Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3

Size: px
Start display at page:

Download "Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3"

Transcription

1 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale i: Primers used for RT-PCR. References are provided under Source, except for primers designed using PuMed s Primer-BLAST. Target Primer Sequence Source Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3 CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3 5 -AAAGGCATTGGCTGGAAGAA-3 Fizz-1 Forward 5 - CACCTCTTCACTCGAGGGACAGTTG GGTCCCAGTGCATATGGATGAGACC-3 GAPDH Forward 5 -ACCACAGTCCATGCCATCAC-3 5 -TCCACCACCCTGTTGCTGTA-3 IL-1β Forward 5 - AGGCAGGCAGTATCACTCATTGT GGAAGGTCCACGGGAAAGA-3 IL-6 Forward 5 -TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTCC-3 LDLR Forward 5 -TCCAATCAATTCAGCTGTGG-3 Mannose receptor 5 -GAGCCATCTAGGCAATCTCG-3 Forward 5 - AAACACAGACTGACCCTTCCC GTTAGTGTACCGCACCCTCC-3 MCP-1 Forward 5 - TTCCTCCACCACCATGCAG CCAGCCGGCAACTGTGA-3 PCSK9 Forward 5 -TTGCAGCAGCTGGGAACTT CCGACTGTGATGACCTCTGGA-3 SR-A Forward 5 - CTTTACCAGCAATGACAAAAGAGA-3 5 -ATTTCACGGATTCTGAACTGC-3 1

2 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale ii: Antiodies used in this study. IF indicates immunofluorescence, Flow indicates flow cytometry. Antiody Supplier Catalogue # Use Primary Goat anti-human apoa1 Midland Bioproducts Immunolot Goat anti-human apob Midland Bioproducts Immunolot Rait anti-apob48 receptor Acam A Immunolot FITC rat anti-mouse CD3 BD Pharmingen Flow APC rat anti-mouse CD11 (M1/70) Invitrogen RM2805 Flow FITC rat anti-mouse CD11 (M1/70) BD Pharmingen Flow Rait anti-mouse CD36 Santa Cruz Biotech. SC9154 IF APC-anti-mouse CD36 BioLegend Flow Rat anti-mouse CD41 (MWReg30) BD Pharmingen IF PerCP-Cy5.5 anti-hu/mo CD45R/B220 ebioscience Flow E06 IgM monoclonal antiody Avanti Polar Lipids IF Rait anti-ε-cop Novus Biologicals NBP Immunolot F4/80 monoclonal antiody Acam a6640 IF/Flow FITC anti-gp1β Emfret Analytics M050-1 Flow PE-JON/A Emfret Analytics D200 Flow (anti- GPII/IIIa) Goat anti-mouse LDLR R&D Systems AF2255 Immunolot Rait anti-lrp-1 Acam a92544 Immunolot Mouse anti-mouse Na + /K + ATPase α-1 Upstate Technology Immunolot FITC anti-p-selectin Emfret Analytics D200 Flow Secondary Alexa-488 goat anti-mouse IgM Invitrogen A21042 IF Alexa-488 goat anti-rat Invitrogen A11006 IF Alexa-594 goat anti-rait Invitrogen A11012 IF/Flow 2

3 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. HRP donkey anti-mouse IgG Jackson Immunoresearch Immunolot HRP donkey anti-rait IgG Jackson Immunoresearch Immunolot HRP rait anti-goat IgG Jackson Immunoresearch Immunolot 3

4 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Legends to Supplementary Figures Supplementary Figure i: LRP-1 and apob48r levels in liver total memranes of control and rosuvastatin treated SR-B1 -/- /apoe -/- mice. Representative immunolots (A,C) and quantification (B,D) of LRP-1 (A,B) or apob48r (C,D) levels in liver total memranes from control saline- or rosuvastatin-treated SR-B1 -/- /apoe -/- mice (n=5, 5). ε-cop was used to control for equal loading. NS indicates not statistically significantly different y Mann-Whitney rank sum test. Supplementary Figure ii: Scatter plots of atherosclerosis in aortic sinuses and coronary arteries from rosuvastatin and control treated SR-B1 -/- apoe -/- mice. Scatter plots are shown for the atherosclerosis data presented in figure 2C for the aortic sinus (panel A) and figure 2I for coronary arteries (panel B). Red symols correspond to female and lue to male mice. Horizontal ars and whiskers correspond to means±sem of pooled data. Values for control females and control males were not statistically significantly different (P=0.76 for panel A, and P=0.17 for panel B). Values for control versus rosuvastatin treated mice were statistically significantly different for females (P=0.029 for panel A and P= for panel B) and when oth males and females were pooled (P=0.023 for panel A and P< for panel B). Mann-Whitney rank sum test was used for statistical analysis. Supplementary Figure iii: Flow cytometry analysis of platelets. Whole heparinized lood was collected y carotid artery cannulation, laeled with antiodies and fixed as descried in the methods section. Flow cytometry was performed using a BD FACSCaliur. Forward and side scatter was used to identify platelets (gated as shown). Shown are forward and side scatter and gating for platelets for representative samples from a apoe -/- sko control mouse (left panel) and SR-B1 -/- apoe -/- dko mice treated with saline (control-middle panel) or rosuvastatin (right panel). Supplementary Figure iv: Platelet CD36 levels detected y flow cytometry. Whole lood (26 μl) was incuated with 2 μl FITC-conjugated anti-gp1β (to identify platelets) and 1 μl APC-conjugated anti-cd36 for 15 min, and then mixed with 0.4 ml PBS containing 1 % formaldehyde (freshly prepared from paraformaldehyde), prior to flow cytometry analysis using a BDFACSCaliur flow cytometer. Platelets were identified y gating for FITC (GP1β+) and the median APC fluorescence (CD36) of the histogram was determined for each sample. C indicates control, saline-treated. R indicates rosuvastatin-treated. sko are apoe -/- and dko are SR-B1 -/- /apoe -/- mice. Data are averages ± S.E.M. of N=4 (sko) and N=5 (C and R, dko) mice. Data were analyzed y the Kruskall-Wallis one-way ANOVA and found not to e statistically significantly different (P>0.4). Supplementary Figure v: Flow cytometry analysis of leukocytes from control saline- or rosuvastatin treated SR-B1 -/- /apoe -/- mice. Blood from control saline- and rosuvastatin-treated SR- B1 -/- apoe -/- dko mice was treated to lyse erythrocytes, washed and laeled as descried in the Methods section with A) FITC-laeled rat anti-mouse CD3 (for T-lymphocytes), B) PerCP-Cy5.5-laeled antihu/mo CD45R/B220 (for B-lymphocytes) and C) APC-laeled anti-mouse CD11 (for myeloid cells). The proportion of cells positive for each of the three markers was determined y flow cytometry using a BD FACSCalier instrument. Shown are the means from N=6 control saline- and N=5 rosuvastatin treated SR-B1 -/- apoe -/- dko mice. Data was analyzed y the Mann-Whitney rank sum test. Rosuvastatin treatment did not significantly affect levels of circulating CD3 +, B220 + or CD11 + leukocytes (P>0.05). 4

5 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Figure vi: Rosuvastatin treatment of one marrow derived macrophages from SR-B1 -/- /apoe -/- mice did not affect polarization towards M1 or M2 phenotypes. Bone marrow was prepared from femurs and tiias of N=3 SR-B1 -/- apoe -/- dko mice. Cells were plated overnight in DMEM with 10 % FBS and cells in suspension were recovered, washed and cultured for 7 days in DMEM containing 10 % FBS and 20 % L-cell conditioned medium to allow for differentiation to macrophages. Macrophages were treated with or without 10 μm rosuvastatin, and 10 ng/ml of either LPS (for M1 polarization, A-C) or IL-4 (for M2 polarization, D-F) as indicated. After 6 hrs, cells were lysed and total RNA was extracted, purified and quantified and analyzed y quantitative real time PCR as descried in the Methods section. LPS treated samples were analyzed for A) IL-1β, B) IL-6 and C) MCP-1 (top) and IL-4 treated samples were analyzed for D) arginase 1 (ARG-1), E) mannose receptor and F) Fizz-1 (ottom). GAPDH was analyzed for all samples. Primers are shown in supplementary tale 1. Levels of target product were normalized to GAPDH and are expressed as fold change relative to control cells not treated with either LPS or IL-4. Values are means ± standard error of the mean of N=3 one marrow derived macrophage preparations. Data was analyzed y two-way ANOVA using a Holme-Sidak post test. Different lower case letters indicate statistically significantly different values (P<0.05). Supplementary Figure vii: Rosuvastatin treatment protects mouse peritoneal macrophages from apoptosis. Thioglycollate-elicited peritoneal macrophages from wild type mice (n=3) were cultured on chamer slides in DMEM containing 3 % neworn calf lipoprotein deficient serum and treated for 24 hrs with either no additions, or with 1 μm thapsigargin without or with 20 μm rosuvastatin. Apoptosis was detected y FITC-Annexin V staining (green fluorescence-see arrows). DAPI was used to counter stain nuclei. A-C) Show representative images. Arrows indicate Annexin V + cells. D) The proportion of Annexin V + cells is plotted as averages ± S.E.M. of cells from N=3 mice. Data was analyzed y oneway ANOVA with the Tukey s multiple comparisons test. *** : P=0.0003; **: P=

6 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary References 1. Sanson M, Distel E, Fisher EA. Hdl induces the expression of the m2 macrophage markers arginase 1 and fizz-1 in a stat6-dependent process. PloS one. 2013;8:e Li AC, Binder CJ, Gutierrez A, Brown KK, Plotkin CR, Pattison JW, Valledor AF, Davis RA, Willson TM, Witztum JL, Palinski W, Glass CK. Differential inhiition of macrophage foamcell formation and atherosclerosis in mice y pparalpha, eta/delta, and gamma. The Journal of clinical investigation. 2004;114: Stein M, Keshav S, Harris N, Gordon S. Interleukin 4 potently enhances murine macrophage mannose receptor activity: A marker of alternative immunologic macrophage activation. The Journal of experimental medicine. 1992;176: Trogan E, Choudhury RP, Dansky HM, Rong JX, Breslow JL, Fisher EA. Laser capture microdissection analysis of gene expression in macrophages from atherosclerotic lesions of apolipoprotein e-deficient mice. Proceedings of the National Academy of Sciences of the United States of America. 2002;99: Ai D, Chen C, Han S, Ganda A, Murphy AJ, Haeusler R, Thorp E, Accili D, Horton JD, Tall AR. Regulation of hepatic ldl receptors y mtorc1 and pcsk9 in mice. The Journal of clinical investigation. 2012;122:

7 Supplementary figure i LRP-1 and apob48r levels in livers of rosuvastatin and control treated mice A Rosuvastatin - + B NS LRP1 ε - COP 85 kda 35 kda C Rosuvastatin - + D Control Rosuvastatin NS ApoB48R ε - COP 250 kda 35 kda Control Rosuvastatin 7

8 Supplementary figure ii Scatter plots of atherosclerosis in aortic sinuses and coronary arteries from rosuvastatin and control treated SR-B1 -/- apoe -/- mice A: Aortic Sinus Atherosclerosis B: Coronary Artery Atherosclerosis 8

9 Supplementary figure iii Flow cytometry analysis of platelets apoe -/- SR-B1 -/- apoe -/- Control Control SR-B1 -/- apoe -/- Rosuvastatin 9

10 Supplementary figure iv Platelet CD36 levels Anti-CD36 (m edian fluorescence aritrary units) ro l NS C C R ro l tin sko dko 10

11 Supplementary figure v Flow cytometry analysis of leukocytes A B C 11

12 Supplementary figure vi Polarization of one marrow derived macrophages Macrophage M1 Polarization A B C a a Control Rosuvastatin Control Rosuvastatin No LPS LPS a a Control Rosuvastatin Control Rosuvastatin No LPS LPS a a Control Rosuvastatin Control Rosuvastatin No LPS LPS Macrophage M2 Polarization D E F a a a a a a Control Rosuvastatin Control Rosuvastatin No IL-4 IL-4 Control Rosuvastatin Control Rosuvastatin No IL-4 IL-4 Control Rosuvastatin Control Rosuvastatin No IL-4 IL-4 12

13 Supplementary figure vii Protection of macrophages against apoptosis B -Thapsigargin C +Thapsigargin -Rosuvastatin -Rosuvastatin A +Rosuvastatin B C c e lls + A n n e x in V (p r o p o r tio n o f to ta l) 0.4 D *** ** μm Rosuvastatin 1 μm Thapsigargin

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Time after injection (hours) ns ns

Time after injection (hours) ns ns Platelet life span (% iotinylated platelets) 1 8 6 4 2 4 24 48 72 96 Time after injection (hours) 6 4 2 IgG GPIα GPIβ GPII GPVI Receptor expression (GeoMean, fluorescence inteity) Supplementary figure

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

Supplemental Table I.

Supplemental Table I. Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

More information

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Detailed step-by-step operating procedures for NK cell and CTL degranulation assays

Detailed step-by-step operating procedures for NK cell and CTL degranulation assays Supplemental methods Detailed step-by-step operating procedures for NK cell and CTL degranulation assays Materials PBMC isolated from patients, relatives and healthy donors as control K562 cells (ATCC,

More information

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.

More information

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)

More information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplemental information

Supplemental information Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental

More information

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu

More information

Supplementary material page 1/10

Supplementary material page 1/10 Supplementary Figure 1. Metoprolol administration during ongoing AMI reduces MVO in STEMI patients (a, b) Complete representative CMR exams (short-axis covering the entire left ventricle (LV) from base

More information

Supplemental information

Supplemental information Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman

More information

Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads

Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads Representative example of comparative ex vivo tetramer enrichment performed in three independent experiments with either conventional

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Supplementary Figures

Supplementary Figures Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved 1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich

More information

In vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay

In vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the

More information

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained 1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every

More information

SUPPORTING INFORMATIONS

SUPPORTING INFORMATIONS SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1175194/dc1 Supporting Online Material for A Vital Role for Interleukin-21 in the Control of a Chronic Viral Infection John S. Yi, Ming Du, Allan J. Zajac* *To whom

More information

Supplementary Table 1

Supplementary Table 1 Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Supporting Information

Supporting Information Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution Immunity, Volume 9 Supplemental Information Regulatory T Cells Promote Macrophage Efferocytosis during Inflammation Resolution Jonathan D. Proto, Amanda C. Doran, Galina Gusarova, Arif Yurdagul Jr., Erdi

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. 1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,

More information

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g) Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number

More information

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ

Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Research article Related Commentary, page 1538 Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Andrew C. Li, 1 Christoph J. Binder, 2 Alejandra

More information

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/381/ra59/dc1 Supplementary Materials for Analysis of single-cell cytokine secretion reveals a role for paracrine signaling in coordinating macrophage responses

More information

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C CD3-specific antibody-induced immune tolerance and suppression of autoimmune encephalomyelitis involves TGF-β production through phagocytes digesting apoptotic T cells Sylvain Perruche 1,3, Pin Zhang 1,

More information

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured

More information

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression a b c DAPI YFP CC3 DAPI YFP PCNA DAPI YFP ph3 DAPI YFP KI67 e 6 Mitosis f 1 PCNA expression %ph3 + /YFP + n= 63 87 61 3 13 8 n= 15 3 9 1 5 %PCNA+/YFP+ 8 6 Supplementary Figure 1. Proliferation/apoptosis

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate

More information

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining

More information

Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2*

Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2* Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2* 1 Department of Laboratory Medicine - Laboratory of Hematology, Radboud University

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

Supplementary Table e-1. Flow cytometry reagents and staining combinations

Supplementary Table e-1. Flow cytometry reagents and staining combinations Supplementary data Supplementary Table e-1. Flow cytometry reagents and staining combinations Reagents Antibody Fluorochrome Clone Source conjugation CD3 FITC UCHT1 BD Biosciences CD3 PerCP-Cy5.5 SK7 Biolegend

More information

SUPPLEMENTAL MATERIAL. Number of patients 14

SUPPLEMENTAL MATERIAL. Number of patients 14 SUPPLEMENTAL MATERIAL Supplemental Table 1 Number of patients 14 Age, years 54.9 ± 10.0 Female gender, n (%) 6 (42.9) Diabetes, n (%) 2 (14.3) History of hypertension, n (%) 5 (35.7) Ever smoker, n (%)

More information

Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation

Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation Supplementary material; Title; Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation Authors; Petra Wäster 1, Ida Eriksson 1, Linda Vainikka 1, Inger Rosdahl 2,

More information

BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented

BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented Supplemental Materials Figure S1. Cultured BMDCs express CD11c BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented with 15 ng/ml GM-CSF. Media was changed and fresh

More information

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of

More information

LDL Uptake Flow Cytometry Assay Kit

LDL Uptake Flow Cytometry Assay Kit LDL Uptake Flow Cytometry Assay Kit Item No. 601470 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

Hidenobu Kanda, Rebecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen

Hidenobu Kanda, Rebecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen Autotaxin, a lysophosphatidic acid-producing ectoenzyme, promotes lymphocyte entry into secondary lymphoid organs Hidenou Kanda, Reecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 43 Figure S1. CD123 in acute lymphoblastic leukemia and leukemia-initiating cells. A. CD123 (histograms) is highly and homogenously expressed in B-ALL blasts (as defined by live,

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 + F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

LDL Uptake Cell-Based Assay Kit

LDL Uptake Cell-Based Assay Kit LDL Uptake Cell-Based Assay Kit Catalog Number KA1327 100 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.

Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis. Supplementary Figure 1 Examples of staining for each antibody used for the mass cytometry analysis. To illustrate the functionality of each antibody probe, representative plots illustrating the expected

More information

Supplementary Figure 1 (Mu)

Supplementary Figure 1 (Mu) Supplementary Figure 1 (Mu) SBP (mmhg) 2 18 16 p

More information

Pearson r = P (one-tailed) = n = 9

Pearson r = P (one-tailed) = n = 9 8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Supplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on

Supplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on Online supplementary information Supplementary Figure S1. TRAIL-induced necroptos at acidic phe is dependent on RIPK1 and RIPK3. (a) HT29 cells were tranently transfected with RIPK1, RIPK3, RIPK1/ RIPK3

More information

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition

More information

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

Supplementary table I. Real-time primers used in the study. The fold change was obtained by Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.

More information

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,

More information

Online supplement. Phenotypic, functional and plasticity features of classical and alternatively activated

Online supplement. Phenotypic, functional and plasticity features of classical and alternatively activated Online supplement Phenotypic, functional and plasticity features of classical and alternatively activated human macrophages Abdullah Al Tarique*, Jayden Logan *, Emma Thomas *, Patrick G Holt *, Peter

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

The Annexin V Apoptosis Assay

The Annexin V Apoptosis Assay The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.

More information

Supporting Information

Supporting Information Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or

More information