. with ownership of stock in Pfizer, Inc.

Disclosure. This study was sponsored by Pfizer, Inc. All authors are employees of Pfizer, Inc. with ownership of stock in Pfizer, Inc. Disclosure This study was sponsored by Pfizer, Inc. All authors are employees of Pfizer, Inc. with ownership of stock in Pfizer, Inc. Effects of 12 Weeks of Treatment with RN316 (PF-04950615), a Humanized

More information

UNIVERSITA DI PISA CHIMICA E TECNOLOGIE FARMACEUTICHE FAMILIAL HYPERCHOLESTEROLEMIA DIPARTIMENTO DI FARMACIA GENETIC CAUSES AND THERAPY

UNIVERSITA DI PISA CHIMICA E TECNOLOGIE FARMACEUTICHE FAMILIAL HYPERCHOLESTEROLEMIA DIPARTIMENTO DI FARMACIA GENETIC CAUSES AND THERAPY UNIVERSITA DI PISA DIPARTIMENTO DI FARMACIA CHIMICA E TECNOLOGIE FARMACEUTICHE CORSO DI BASI BIOCHIMICHE DELL AZIONE DEI FARMACI FAMILIAL HYPERCHOLESTEROLEMIA GENETIC CAUSES AND THERAPY ERIKA ROSARIA PACCIOLLA

More information

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:

More information

Lipoprotein Management: the role of genes and drugs. W. Virgil Brown, MD Emory University

Lipoprotein Management: the role of genes and drugs. W. Virgil Brown, MD Emory University Lipoprotein Management: the role of genes and drugs W. Virgil Brown, MD Emory University Mortality from ASCVD In USA (2000 through 2011) AHA Heart Disease and Stroke Statistics 2015 (Circulation 01-27-15)

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

RNAi Roundtable: ALN-PCSsc for the Treatment of Hypercholesterolemia. August 14, 2014

RNAi Roundtable: ALN-PCSsc for the Treatment of Hypercholesterolemia. August 14, 2014 RNAi Roundtable: ALN-PCSsc for the Treatment of Hypercholesterolemia August 14, 2014 Welcome Cynthia Clayton Vice President, Investor Relations and Corporate Communications Introduction Akshay Vaishnaw,

More information

Test Definition: FNMR2 NMR LipoProfile w/ir Markers

Test Definition: FNMR2 NMR LipoProfile w/ir Markers Reporting Title: Performing Location: Labcorp Burlington Specimen Requirements: Submit only one of the following specimens: Serum Draw blood in a plain red-top tube(s). (Serum gel tube is not acceptable.)

More information

Impact of a 1- or 2-dose starting regimen of inclisiran, a novel sirna inhibitor to PCSK9 on time averaged LDL-C reductions over 1 year

Impact of a 1- or 2-dose starting regimen of inclisiran, a novel sirna inhibitor to PCSK9 on time averaged LDL-C reductions over 1 year ORION-1 Impact of a 1- or 2-dose starting regimen of inclisiran, a novel sirna inhibitor to PCSK9 on time averaged LDL-C reductions over 1 year Kausik K Ray, Ulf Landmesser, Lawrence A Leiter, David Kallend,

More information

Separation of HDL Particles by Immunoprecipitation

Separation of HDL Particles by Immunoprecipitation Sun Diagnostics, LLC Separation of HDL Particles by Immunoprecipitation Rae-Anne Nguyen and John H. Contois 13 Introduction We all know that HDL cholesterol concentration is inversely associated with coronary

More information

NOVEL BIOMARKERS IN RISK ASSESSMENT AND MANAGEMENT OF CARDIOVASCULAR DISEASE

NOVEL BIOMARKERS IN RISK ASSESSMENT AND MANAGEMENT OF CARDIOVASCULAR DISEASE CARDIOVASCULAR DISEASE Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices and drugs

More information

Novel Approach to the Potential Treatment of Patients with B-Cell Lymphomas Harboring the MYD88 L265P Mutation:

Novel Approach to the Potential Treatment of Patients with B-Cell Lymphomas Harboring the MYD88 L265P Mutation: Novel Approach to the Potential Treatment of Patients with B-Cell Lymphomas Harboring the MYD88 L265P Mutation: Combination Treatment with TLR Antagonist and Rituximab D. Wang, W. Jiang, T. Sullivan, L.

More information

Alirocumab Treatment Effect Did Not Differ Between Patients With and Without Low HDL-C or High Triglyceride Levels in Phase 3 trials

Alirocumab Treatment Effect Did Not Differ Between Patients With and Without Low HDL-C or High Triglyceride Levels in Phase 3 trials Alirocumab Treatment Effect Did Not Differ Between Patients With and Without Low HDL-C or High Triglyceride Levels in Phase 3 trials G. Kees Hovingh, 1 Richard Ceska, 2 Michael Louie, 3 Pascal Minini,

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures and Figure Legends Supplementary Figure 1 A. HDL-C (mg/dl) 14 12 1 8 6 4 2 Noncarriers HDL Cholesterol **** Carriers B. apoa-i (mg/dl) 325 3 275 25 225 2

More information

Expanding its HDL strategy into Immuno-oncology and Chemotherapeutic drug delivery. Acquisition of LYPRO Biosciences

Expanding its HDL strategy into Immuno-oncology and Chemotherapeutic drug delivery. Acquisition of LYPRO Biosciences Expanding its HDL strategy into Immuno-oncology and Chemotherapeutic drug delivery Acquisition of LYPRO Biosciences CERENIS is well positioned to change the drug delivery paradigm Over a decade of experience

More information

B. Patient has not reached the percentage reduction goal with statin therapy

B. Patient has not reached the percentage reduction goal with statin therapy Managing Cardiovascular Risk: The Importance of Lowering LDL Cholesterol and Reaching Treatment Goals for LDL Cholesterol The Role of the Pharmacist Learning Objectives 1. Review the role of lipid levels

More information

Clinical Policy: Mipomersen (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017

Clinical Policy: Mipomersen (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017 Clinical Policy: (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017 Last Review Date: Revision Log See Important Reminder at the end of this policy for important regulatory and legal information.

More information

Update on inclisiran Discussion of ORION-1 trial

Update on inclisiran Discussion of ORION-1 trial Update on inclisiran Discussion of ORION-1 trial Conference call: March 17, 2017 4:30 pm 5:30 pm, EDT 1 Forward-looking statements Statements contained in this presentation that are not purely historical

More information

Developing Best in Class BET Inhibitors for Oncology & AI: from Discovery to the Clinic. Kevin G. McLure, PhD EpiCongress July 2014

Developing Best in Class BET Inhibitors for Oncology & AI: from Discovery to the Clinic. Kevin G. McLure, PhD EpiCongress July 2014 Developing Best in Class BET Inhibitors for Oncology & AI: from Discovery to the Clinic Kevin G. McLure, PhD EpiCongress July 2014 Zenith Epigenetics Overview Formed from Resverlogix as an independent

More information

Lipid/Lipoprotein Structure and Metabolism (Overview)

Lipid/Lipoprotein Structure and Metabolism (Overview) Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Lipids, Lipoproteins and Cardiovascular Risk: Getting the Most out of New and Old Biomarkers. New and Old Biomarkers. Disclosures

Lipids, Lipoproteins and Cardiovascular Risk: Getting the Most out of New and Old Biomarkers. New and Old Biomarkers. Disclosures Lipids, Lipoproteins and Cardiovascular Risk: Getting the Most out of New and Old Biomarkers William Cromwell, MD, FAHA, FNLA Diplomate, American Board of Clinical Lipidology Chief Lipoprotein and Metabolic

More information

PCSK9 and its Inhibitors Past, Present, and Future Implications

PCSK9 and its Inhibitors Past, Present, and Future Implications PCSK9 and its Inhibitors Past, Present, and Future Implications Seth J. Baum, MD, FACC, FACPM, FAHA, FNLA, FASPC President-Elect, American Society for Preventive Cardiology Medical Director, Women s Preventive

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Low-density lipoproteins cause atherosclerotic cardiovascular disease (ASCVD) 1. Evidence from genetic, epidemiologic and clinical studies

Low-density lipoproteins cause atherosclerotic cardiovascular disease (ASCVD) 1. Evidence from genetic, epidemiologic and clinical studies Low-density lipoproteins cause atherosclerotic cardiovascular disease (ASCVD) 1. Evidence from genetic, epidemiologic and clinical studies A Consensus Statement from the European Atherosclerosis Society

More information

ALKA VITA DIABETES TEST

ALKA VITA DIABETES TEST ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O

More information

Dyslipidemia Endothelial dysfunction Free radicals Immunologic

Dyslipidemia Endothelial dysfunction Free radicals Immunologic ATHEROSCLEROSIS Hossein Mehrani Professor of Clinical Biochemistry Definition Atherosclerosis: Is a chronic inflammatory process characterized by plaque formation within the vessel wall of arteries and

More information

Safety of Anacetrapib in Patients with or

Safety of Anacetrapib in Patients with or Safety of Anacetrapib in Patients with or at Risk for Coronary Heart Disease Christopher P. Cannon, MD, Sukrut Shah, PhD, RPh, Hayes M. Dansky, MD, Michael Davidson, MD, Eliot A. Brinton, MD, Antonio M.

More information

Canakinumab Anti-Inflammatory Thrombosis Outcomes Study (CANTOS)

Canakinumab Anti-Inflammatory Thrombosis Outcomes Study (CANTOS) Canakinumab Anti-Inflammatory Thrombosis Outcomes Study (CANTOS) Stable CAD (post MI) On Statin, ACE/ARB, BB, ASA Persistent Elevation of hscrp (> 2 mg/l) N = 10,061 39 Countries April 2011 - June 2017

More information

PCSK9 inhibition and LDL cholesterol lowering: the biology of an attractive therapeutic target and critical review of the latest clinical trials

PCSK9 inhibition and LDL cholesterol lowering: the biology of an attractive therapeutic target and critical review of the latest clinical trials Clinical Lipidology ISSN: 1758-4299 (Print) 1758-4302 (Online) Journal homepage: http://www.tandfonline.com/loi/tlip20 PCSK9 inhibition and LDL cholesterol lowering: the biology of an attractive therapeutic

More information

numares at a glance company overview 2014 Discover, understand and use biological systems high level NMR analytics

numares at a glance company overview 2014 Discover, understand and use biological systems high level NMR analytics numares at a glance company overview 2014 Discover, understand and use biological systems high level NMR analytics Three benefits of numares 1 Supporting patients to receive better cure based on effective

More information

Coverage Guidelines. NMR LipoProfile and NMR LipoProfile -II Tests

Coverage Guidelines. NMR LipoProfile and NMR LipoProfile -II Tests Coverage Guidelines NMR LipoProfile and NMR LipoProfile -II Tests Disclaimer: Please note that Baptist Health Plan updates Coverage Guidelines throughout the year. A printed version may not be most up

More information

Successful completion of Phase I clinical trial of AMPK activator O304

Successful completion of Phase I clinical trial of AMPK activator O304 Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination

More information

Primary efficacy & safety outcomes

Primary efficacy & safety outcomes ORION-1 Primary efficacy & safety outcomes LDL-C reduction from 6 to 9 months following single or second injections of inclisiran, a novel sirna compound Kausik K Ray, Ulf Landmesser, Lawrence A Leiter,

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently

More information

(a) y = 1.0x + 0.0; r = ; N = 60 (b) y = 1.0x + 0.0; r = ; N = Lot 1, Li-heparin whole blood, HbA1c (%)

(a) y = 1.0x + 0.0; r = ; N = 60 (b) y = 1.0x + 0.0; r = ; N = Lot 1, Li-heparin whole blood, HbA1c (%) cobas b system - performance evaluation Study report from a multicenter evaluation of the new cobas b system for the measurement of HbAc and lipid panel Introduction The new cobas b system provides a point-of-care

More information

The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses

The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses 18 June 2015 Doris Jacobs Unilever R&D Vlaardingen Background Elevated low-density lipoprotein-cholesterol

More information

Hypertriglyceridemia: Why, When, and How to Treat. Gregory Cohn, MD, FNLA, FASPC

Hypertriglyceridemia: Why, When, and How to Treat. Gregory Cohn, MD, FNLA, FASPC Hypertriglyceridemia: Why, When, and How to Treat Gregory Cohn, MD, FNLA, FASPC DISCLOSURES Consultant to Akcea Therapeutics (in the past 12 months). OUTLINE I. Lipoproteins II. Non-HDL-C III. Causes and

More information

Pathophysiology of Lipid Disorders

Pathophysiology of Lipid Disorders Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history

More information

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona.

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene therapy: State of the art Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene Therapy: First Steps Type 1 diabetes: An islet disease Alpha cell Beta cell Pancreatic

More information

Plasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension

Plasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original

More information

Disclosures. Background 1 What is Known MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES. Background 2 What is Not Known 10/2/2017

Disclosures. Background 1 What is Known MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES. Background 2 What is Not Known 10/2/2017 Disclosures MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES Grants: NIH, Quest Diagnostics Consultant: Quest Diagnostics Merck Global Atherosclerosis Advisory Board Ronald M. Krauss, Children s Hospital

More information

Effect of a Monoclonal Antibody to PCSK9 on LDL Cholesterol

Effect of a Monoclonal Antibody to PCSK9 on LDL Cholesterol T h e n e w e ngl a nd j o u r na l o f m e dic i n e original article Effect of a Monoclonal Antibody to PCSK9 on LDL Cholesterol Evan A. Stein, M.D., Ph.D., Scott Mellis, M.D., Ph.D., George D. Yancopoulos,

More information

6 th Hellenic Congress in Athens, of the Hellenic Atherosclerosis Society, on the December 2014

6 th Hellenic Congress in Athens, of the Hellenic Atherosclerosis Society, on the December 2014 The Cardiovascular Medicine Journal, 2015, 9, 73-77 73 Open Access 6 th Hellenic Congress in Athens, of the Hellenic Atherosclerosis Society, on the 04-06 December 2014 Novel Pharmacologic Treatments of

More information

Chapter (5) Etiology of Low HDL- Cholesterol

Chapter (5) Etiology of Low HDL- Cholesterol Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the

More information

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

Chronic Kidney Disease as cardiovascular risk predictor Evidence based clinical management. Fabio Mazza

Chronic Kidney Disease as cardiovascular risk predictor Evidence based clinical management. Fabio Mazza Chronic Kidney Disease as cardiovascular risk predictor Evidence based clinical management Fabio Mazza CKD (Chronic Kidney Disease) is an ever-increasing clinical condition marked by a progressive reduction

More information

CERENIS Therapeutics acquires LYPRO Biosciences expanding its HDL strategy into immuno-oncology and chemotherapeutic drug delivery

CERENIS Therapeutics acquires LYPRO Biosciences expanding its HDL strategy into immuno-oncology and chemotherapeutic drug delivery Press release CERENIS Therapeutics acquires LYPRO Biosciences expanding its HDL strategy into immuno-oncology and chemotherapeutic drug delivery Combining LYPRO Biosciences NanoDisk technology with CERENIS

More information

Metabolic Disease drug discovery at Evotec

Metabolic Disease drug discovery at Evotec Metabolic Disease drug discovery at Evotec Evotec, Metabolic Disease Drug Discovery, 2016 Evotec, an ideal partner in metabolic disease drug discovery The different ways to work with us On your specific

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)

More information

PCSK9 for LDL Cholesterol Reduction: What have we learned from clinical trials?

PCSK9 for LDL Cholesterol Reduction: What have we learned from clinical trials? PCSK9 for LDL Cholesterol Reduction: What have we learned from clinical trials? Slide deck kindly supplied as an educational resource by Dr Evan A Stein MD PhD Director Emeritus Metabolic & Atherosclerosis

More information

Supplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups

Supplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups Supplemental Table S1: Unadjusted and Adjusted Hazard Ratios for Diabetes Associated with Baseline Factors Considered in Model 3 SMART Participants Only Unadjusted Adjusted* Baseline p-value p-value Covariate

More information

March 30, 2014, Joint ACC/JAMA Late-breaking Clinical Trials Session 402 American College of Cardiology, Washington DC

March 30, 2014, Joint ACC/JAMA Late-breaking Clinical Trials Session 402 American College of Cardiology, Washington DC A Phase 3 Double-blind, Randomized Study to Assess Safety and Efficacy of Evolocumab (AMG 145) in Hypercholesterolemic Subjects Unable to Tolerate an Effective Dose of Statin Erik Stroes 1, David Colquhoun

More information

Traceable lipoprotein counting for Cardiovascular disease risk assessment Vincent DELATOUR, PhD

Traceable lipoprotein counting for Cardiovascular disease risk assessment Vincent DELATOUR, PhD Traceable lipoprotein counting for Cardiovascular disease risk assessment Vincent DELATOUR, PhD 1 The need for primary methods VIM 2008 : Primary reference measurement procedure : reference measurement

More information

If yes, continue to #2. If no, do not approve. DENIAL TEXT: See the initial denial text at the end of the guideline.

If yes, continue to #2. If no, do not approve. DENIAL TEXT: See the initial denial text at the end of the guideline. Generic Brand HICL GCN Exception/Other LOMITAPIDE JUXTAPID 39883 This drug requires a written request for prior authorization. All requests for Juxtapid (lomitapide) require review by a pharmacist prior

More information

Hepatic ABC transporters and triglyceride metabolism

Hepatic ABC transporters and triglyceride metabolism University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Nutrition and Health Sciences -- Faculty Publications Nutrition and Health Sciences, Department of 2012 Hepatic ABC transporters

More information

Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs

Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs Indian Patent Application No. 1623/DEL/2014 Inventors: Prof. Kulbhushan Tikoo and Jasmine Kaur Department of Pharmacology

More information

Identification and management of familial hypercholesterolaemia (FH) - An overview

Identification and management of familial hypercholesterolaemia (FH) - An overview Identification and management of familial hypercholesterolaemia (FH) - An overview National Collaborating Centre for Primary Care and Royal College of General Practitioners NICE Guideline CG 71 (August

More information

Managing recalcitrant hypercholesterolemia in patients on current best standard of care: efficacy and safety of novel pharmacotherapies

Managing recalcitrant hypercholesterolemia in patients on current best standard of care: efficacy and safety of novel pharmacotherapies Clinical Lipidology ISSN: 1758-4299 (Print) 1758-4302 (Online) Journal homepage: http://www.tandfonline.com/loi/tlip20 Managing recalcitrant hypercholesterolemia in patients on current best standard of

More information

Relationship of CRP Reduction to Cardiovascular Event Reduction Following Treatment with Canakinumab

Relationship of CRP Reduction to Cardiovascular Event Reduction Following Treatment with Canakinumab AHA 2017 Residual Inflammatory Risk and Residual Cholesterol Risk: Critical Analysis from CANTOS Relationship of CRP Reduction to Cardiovascular Event Reduction Following Treatment with Paul M Ridker MD,

More information

Therapeutic effect of flavonoid rich extract of apricots on high-fat diet induced hyperlipidemia in rabbits

Therapeutic effect of flavonoid rich extract of apricots on high-fat diet induced hyperlipidemia in rabbits Therapeutic effect of flavonoid rich extract of apricots on high-fat diet induced hyperlipidemia in rabbits in rabbits TOOBA LATEEF Assistant Professor Department of Biochemistry Jinnah University for

More information

Copyright 2017 by Sea Courses Inc.

Copyright 2017 by Sea Courses Inc. Diabetes and Lipids Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored, or transmitted in any form or by any means graphic, electronic, or

More information

HBA1C: PREDICTOR OF DYSLIPIDEMIA AND ATHEROGENICITY IN DIABETES MELLITUS

HBA1C: PREDICTOR OF DYSLIPIDEMIA AND ATHEROGENICITY IN DIABETES MELLITUS Original Article HBA1C: PREDICTOR OF DYSLIPIDEMIA AND ATHEROGENICITY IN DIABETES MELLITUS Chintamani Bodhe*, Deepali Jankar**, Tara Bhutada***, Milind Patwardhan****, Mrs Varsha Patwardhan***** ABSTRACT

More information

Case Discussions: Treatment Strategies for High Risk Populations. Most Common Reasons for Referral to the Baylor Lipid Clinic

Case Discussions: Treatment Strategies for High Risk Populations. Most Common Reasons for Referral to the Baylor Lipid Clinic Case Discussions: Treatment Strategies for High Risk Populations Peter H. Jones MD, FNLA Associate Professor Methodist DeBakey Heart and Vascular Center Baylor College of Medicine Most Common Reasons for

More information

Pattern of lipid biomarkers and risk of cardiovascular disease

Pattern of lipid biomarkers and risk of cardiovascular disease Pattern of lipid biomarkers and risk of cardiovascular disease Robert Clarke Clinical Trial Service Unit University of Oxford 9 January 2017 Biomarkers for dietary fats Blood lipids (LDL, HDL, triglycerides,

More information

Is Universal Pediatric Lipid Screening Justified? YES. Damon Dixon, MD, FAAP Preventative Cardiology March 7 th, 2016

Is Universal Pediatric Lipid Screening Justified? YES. Damon Dixon, MD, FAAP Preventative Cardiology March 7 th, 2016 Is Universal Pediatric Lipid Screening Justified? YES Damon Dixon, MD, FAAP Preventative Cardiology March 7 th, 2016 None Disclosures What is a Pediatrician? Pediatrics is the specialty of medical science

More information

Genetic Dyslipidemia and Cardiovascular Diseases

Genetic Dyslipidemia and Cardiovascular Diseases Sultan Qaboos University Genetic Dyslipidemia and Cardiovascular Diseases Fahad AL Zadjali, PhD Fahadz@squ.edu.om We care 1 2/14/18 DISCLOSURE OF CONFLICT No financial relationships with commercial interests

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

UPDATES IN LIPID MANAGEMENT

UPDATES IN LIPID MANAGEMENT UPDATES IN LIPID 2017 Cardiovascular Symposium MANAGEMENT SUDHA RAVILLA, MD, DIPLOMATE, ABCL MEDICAL DIRECTOR CLINICAL LIPIDOLOGY TMHPP METABOLIC HEALTH CENTER INTRODUCTION CVD is STILL the No. 1 cause

More information

Lipid metabolism in familial hypercholesterolemia

Lipid metabolism in familial hypercholesterolemia Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis

More information

Prevention Updates and Paradigm Shifts

Prevention Updates and Paradigm Shifts Prevention Updates and Paradigm Shifts Andrew Freeman, MD, FACC Director of Clinical Cardiology and Operations National Jewish Health Assistant Professor of Medicine National Jewish Health and University

More information

Repatha. Repatha (evolocumab) Description

Repatha. Repatha (evolocumab) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.08 Subject: Repatha Page: 1 of 9 Last Review Date: September 15, 2017 Repatha Description Repatha

More information

Normal ldl cholesterol levels for men over 50

Normal ldl cholesterol levels for men over 50 Normal ldl cholesterol levels for men over 50 Aug 14, 2017. Thus, the healthy bad cholesterol numbers for younger people are significantly lower because the risk charts figure their numbers will rise.

More information

Atherogenic Lipoprotein Determinants of Cardiovascular Disease and Residual Risk Among Individuals With Low Low-Density Lipoprotein Cholesterol

Atherogenic Lipoprotein Determinants of Cardiovascular Disease and Residual Risk Among Individuals With Low Low-Density Lipoprotein Cholesterol Atherogenic Lipoprotein Determinants of Cardiovascular Disease and Residual Risk Among Individuals With Low Low-Density Lipoprotein Cholesterol Patrick R. Lawler, MD, MPH; Akintunde O. Akinkuolie, MBBS,

More information

Rotterdam Criteria 9/30/2017. A Changing Paradigm in PCOS. Polycystic Ovary Syndrome - Is the Cardiometabolic Risk Increased After Menopause?

Rotterdam Criteria 9/30/2017. A Changing Paradigm in PCOS. Polycystic Ovary Syndrome - Is the Cardiometabolic Risk Increased After Menopause? Disclosure Polycystic Ovary Syndrome - Is the Cardiometabolic Risk Increased After Menopause? Fractyl laboratories, Inc Anuja Dokras, MD., Ph.D. Professor of Obstetrics and Gynecology Director PENN PCOS

More information

Dyslipidemia and the Use of Statins. Troy L Randle, DO, FACC, FACOI

Dyslipidemia and the Use of Statins. Troy L Randle, DO, FACC, FACOI Dyslipidemia and the Use of Statins Troy L Randle, DO, FACC, FACOI Objective: Identify CV risk. Determine what dyslipidemia (dyslipoproteinemia) is Decrease CV risk and optimize lipid levels for your

More information