The endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages

Transcription

1 The endoplsmic reticulum is the site of cholesterol-induced cytotoxicity in mcrophges Bo Feng 1, Pin Mei Yo 1, Ynkun Li 1, Cecili M. Devlin 1, Djun Zhng 1, Hether P. Hrding 2, Michele Sweeney 3, Jmes X. Rong 4, George Kurikose 1, Edwrd A. Fisher 4, Andrew R. Mrks 3, Dvid Ron 2 nd Ir Ts 1,5 Excess cellulr cholesterol induces poptosis in mcrophges, n event likely to promote progression of therosclerosis. The cellulr mechnism of cholesterol-induced poptosis is unknown ut hd previously een thought to involve the plsm memrne. Here we report tht the unfolded protein response (UPR) in the endoplsmic reticulum is ctivted in cholesterolloded mcrophges, resulting in expression of the cell deth effector CHOP. Cholesterol loding depletes endoplsmic reticulum clcium stores, n event known to induce the UPR. Furthermore, endoplsmic reticulum clcium depletion, the UPR, cspse-3 ctivtion nd poptosis re mrkedly inhiited y selective inhiition of cholesterol trfficking to the endoplsmic reticulum, nd Chop / mcrophges re protected from cholesterol-induced poptosis. We propose tht cholesterol trfficking to endoplsmic reticulum memrnes, resulting in ctivtion of the CHOP rm of the UPR, is the key signlling step in cholesterolinduced poptosis in mcrophges. Mcrophges ccumulte free cholesterol in dvnced therosclerotic lesions, resulting in mcrophge poptosis nd progression of lesions 18. Previous studies with cultured mcrophges hve elucidted downstrem poptotic events induced y free cholesterol loding 811. However, the proximl free-cholesterol-induced events tht trigger poptosis hve not yet een identified. It ws shown recently tht freecholesterol-induced mcrophge deth could e locked y micromolr concentrtions of certin mphipthic mines tht re known to interfere with cholesterol trfficking from lte endosomes to other cellulr sites, prticulrly the plsm memrne 9,12. On the sis of these oservtions nd previous in vitro dt showing tht plsm memrne proteins function poorly in free-cholesterol-enriched memrnes 13, it ws proposed tht deth of free-cholesterol-loded mcrophges ws triggered y norml enrichment of the plsm memrne with free cholesterol 12. Cholesterol derived from endocytosed lipoproteins is lso trfficked from lte endosomes to other cellulr sites, such s the endoplsmic reticulum. Becuse the cholesterol content of endoplsmic reticulum memrnes is prticulrly low 14, the function of this orgnelle is likely to e prticulrly sensitive to norml enrichment with free cholesterol. Perturtions of endoplsmic reticulum function from mny cuses ctivte signlling pthwy referred to s the UPR 15, resulting in trnscriptionl ctivtion of genes whose products promote the cpcity of the endoplsmic reticulum to process client proteins, synthesize phospholipids nd re-esterify sterols 16. These lst two responses my e involved in reducing the urden of free cholesterol ccumultion in the endoplsmic reticulum nd other cell memrnes 17.However,the UPR lso ctivtes signlling pthwys tht promote progrmmed cell deth, including ctivtion of specific cspse 18, Jun N-terminl stress-ctivted protein kinses 19,2, nd the trnscription fctor CHOP 21,22. These oservtions suggested tht free cholesterol loding of endoplsmic reticulum memrnes might contriute to mcrophge poptosis. In this study we used genetic nd phrmcologicl tools tht selectively pertur cholesterol trfficking from lte endosomes to specific cellulr sites, llowing us to explore further the sis of free-cholesterolinduced poptosis in mcrophges. Our findings implicte endoplsmic-reticulum-sed signls in the deth of free-cholesterol-loded mcrophges nd thus provide new insight into the reltionship etween cholesterol homeostsis in the endoplsmic reticulum memrne nd endoplsmic reticulum function. Moreover, the dt suggest novel cellulr mechnism for cholesterol-induced mcrophge deth in dvnced therosclerotic lesions. RESULTS The plsm memrne is not the site of cholesterol-induced poptosis In mcrophges tht hve ingested lipoprotein prticles, micromolr concentrtions of the mphipthic mine U18666A inhiit multiple pthwys of cholesterol trfficking from lte endosomes 23.However, when used t nnomolr concentrtions, U18666A selectively interferes with cholesterol trfficking to the endoplsmic reticulum without sustntively ffecting the trnsfer of cholesterol to the 1 Deprtments of Medicine nd Cell Biology, Columi University, New York, NY 132, USA. 2 Skirll Institute, New York University School of Medicine, New York, NY 116, USA. 3 Deprtment of Physiology nd Cellulr Biophysics, Center for Moleculr Crdiology, Columi University, New York, NY 132, USA. 4 Deprtment of Medicine nd The Zen nd Michel A. Wiener Crdiovsculr Institute, Mount Sini School of Medicine, New York, NY 129, USA. 5 Correspondence should e ddressed to I.T. (e-mil: it1@columi.edu). Pulished online: 1 August 23; DOI: 1.138/nc135 NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER

2 Cholesterol esterifiction ( 3 H-CE cpm per µg cell protein) U18666A Cholesterol or cholestenone (µg per mg cell protein) Chol CN untreted U18666A c d (1) (2) 5835 (3) U18666A 5835 (4) 5835 U18666A (5) Percentge cell deth Androstenediol 5835 ndrostenediol Figure 1 Free-cholesterol-induced poptosis in mcrophges is locked y low dose of U18666A. () Esterifiction of 3 H-cholesterol ( mesure of cholesterol trfficking to endoplsmic reticulum memrnes) in cultured mouse peritonel mcrophges incuted for 5 h with medium contining 5 µg ml 13 H-cholesterol-lelled cetyl-ldl in the sence or presence of 7 nm U18666A. Results re the men ± s.e.m. (n = 3) of 3 H-cholesteryl ester formed (in cpm per µg cell protein). () Accessiility of cellulr cholesterol to cholesterol oxidse ( mesure of plsm memrne cholesterol) in fixed mcrophges fter incution for 4 h with medium lone or medium contining 5 µg ml 1 cetyl-ldl in the sence or presence of 1 µg ml or 7 nm U18666A. The mss (in µg per mg cell protein) of cholesterol (Chol, open rs), which is the cholesteroloxidse-inccessile pool of intrcellulr cholesterol, nd of cholestenone (CN, solid rs), which is the cholesterol-oxidse-ccessile pool of plsm memrne cholesterol re shown. (c) Alex-488nnexin V stining (green) nd PI stining (red-ornge) to ssess deth of mcrophges incuted for 8 h under the sme conditions s in, with the inclusion of two dditionl controls, cetyl-ldl lone nd 5835 lone. Representtive fluorescence imges nd quntittive cell deth dt from five fields of cells for ech condition re shown, expressed s the percentge of totl cells tht stined with nnexin V or PI (men ± s.e.m.; n = 5 fields of cells, where ech field contined pproximtely 2 cells). Numers under ech r refer to the five conditions depicted in the imges. Scle r represents 1 µm for ech of the five imges. (d) Alex-488nnexin V nd PI stining of mcrophges incuted for 16 h under the indicted conditions. Scle r represents 1 µm for ech of the four imges. plsm memrne 23. Here, we confirm these oservtions in mouse peritonel mcrophges y showing tht tretment with nnomolr concentrtions of U18666A reduced re-esterifiction of ingested cholesterol (n event tht occurs in the endoplsmic reticulum) y 9% (Fig. 1), ut hd no effect on ccumultion of cholesterol in the plsm memrne. Effects t the plsm memrne were ssyed y nlysing ccessiility of plsm memrne cholesterol to exogenous cholesterol oxidse in lipoprotein-loded, gluterldehyde-fixed cells (Fig. 1) nd y extrctility of cholesterol y methyl-β-cd t 4 C (dt not shown). U18666A lone hs no direct inhiitory effect on the cyl- CoA:cholesterol cyltrnsferse (ACAT) enzyme 23. Thus, low-dose U18666A provides useful tool to selectively exmine the role of cholesterol trfficking to the endoplsmic reticulum in mcrophge poptosis. High concentrtions of U18666A tht completely inhiit cholesterol trfficking were previously shown to lock mcrophge deth induced y cholesterol loding 12. Therefore, we tested whether low dose of U18666A, which selectively impir trfficking to the endoplsmic reticulum memrne, lso protect mcrophges from poptosis. Free cholesterol ccumultion (loding) ws effected y incuting mcrophges with cetyl-low-density lipoprotein (cetyl- LDL) in the presence of the ACAT inhiitor 5835, which inhiits cholesterol re-esterifiction nd thus prevents the conversion of the ingested cholesterol into cholesteryl ester 8,24. Free cholesterol loding ws toxic to mcrophges, resulting in poptosis (Fig. 1c), s predicted from previous nlysis with TUNEL nd cspse ssys 1. However, even t low dose tht selectively impirs cholesterol trfficking to the endoplsmic reticulum, U18666A tretment protected mcrophges from free-cholesterol-induced poptosis (Fig. 1c). 782 NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER 23

3 Sturosporine Percentge cell deth Npc1 / Npc1 / Npc1 / Npc1 / c Cholesterol or cholestenone (µg per mg cell protein) Chol CN 5835 CD-Chol CD-Chol Percentge cell deth CD-Chol 5835 Figure 2 The endoplsmic reticulum, not the plsm memrne, is the site of cholesterol-induced poptosis. () Quntifiction of nnexin V nd PI stining of mcrophges from wild-type or Npc1 / mice incuted for 8.5 h with medium lone, medium contining 5 µg ml 1 cetyl-ldl nd 1 µg ml , or medium contining 5 nm sturosporine. The percentge of totl cells stined with nnexin V or PI (men ± s.e.m.; n = 5 fields of cells, where ech field contined pproximtely 2 cells) re shown. () Altertion in the mss of the cholesterol-oxidse-ccessile pool of plsm memrne cholesterol fter 4-h incution of mcrophges with medium lone, medium contining 25 µg ml 1 cetyl- LDL nd 1 µm 5835, or medium contining 5 mm methyl-βcyclodextrin:cholesterol (5:1 mss rtio) nd 1 µm 5835 (CD-Chol). Dt re displyed s in Fig. 1. (c) Alex-488nnexin V nd PI stining of mcrophges incuted for 8.5 h in the sence or presence of CDcholesterol, using the medium descried in. Representtive fluorescence imges (left) nd quntittive dt (right) re shown (men ± s.e.m.; n = 5 fields of cells, where ech field contined pproximtely 2 cells). Scle r represents 1 µm. U18666A tretment filed to protect mcrophges from poptosis induced y the phosphtse inhiitor, sturosporine, ttesting to the specificity of its protective effect (dt not shown). Moreover, ndrostenediol, structurlly relted homologue of U18666A tht does not lock cholesterol trfficking to the endoplsmic reticulum in mouse peritonel mcrophges 25, did not lock free-cholesterolinduced cell deth, even t concentrtions greter thn 1 µm (Fig. 1d). NPC1 is importnt for the intrcellulr trfficking of cholesterol 26. Previously, we noted tht peritonel mcrophges derived from Npc1 / mice hve cholesterol trfficking defect tht closely mimics tht of cells treted with low-dose U18666A 27. Therefore, we compred free-cholesterol-induced deth in mcrophges from Npc1 / nd Npc1 / mice. Similrly to mcrophges treted with low dose of U18666A, Npc1 / mcrophges were mrkedly protected from freecholesterol-induced deth, ut not from other inducers of mcrophge poptosis (Fig. 2). These dt re consistent with role for cholesterol trfficking to the endoplsmic reticulum, rther thn to the plsm memrne, in freecholesterol-induced poptosis. To test this model further, we directly loded the plsm memrne of mcrophges with excess free cholesterol y incuting cells with cholesterol-sturted cyclodextrin (CD, cyclic oligoscchride tht soluilizes free cholesterol) in the presence of CD-cholesterol, which ypsses the endocytic route used y lipoproteins, trnsfers free cholesterol directly to the plsm memrne ut inefficiently to the endoplsmic reticulum 283. CD-cholesterol incresed plsm memrne free cholesterol levels to tht found in mcrophges incuted with cetyl-ldl nd 5835 (Fig. 2). However, cell deth ws significntly reduced in cells incuted with CD-cholesterol, compred with cells loded through the endocytic lipoprotein pthwy (Fig. 2c). These dt suggest tht the ccumultion of excess free cholesterol in the plsm memrne is not sufficient to induce poptosis in free-cholesterol-loded mcrophges, further highlighting the importnce of the endoplsmic reticulum in this process. Cholesterol loding of mcrophges ctivtes the UPR As shown ove, the protective effects of low-dose U18666A nd the Npc1 / muttion re ssocited with inhiition of cholesterol trfficking to the endoplsmic reticulum. Becuse endoplsmic reticulum memrnes normlly contin low levels of cholesterol 14, we sought to determine if excess trfficking of free cholesterol to the endoplsmic reticulum would pertur orgnelle function. To this end, we monitored UPR ctivity in free-cholesterol-loded mcrophges under conditions tht were permissive or non-permissive for cholesterol trfficking to NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER

4 U18666A (7 nm) Tunicmycin (2.5 µg ml 1 ) A23178 (2 µg ml 1 ) 5835 (1 µg ml 1 ) (1 µg ml 1 ) U18666A (7 nm) A23178 (2 µg ml 1 ) 5835 (1 µg ml 1 ) (1 µg ml 1 ) CHOP PERK PERK β-ctin ATF-4 Androstenediol (3.3 µm) 5835 (1µg ml 1 ) (1µg ml 1 ) CHOP CHOP Lmin B Lmin B c h 3 h 5 h (1 µg ml 1 ) 5835 (1 µg ml 1 ) P-PERK PERK d U18666A (7 nm) A23178 (2 µg ml 1 ) 5835 (1 µg ml 1 ) (1 µg ml 1 ) ATF-4 P-IRE1α IRE1α CHOP XBP-1 e Npc1 / Npc1 / U18666A (7 nm) A23178 (2 µg ml 1 ) 5835 (1 µg ml 1 ) (1 µg ml 1 ) ATF-4 CHOP XBP-1 Lmin B Figure 3 Free cholesterol loding of mcrophges ctivtes the UPR. () CHOP nd β-ctin immunolots of whole-cell mcrophge extrcts incuted under control or free cholesterol loding conditions. Mcrophges were incuted for 5 h in medium contining regents nd cetyl-ldl lone or cetyl-ldl nd 5835 efore immunolotting for CHOP. Lmin B ws used s loding control. (, c) PERK, ATF-4, CHOP nd lmin B immunolots of nuclei-free or nucler extrcts of mcrophges incuted under control or free cholesterol loding conditions. In, mcrophges were treted for 5 h in medium contining regents, s indicted. For detection of PERK, nuclei-free cell extrcts were immunoprecipitted with nti-perk ntiserum nd then immunolotted. For detection of ATF-4 nd CHOP, immunolots were performed on nucler extrcts. Lmin B ws used s loding control. In c, mcrophges were either extrcted efore the incution period or incuted for 3 or 5 h with medium contining regents, s indicted. Smples were then immunolotted for PERK, ATF-4 nd CHOP, s in. (d) IRE1α nd XBP-1 immunolots of nuclei-free or nucler extrcts, respectively, of mcrophges incuted under the sme control or free cholesterol loding conditions s in. (e) ATF-4, CHOP, XBP- 1 nd lmin B immunolots of mcrophges from Npc1 / or Npc1 / mice incuted under the sme conditions s in nd d. 784 NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER 23

5 print NCB135 14/8/3 12:39 pm Pge 785 ARTICLES Sense Anti-sense Lumen Intim 14. Intim Lumen Anti-sense Rtio Chop:CypA 1.5 Sense Lumen Lumen Intim Intim. Lesionl Peritonel c Hoechst Anti-CHOP d Anti-CHOP Intim Anti-CD68 Lumen Pre-sored nti-chop Hoechst Lumen Filipin (FC) Intim Figure 4 CHOP is expressed in the therosclerotic lesions of Apoe / mice. () Chop in-situ histohyridiztion of proximl ortic therosclerotic lesion sections from Apoe / mice fed the Western-type diet for 13 weeks. Representtive imges using the nti-sense Chop proe (drk lue) re shown in the two left pnels, wheres djcent sections stined with the control, sense proe, re shown in the two right pnels. Sections were counter-stined with Fst Red (reddish rown) to show the nuclei of the lesionl cells. Scle r represents 2 µm for ech of the four imges. () Quntittive Chop RTPCR of RNA from lesionl mcrophges (using lser cpture microdissection) nd from resident peritonel mcrophges (using mice similr to those shown in ). Results re the men ± s.e.m. (n = 3 Tqmn repets of the RNA smples) of the Chop:CypA (stndrd) rtio. (c) Anti-CHOP nd Hoechst (nucler) doule-immunofluorescence microscopy nlysis, showing sections of proximl ortic lesion from mouse similr to tht shown in. The top left nd right pnels show representtive section of the CHOP (red) nd nucler (lue) signls, respectively. The ottom left pnel shows the CHOP signl fter sorption of the ntiody with its cognte peptide. The ottom right pnel shows nucler stining of this section. Scle r represents 1 µm for ech of the four imges. (d) Anti-CHOP, nti-cd68 (mcrophges) nd filipin (free cholesterol) stining of three sections of proximl ortic lesion from mouse similr to tht shown in. Scle r represents 1 µm for ech of the four imges. NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER Nture Pulishing Group 23 Nture Pulishing Group 785

6 34/38-nm fluorescence rtio Increment in fluorescence rtio: sl-to-pek TG C 2 -free Time (s) 5835 U18666A U18666A U18666A 5835 U18666A Figure 5 Free cholesterol loding depletes endoplsmic reticulum clcium stores. () Assessment of endoplsmic reticulum clcium stores in mcrophges incuted for 2.5 h with medium lone (untreted); 7 nm U18666A; 1 µg ml 1 cetyl-ldl nd 1 µg ml ; or cetyl-ldl, 5835 nd 7 nm U18666A. Representtive trcings of the 34:38-nm Fur-2 fluorescence rtio in n individul mcrophge from ech tretment group efore nd fter ddition of 1 µm thpsigrgin re shown. () Plot of sl-to-pek Fur-2 fluorescence rtio fter ddition of thpsigrgin in individul cells in ech tretment group, with the men increment denoted y the red line. endoplsmic reticulum memrnes. Signlling in the UPR is initited y endoplsmic-reticulum-loclized trnsmemrne protein kinses tht ecome phosphorylted under conditions of impired orgnelle function 15. These kinses, in turn, ctivte downstrem trnscription fctors tht induce genes involved in restoring endoplsmic reticulum function nd, when stress is severe, induce progrmmed cell deth 15. The downstrem trnscription fctor CHOP (lso known s GADD153) is mrker for UPR ctivtion 31. We found tht induction of CHOP in free-cholesterol-loded mcrophges ws comprle in mgnitude with the induction elicited y tunicmycin or A23187, which ctivte the UPR y locking N-linked glycosyltion or endoplsmic reticulum clcium depletion, respectively (Fig. 3). Blocking cholesterol trffic to endoplsmic reticulum memrnes with low-dose U18666A locked induction of CHOP in free-cholesterol-loded mcrophges (Fig. 3, top, lne 5). As control for the effects of U18666A, we demonstrted tht ndrostenediol did not lock induction of CHOP y free cholesterol (Fig. 3, ottom). Importntly, U18666A did not lock induction of CHOP y A23187 (Fig. 3, top, lne 6), indicting tht U18666A is neither direct inhiitor of CHOP expression nor generl inhiitor of the UPR. Induction of CHOP in the UPR is dependent on ctivtion of the endoplsmic-reticulum-resident protein kinse, PERK, which induces the upstrem trnscription fctor ATF-4 (ref. 32). PERK is specificlly ctivted y impired protein folding in the endoplsmic reticulum lumen, common outcome of mny perturtions of orgnelle function 33. PERK is ctivted y trns-utophosphoryltion, which is detected s shift in the protein s moility on immunolots 33,34. Most of the PERK extrcted from mcrophges migrted s fster-moility, inctive, dephosphorylted form (Fig. 3, lne 1). Cholesterol loding resulted in mrked increse in the slower-moility, ctive phosphorylted from of PERK, wheres low-dose U18666A, which locks free cholesterol trfficking to the endoplsmic reticulum, locked PERK ctivtion in free-cholesterol-loded mcrophges (Fig. 3, lnes 4 nd 5). As predicted, the chnges in PERK ctivtion were reflected in the susequent expression of its downstrem effectors ATF-4 nd CHOP, detected y immunolotting nucler extrcts from the sme cells (Fig. 3, c). Note tht exposure to the ACAT inhiitor 5835 lone or incution with cetyl-ldl lone ws sufficient to prtilly ctivte PERK (Fig. 3, lnes 2 nd 3). These oservtions suggest tht endoplsmic reticulum function my e pertured y even smll increses in cellulr free cholesterol. To confirm the link etween free cholesterol loding nd the UPR, we exmined the ctivity of second independent signlling pthwy ctive in the UPR. Similrly to PERK, IRE1 is n endoplsmic reticulum trnsmemrne protein kinse whose ctivity is controlled y trns-utophosphoryltion 15, s reflected y shift in moility on immunolots. In mmmlin cells, endoplsmic reticulum stressmedited IRE1 ctivtion is solutely required for expression of the ctive form of XBP-1, trnscription fctor which functions s n effector for IRE1. Unlike CHOP, whose expression cn e induced y other stress signls 35, XBP-1 is highly specific to the UPR 36,37. Free cholesterol loding ctivted IRE1α (the isoform of IRE1 expressed in mcrophges) nd promoted XBP-1 expression (Fig. 3d, lne 4). Lowdose U18666A mrkedly ttenuted oth events (Fig. 3d, lne 5). To exmine further the importnce of intrcellulr cholesterol trfficking in UPR ctivtion, we compred the induction of ATF-4, CHOP nd XBP-1 in Npc1 / nd Npc1 / mcrophges. As noted ove, the Npc1 / muttion locks cholesterol trfficking to the endoplsmic reticulum 27 nd locks free-cholesterol-induced poptosis (Fig. 1e). As shown in Fig. 3e, the expression of ll three UPR proteins ws mrkedly decresed in free-cholesterol-loded Npc1 /, compred with Npc1 / mcrophges. As control, we showed tht induction of these three UPR proteins y A23187 ws not locked y the Npc1 / muttion. In summry, these results estlish tht free cholesterol loding of mcrophges ctivtes the UPR nd tht mnipultions which lock cholesterol trfficking to endoplsmic reticulum memrnes prevent this ctivtion. Free-cholesterol-induced mcrophge deth is thought to e n importnt event in the progression of therosclerotic lesions. To determine if dvnced therosclerosis is ssocited with ctivtion of the UPR, we studied the therosclerotic lesions of ft-fed Apoe / mice. As Apoe / mice lck polipoprotein E, they hve high plsm cholesterol levels nd thus develop dvnced therosclerosis 38. CHOP expression ws ssessed y in-situ histohyridiztion nd immunohistochemistry nd found to e mrkedly elevted in proximl ortic lesions from Apoe / mice 786 NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER 23

7 Perk / 1 h Perk / Control 5 4 Control U18666A 5835 Percentge of cell deth U18666A Perk / Perk / Figure 6 Disruption of the PERK enhnces cholesterol-induced poptosis. (, ) Alex-488nnexin V (green) nd PI stining (red-ornge) of mcrophges from wild-type or Perk / mice incuted for 1 h with medium contining 1 µg ml 1 cetyl-ldl lone; 1 µg ml 1 cetyl-ldl nd 1 µg ml ; or cetyl-ldl, 5835 nd 7 nm U18666A. Representtive fluorescence imges re shown in. Quntittive poptosis dt from five fields of cells for ech condition re shown in, expressed s the percentge of totl cells stined with nnexin V or PI (men ± s.e.m.; n = 5 fields of cells, where ech field contined 2 cells). Scle r represents 1 µm for ech of the six imges in. (Fig. 4). The nti-sense signl in the histohyridiztion (lue) ppered to e scttered throughout the intim, eing concentrted in res tht contined cells (mrked y the reddish rown-stined nuclei). Stining ws sent from lesions hyridized with sense proe. Chop expression ws lso ssessed y quntittive RTPCR: we exmined RNA otined y lser-cpture microdissection of mcrophges from dvnced therosclerotic lesions nd peritonel mcrophges from the sme mice. Lesionl mcrophges expressed much higher level of Chop mrna (stndrdized with CypA mrna) thn peritonel mcrophges (Fig. 4). CHOP immunostining ws widespred throughout the intim nd correlted with Hoechst-3358-stined nuclei (Fig. 4c), consistent with previous locliztion of CHOP to the nucleus 21. Pre-sorption of the ntiserum with its cognte peptide olished the signl (Fig 4c) nd similrly, lesions stined with secondry ntiody lone showed no signl (dt not shown). Moreover, mny of the CHOPexpressing cells in therosclerotic lesions re in mcrophge-rich (CD68- positive) nd free-cholesterol-rich (filipin-positive) res of lesions (Fig 4d). These oservtions demonstrte tht CHOP is expressed in vivo under conditions of pertured cellulr cholesterol metolism. Endoplsmic reticulum clcium stores re depleted y free cholesterol loding The incresed free cholesterol content of endoplsmic reticulum memrnes could pertur endoplsmic reticulum function t multiple levels. One possiility includes disturnce of clcium homeostsis, which depends on clcium pump nd clcium relese chnnels emedded in the endoplsmic reticulum memrne, ecuse depletion of endoplsmic reticulum clcium stores is potent inducer of the UPR 39.For exmple, tretment with thpsigrgin, n inhiitor of the endoplsmic reticulum clcium pump, or A23187, clcium ionophore, resulted in dysfunction of clcium-dependent endoplsmic reticulum chperones nd induced the UPR 39. Therefore, we compred endoplsmic reticulum clcium pools in mcrophges loded with free cholesterol in the presence or sence of low-dose U18666A. Cells exposed to U18666A lone or culture medi with no dditives were used s further controls. After perturing cellulr cholesterol metolism, cells were loded with the fluorescent clcium indictor, Fur-2, switched to clcium-free medium nd exposed to 1 µm thpsigrgin. Thpsigrgin tretment results in emptying of endoplsmic reticulum clcium stores into the cytosol, which ws quntified y fluorescence microscopy, providing mesure of relesle endoplsmic reticulum clcium stores t the time of thpsigrgin ddition. Representtive trcings of the Fur-2 fluorescence rtio (34:38 nm) for individul mcrophges in ech experimentl group re shown in Fig. 5. The untreted mcrophge (lue line) displyed shrp rise in cytosolic clcium soon fter ddition of thpsigrgin, indicting n undnce of relesle, endoplsmic-reticulum-stored clcium. Similr results were otined using mcrophge incuted with U18666A lone (lck line). In contrst, the free-cholesterolloded mcrophge (green line) hd mrkedly reduced response, indicting tht endoplsmic reticulum clcium stores were depleted. Mcrophges loded with free cholesterol for longer times showed no increse in cytosolic clcium fter thpsigrgin tretment (dt not shown), indicting tht endoplsmic reticulum clcium stores were severely depleted. Importntly, the mcrophge loded with free cholesterol in the presence of 7 nm U18666A (red line) showed similr rise in cytosolic clcium s the control mcrophges. Anlysis of the sl-to-pek increment in fluorescence rtio of multiple individul cells in ech group clerly demonstrtes tht free cholesterol loding is ssocited with sustntilly smller thpsigrgin-induced rise in cytosolic clcium, n effect which is completely prevented y tretment with 7 nm U18666A (Fig. 5). Becuse depletion of endoplsmic reticulum clcium stores cn ctivte cpcitive clcium entry, we NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER

8 Chop / 16 h Chop / c Control h Percent ctivted cspce 3-positive cells Control 5835 Control Chop / Chop / d Chop / Chop / ATF-4 XBP-1 Lmin B Percentge of cell deth Chop / Control 5835 Chop / Chop / Chop / Post-thpsigrgin rise in 34:38-nm rtio (seline to pek) e Chop / 5835 Chop / h 27 h Figure 7 Disruption of CHOP ttenutes free-cholesterol-induced poptosis in mcrophges. (, ) Alex-488nnexin V (green) nd PI stining (redornge) of mcrophges from wild-type or Chop / mice incuted for 16 h or 27 h with medium contining 1 µg ml 1 cetyl-ldl lone; or cetyl- LDL nd 1 µg ml Representtive fluorescence imges re shown in. Quntittive cell deth dt from five fields of cells for ech condition re shown in, expressed s the percentge of totl cells tht stined with nnexin V or PI (men ± s.e.m.; n = 5 fields of cells, where ech field contined pproximtely 2 cells). Scle rs represent 1 µm in. (c) Percentge of control nd free-cholesterol-loded Chop / nd Chop / mcrophges with ctivted cspse-3. (d) ATF-4, XBP-1, nd lmin B immunolots of mcrophges from Chop / or Chop / mice incuted under the sme conditions in Fig. 3 nd d. (e) Plot of sl-to-pek Fur-2 fluorescence rtio fter ddition of thpsigrgin, which is mesure of the level of endoplsmic reticulum clcium stores. Mesurements were mde in control nd free-cholesterol-loded mcrophges from Chop / or Chop / mice, with the men increment denoted y the horizontl line. Experimentl conditions were the sme s those in Fig NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER 23

9 determined the effect of lockers of this process on free-cholesterolinduced poptosis nd CHOP induction. Although SKF96365 could not e used ecuse of non-specific effects on cholesterol metolism, we showed tht neither.1 mm nickel chloride nor 1 µm cdmium succinte ffected poptosis or CHOP induction in free-cholesterolloded mcrophges. Thus, depletion of endoplsmic reticulum clcium stores is n erly event in free cholesterol loding tht is dependent on intrcellulr cholesterol trfficking to the endoplsmic reticulum. Given tht endoplsmic reticulum clcium depletion is known inducer of the UPR, this event most proly contriutes to free-cholesterol-induced UPR ctivtion. UPR signlling modultes free-cholesterol-induced poptosis in mcrophges UPR signlling is importnt in modulting the sensitivity of cells to deth induced y perturtions tht cuse endoplsmic reticulum stress. Cells lcking PERK re mrkedly hypersensitive to gents tht cuse endoplsmic reticulum stress 32. In ddition, nimls hrouring PERK muttions undergo rpid loss of specific secretory cell popultions tht re exposed to physiologiclly high levels of endoplsmic reticulum stress 4,41. In contrst, CHOP is n effector of cell deth induced y endoplsmic reticulum stress, s Chop / cells re prtilly protected from deth induced y gents nd conditions tht impir endoplsmic reticulum function 21,22,42. Therefore, the signl trnsduction pthwys downstrem of PERK hve protective effects tht predominte, ut lso include CHOP-dependent, deth-promoting rm tht cn e selectively inctivted y deletion of CHOP. If endoplsmic reticulum dysfunction is importnt in the deth of free-cholesterol-loded mcrophges, deletion of PERK should increse cell deth, wheres deletion of CHOP should protect ginst deth. Therefore, we compred the response to free cholesterol loding of mcrophges from wild-type, Chop / nd Perk / mice. Cell deth, s mesured y nnexin V nd propidium iodide (PI) stining, ws mrkedly incresed in free-cholesterol-loded Perk / mcrophges, compred with wild-type mcrophges (Fig. 6, ). Importntly, low dose of U18666A provided significnt protection to Perk / cells, suggesting tht free cholesterol trfficking to the endoplsmic reticulum is importnt for the deth of Perk / cells (Fig. 6, ). In contrst, the mjority of Chop / mcrophges were protected from cell deth induced y free cholesterol loding. Furthermore, this protection ws noted t oth erly (16 h) nd lte times (27 h), reltive to the wild-type cells (Fig. 7, ). The percentge of mcrophges contining ctivted cspse-3, which is criticl for free-cholesterolinduced poptosis 1, ws lso mrkedly decresed in the Chop / mcrophges (Fig. 7c). Neither the Perk nor the Chop muttions significntly ffected the mss of lipoprotein-free cholesterol ccumulted y the mcrophges (dt not shown). These dt estlish functionl role for the UPR in free-cholesterol-induced poptosis in mcrophges. Moreover, consistent with the notion tht the Chop / muttion locks free-cholesterol-induced mcrophge deth through distl UPR pthwy, nd not y inhiiting upstrem events, induction of XBP-1 nd ATF-4, s well s depletion of endoplsmic reticulum clcium stores, were similr in free-cholesterol-loded Chop / nd Chop / mcrophges (Fig. 7d, e). DISCUSSION Cells possess multiple mechnisms to prevent the ccumultion of excess free cholesterol, including ctivtion of ACAT-medited cholesterol esterifiction nd cellulr cholesterol efflux 8. When one or more of these mechnisms fil, s seems to occur in mcrophges in dvnced therosclerotic lesions, cell deth ensues. The intrcellulr ccumultion of lrge mounts of cholesteryl ester, s occurs in the mcrophge fom cells of erly therosclerotic lesions, does not induce cell deth. The fct tht cholesteryl esters re stored in reltively inert intrcellulr lipid vesicles, wheres free cholesterol is integrted into the lipid ilyers of cellulr memrnes, hs een proposed s possile clue to the toxic effects of the ltter. The purpose of this study ws to provide insight into the perturtions ffected y free cholesterol loding of mcrophges. We resoned tht elucidting the site of free cholesterol ccumultion might provide clue to the mechnism of free-cholesterolinduced toxicity. Although the direct mesurement of free cholesterol mss in iologicl memrnes is difficult, plsm memrne free cholesterol content cn e estimted y oth the cholesterol oxidse method 43 nd y vilility to cyclodextrin-medited efflux 44.In ddition, endoplsmic reticulum cholesterol cn e ssessed y esterifiction through ACAT 45. Using these methods, we showed tht oth low-dose U18666A nd the Npc1 / muttion, which inhiit free cholesterol trfficking to the endoplsmic reticulum ut not to the plsm memrne, lock mcrophge poptosis. Moreover, directly loding the plsm memrne with free cholesterol did not induce poptosis. Free cholesterol loding of mitochondri is lso unlikely to contriute to mcrophge deth, ecuse incution of mitochondri with excess cholesterol in vitro ctully stilizes mitochondril function (ref. 46; P.M.Y. nd I.T., unpulished oservtions). In contrst to the plsm memrne, the endoplsmic reticulum memrne is fluid nd low in cholesterol 14, nd is thus predicted to e prticulrly sensitive to the toxic effects of free cholesterol enrichment. Indeed, we find tht n endoplsmic-reticulum-sed stress pthwy is induced y free cholesterol loding. Together, these findings suggest tht the endoplsmic reticulum is mjor source of free-cholesterol-induced poptosis. We wondered how free cholesterol trfficking to endoplsmic reticulum memrnes might result in endoplsmic reticulum stress. Integrl memrne endoplsmic reticulum proteins tht re essentil to proper orgnelle function my e pertured y incresing the free cholesterol:phospholipid rtio of the normlly fluid endoplsmic reticulum memrne. In this report, we hve shown tht criticl endoplsmic reticulum memrne-protein-dependent function, nmely, mintennce of endoplsmic reticulum clcium homeostsis is pertured erly in the course of free cholesterol loding. The fct tht this effect required cholesterol trfficking to the endoplsmic reticulum memrne nd tht depletion of endoplsmic reticulum clcium stores y other gents induces the UPR suggests tht this event is t lest prt of the mechnism linking free cholesterol loding to UPR induction. It is lso possile tht free cholesterol loding of the endoplsmic reticulum memrne perturs other endoplsmic reticulum memrne-dependent ctivities, either s primry event or secondry to the erly depletion of endoplsmic reticulum clcium stores. Interestingly, modest levels of free cholesterol loding re sufficient to ctivte the PERK kinse in mcrophges (Fig. 3), suggesting tht the endoplsmic reticulum in these cells my normlly function close to its threshold for free cholesterol tolernce. An importnt finding in this report is tht UPR signlling hs profound effect on free-cholesterol-induced mcrophge poptosis. The fct tht Perk / mcrophges re mrkedly hypersensitive to free cholesterol loding indictes tht the ility to resist endoplsmic reticulum stress cn e limiting for the survivl of free-cholesterol-loded mcrophges. Alterntively, the finding tht the mjority of Chop / mcrophges re resistnt to free-cholesterol-induced cell deth nd cspse-3 ctivtion rgues tht pro-poptotic pthwy ctivted specificlly y the CHOP rm of the UPR is importnt for promoting poptosis under these circumstnces. Possile mechnisms include NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER

10 CHOP-induced decreses in Bcl-2 nd glutthione nd increses in rective oxygen species 42. Non-CHOP pthwys of poptosis my lso e involved, s pproximtely 3% of free-cholesterol-induced mcrophge deth occurs in the presence of the Chop / muttion. Nonetheless, the fct tht CHOP is expressed in mcrophge nd freecholesterol-rich res of therosclerotic lesions, tht dvnced lesionl mcrophges ccumulte free cholesterol nd tht mcrophge deth is ssocited with plque disruption suggest tht endoplsmic reticulum stress in lesionl mcrophges my e n importnt cellulr process in the progression of therosclerosis. Note dded in proof: in recent study, (Feng, B., et l. Niemnn-Pick C heterozygosity confers resistnce to lesionl necrosis nd mcrophge poptosis in murine therosclerosis. Proc. Ntl Acd. Sci. USA (in the press)), we demonstrte tht mcrophge poptosis nd lesionl necrosis re sustntilly decresed in the therosclerotic lesions of Apoe / mice on the Npc1 / ckground versus the Npc1 / ckground, thus providing in vivo evidence tht trfficking of cholesterol to the endoplsmic reticulum is importnt in lesionl mcrophge poptosis nd plque morphology. METHODS Mterils. Flcon tissue culture plstic ws purchsed from Fisher Scientific (Springfield, NJ). Tissue culture medi nd other tissue culture regents were otined from Invitrogen (Crlsd, CA). Foetl ovine serum (FBS) ws otined from Hyclone Lortories (Logn, UT) nd ws het-inctivted for 1 h t 65 C (HI-FBS). Compound 5835 (3-[decyldimethylsilyl]-N-[2-(4- methylphenyl)-1-phenylethyl]propnmide 47, n inhiitor of ACAT, ws generously provided y J. Heider, formerly of Sndoz (Est Hnover, NJ); 1 mg ml 1 stock solution ws prepred in dimethyl sulphoxide (DMSO), nd the finl DMSO concentrtion in oth treted nd control cells ws.5%. Cholesterol (>99% pure) ws otined from Nu-chek Prep. (Elysin, MN). U18666A (3-β [2-diethylminoethoxy]ndrost-5-en-17-one hydrochloride) ws from Biomol (Plymouth Meeting, PA). LDL (d, g ml 1 ) from fresh humn plsm ws isolted y preprtive ultrcentrifugtion. Acetyl-LDL ws prepred y rection with cetic nhydride 48. All other chemicls nd regents, including ndrostenediol, Streptomyces (Sigm, St Louis, MO) cholesterol oxidse, methyl-β-cyclodextrin, concnvlin A, A32187, thpsigrgin, tunicmycin nd the nti-β-ctin monoclonl ntiody were from Sigm, nd ll orgnic solvents were from Fisher Scientific. Methyl-β-CD ws sturted with cholesterol s previously descried 29. Anti-GADD153 (CHOP) ws from Snt Cruz Biotechnology (Snt Cruz, CA). Antiodies ginst XBP-1, ATF-4, PERK nd IRE1α were mde s descried 34,35,37. Horserdish peroxidse (HRP)-conjugted got nti-rit IgG nd got nti-mouse IgG were from Bio-Rd (Hercules, CA) nd rit nti-lmin B polyclonl ntiserum ws generous gift from E. Mrcntonio (Deprtment of Pthology, Columi University, NY). Mice. Apoe / mice on the C57BL/6 ckground were fed fter wening highcholesterol diet contining 21% nhydrous milk ft nd.15% cholesterol ( Western-type diet; Hrln-Tekld, Indinpolis, IN) for the indicted times. Chop / mice on the FVB/N ckground nd Perk / mice on the Swiss-Wester ckground were creted s previously descried 21,32. For experiments involving these mice, control mcrophges were otined from wild-type silings. Free cholesterol loding nd cell deth ssys of mouse peritonel mcrophges. Peritonel mcrophges from dult femle C57BL/6 mice nd ll mutnt mice used in this study were hrvested three dys fter intrperitonel injection of 4 µg concnvlin A in.5 ml of PBS. Cells were incuted in DMEM supplemented with 1% FBS nd 2% L-cell-conditioned medium. The medium ws replced every 24 h until mcrophges were confluent. On the dy of the experiment, cells were wshed three times with wrmed PBS nd incuted s indicted in the figure legends. Most importntly, free cholesterol loding of wild-type nd mutnt mcrophges ws effected y incuting the cells with 1 µg ml 1 cetyl-ldl in the presence of 1 µg ml , which inhiits ACAT-medited cholesterol esterifiction 1. At the end of the incution period, mcrophges were ssyed for erly-to-mid-stge poptosis (tht is, externliztion of phosphtidylserine) y stining with Alex-488-lelled nnexin V nd for lte-stge poptosis (tht is, incresed memrne permeility) y stining with PI, s previously descried 1. Cells were viewed immeditely with n Olympus IX-7 inverted fluorescence microscope, nd 36 representtive fields (pproximtely 1, cells) for ech condition were counted for the numer of nnexin-positive, PI-positive cells, nd totl cells. In other experiments, cell or nucler preprtions were sujected to immunolot nlysis, s descried elow. Activted cspse-3 in mcrophges ws detected y immunofluorescence microscopy using n ntiody tht specificlly recognizes the ctive form (Apo-Active 3 kit; Cell Technology, Minnepolis, MN). Whole-cell cholesterol esterifiction ssy. Mcrophges were incuted for 5 h with DMEM,.2% BSA contining 5 µg ml 13 H-cholesterol-lelled cetyl- LDL lone or contining the indicted compounds. Cellulr lipids were extrcted twice with.5 ml of hexne:isopropnol (3:2, v:v), nd the cellulr content of 3 H-cholesteryl ester ws determined using thin-lyer chromtogrphy 49. The lipid-extrcted cell monolyer ws dissolved in 1 ml 1 N NOH nd ssyed for protein content using the Lowry method 5. Cholesterol oxidse ssy. Mcrophges were fixed with 1% glutrldehyde for 1 min nd then incuted for 3 min t 37 C with 2 U ml 1 Streptomyces cholesterol oxidse. Cellulr lipids were extrcted twice with.5 ml of hexne:isopropnol (3:2). Cholesterol nd cholestenone mss in these extrcts were determined y gsliquid chromtogrphy using β-sitosterol s n internl stndrd. The lipid-extrcted cell monolyer ws dissolved in 1 ml 1 N NOH nd ssyed for protein content using the Lowry method 5. Immunolot nlysis. Immunoprecipittion nd immunolotting of IRE1α nd PERK were conducted s previously descried 34. Immunolotting of XBP- 1, ATF-4 nd CHOP were performed s previously descried 35,37 with minor modifictions. Briefly, cells were lysed in RIPA uffer to prepre whole-cell lystes or to prepre nuclei y centrifugtion. The whole-cell lystes or nuclei were resuspended in 2 SDSpolycrylmide gel electrophoresis (PAGE) loding uffer nd incuted t 95 C for 1 min. Whole-cell (1 µg) or nucler (2 µg) lystes were electrophoresed on 42% grdient SDSPAGE gels nd electrotrnsferred to.22-µm nitrocellulose memrnes using Bio-Rd minitrnsfer tnk. After incution with primry ntiodies, the protein nds were detected with HRP-conjugted secondry ntiodies (Bio-Rd) nd y ECL (Amershm Phrmci Biotech, Pisctwy, NJ). Memrnes were reproed with n nti-β-ctin monoclonl ntiody or n nti-lmin B serum to control for differences in loding. Assy of endoplsmic reticulum clcium pools. or cholesterolloded mcrophges grown on 25-mm coverslips in microscopy dishes were loded with 4 µm Fur-2.m. (Moleculr Proes, Eugene, OR) nd.8% Pluronic F-127 in Hnk s uffered sline solution (HBSS) t room temperture for 3 min. Monolyers were then wshed twice with HBSS, incuted in HBSS for n dditionl 3 min nd then mounted on the stge of n inverted Nikon diphot microscope equipped with 4 ojective. Sulphinpyrzone (25 µm) ws included in ll solutions to prevent excretion of the Fur-2 y mcrophges. Fluorescence imges (51-nm emission fter lternte 34- nd 38-nm excittion) were collected through chrge-coupled device cmer (Photon Technology Interntionl, Lwrenceville, NJ) nd the 34:38 rtio of individul cells in these imges ws clculted. In-situ hyridiztion. The 47-p BmHI-NheI frgment of CHOP ws sucloned into the BmHI nd XI sites of the pcrii-topo vector (Invitrogen). The resulting plsmid ws trnscried in vitro using the DIG-RNA Lelling kit (SP6T7; Roche Moleculr Biochemicls, Bsel, Switzerlnd) to generte sense nd nti-sense Digrio proes. Proximl orte from Apoe / mice fed the Western-type diet for 13 weeks were fixed in 4% prformldehyde in PBS t 4 C overnight nd then sumerged in 3% (w/v) sucrose in PBS for 48 h t 4 C. The tissue ws then emedded in optiml cutting temperture (OCT) emedding medium (VWR Scientific, Bridgeport, NJ), cut into 1-µm sections nd mounted on Superfrost-plus slides (Fisher Scientific). Sections were then fixed in 4% prformldehyde for 1 min, wshed with PBS nd treted for 1 min ech with 1 µg ml 1 proteinse K in 5 mm Tris-HCl, 5 mm EDTA t ph 8. nd then.25% cetic nhydride in.1 M triethnolmine t ph NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER 23

11 Slides were dehydrted y sequentil 5-min incutions with 7%, 85%, 95% nd 1% ethnol, followed y incution in xylene. Sections were then incuted for 2 h t 42 C with 2 µl of prehyridiztion uffer, which contined 5% formmide, 4 SSC, 5 Denhrdt s solution, 5 µg ml 1 dentured slmon sperm DNA nd 25 µg ml 1 yest RNA. For hyridiztion, sections were incuted for 24 h t 42 C with 8 µl of the ove uffer contining 1 µg ml 1 sense or nti-sense DIG-lelled RNA proe. Next, sections were incuted sequentilly s follows: 3 min t 42 C with 5% formmide nd 1 SSC; 15 min t 37 C with.5 SSC; 15 min t 37 C with 3.5 SSC contining 2 µg ml 1 RNse A; 15 min t room temperture with 3.5 SSC; nd 6 min t 6 C with.1 SSC. For signl detection, sections were incuted for 2 h with nti- DIG lkline phosphtse-conjugted ntiody (1:2), wshed with PBS nd then developed with lkline phosphtse sustrte (Roche Moleculr Biochemicls) for 16 h. Sections were then dehydrted, rehydrted nd counterstined with 3% neutrl red for 5 min. Lser cpture microdissection (LCM) nd RNA extrction. Aortic roots with therosclerotic lesions were removed from Apoe / mice tht hd een fed the Western-type diet for 13 weeks. The roots were emedded in OCT compound (VWR Scientific) nd frozen immeditely on dry ice. Cryostt sections (6-µm thickness) were mounted on positively chrged slides (Colour Frost Plus; Fisher Scientific). Lesionl mcrophge RNA ws procured y LCM using PixCell II LCM System (Arcturus, Mountin View, CA), s previously descried 51.Briefly, the mcrophges of dehydrted sections were stined with n nti-cd68 ntiody (Serotec, Rleigh, NC) nd the positively stined res were selected nd ffixed to thermoplstic film mounted on opticlly trnsprent LCM cps (Arcturus). Totl RNA ws isolted from selected cells using Picopure RNA Isoltion Kit (Arcturus) in ccordnce with the mnufcturer s instructions efore tretment with DNse I (Amion, Austin, TX). RNA concentrtions were determined using RioGreen RNA Quntittion Kit (Moleculr Proes). Quntittive RTPCR. Totl RNA from resident peritonel mcrophges or from lesionl mcrophges, otined y lser-cpture microdissection, ws reverse-trnscried into cdna using oligo-dt nd Superscript II (Invitrogen). Quntittive PCR for Chop nd cyclophilin A (CypA) ws conducted using the Tqmn PCR regent (ABI) nd the ABI PRISM 77 sequence detection system, s previously descried 51.For Chop, the forwrd nd reverse primers were CCACCACACCTGAAAGCAGAA nd AGGTGAAAGGCAGGGACTCA, respectively, nd the proe ws 6FAM-CTGGTCCACGTGCAGTCATGG- TAMRA. For CypA, the forwrd nd reverse primers were GGCCGATGAC- GAGCCC nd TGTCTTTGGAACTTTGTCTGCAA, respectively, nd the proe ws TGTCTTTGGAACTTTGTCTGCAA. The PCR conditions for Chop cdna detection were 95 C for 1 min, 58 C for 3 s nd 72 C for 3 s, for 4 cycles. For CypA, the conditions were 95 C for 1 min nd 6 C for 1 s, for 4 cycles. Immunofluorescence microscopic detection of CHOP nd CD68 in therosclerotic lesions. Mice were nesthetized, lood ws withdrwn y crdic puncture, nd the hert ws perfused with PBS nd then 4% prformldehyde. The hert nd proximl ort were hrvested nd perfused ex vivo with 4% prformldehyde nd then stored in the sme fixtive for 16 h t 4 C. Specimens were then trnsferred to 3% sucrose in PBS for 48 h t 4 C. In preprtion for sectioning, the herts were emedded in OCT compound nd stored t 7 C. Sections (1 µm) of the proximl ort were prepred t 2 C on Microm (Wlldorf, Bden, Germny) microtome cryostt HM 55E, plced on poly-l-lysine-coted glss slides nd riefly ir dried. Sections were wshed in PBS nd permeilized in PBS contining.2% Triton X-1 for 1 min, wshed in PBS contining.5% Tween-2 for 1 min nd then rinsed repetedly with PBS lone t room temperture. Blocking ws ccomplished y incution with 5% norml got serum in PBS for 16 h t 4 C efore wshing in PBS contining.5% Tween-2 for 1 min nd rinsing repetedly with PBS t room temperture. For interction with primry ntiodies, the sections were incuted with 2.5% got serum contining 1 µg ml 1 rit polyclonl nti- CHOP croxy-terminl peptide IgG (R-2 from Snt Cruz Biotechnology) or 1:5 rt monoclonl nti-cd68 superntnt (FA11 from Serotec) for 1 h t room temperture. In control experiments, the nti-chop IgG ws presored with fivefold mss excess of the C-terminl peptide efore ddition to slides. After the sections were wshed in PBS contining Tween-2 nd then PBS, the ound primry ntiody ws visulized with 7.5 µg ml 1 Cy3-conjugted got nti-rit IgG or 3 µg ml 1 Cy3-conjugted got nti-rt IgG (Jckson ImmunoReserch Lortories, West Grove, PA). Sections were then wshed in PBS. For the CHOP experiment, DNA ws stined with the kryophilic dye Hoechst (14 ng ml 1 ) for 1 min t room temperture. After extensive wshing in PBS, the slides were mounted with coverslip nd viewed with n Olympus IX 7 inverted fluorescence microscope equipped with CoolSNAP CCD cmer. Filipin stining of ortic sections. Frozen sections of proximl ort were wshed in PBS nd then fixed with fresh 3% formldehyde for 1 h t room temperture. The fixed sections were wshed with PBS for 1 min to quench the formldehyde nd then incuted with.5 mg ml 1 filipin solution for 2 h t room temperture. After wshing in PBS, sections were viewed y fluorescence microscopy using n Olympus IX 7 inverted microscope equipped with UV filter set (3438-nm excittion, 4-nm dichroic nd 43-nm long-pss filters). Sttistics. Results re given s mens ± s.e.m.; n = 3 unless otherwise stted. ACKNOWLEDGEMENTS This work ws supported y Ntionl Institutes of Helth (NIH) grnts HL54591, HL5756 nd HL56984 to I.T, DK47119 nd ES8681 to D.R. nd HL61814 to E.A.F. We grtefully cknowledge R. Soccio nd F. Wng for ssistnce with the CHOP Tqmn nd in-situ hyridiztion ssys, respectively. We lso thnk Y. Zhng for technicl ssistnce nd R. Jungreis for help with the Perk / nd Chop / mice. COMPETING FINANCIAL INTERESTS The uthors declre tht they hve no competing finncil interests. Received 12 Mrch 23; ccepted 1 July 23; Pulished online t 1. Shio, H., Hley, N. J. & Fowler, S. Chrcteriztion of lipid-lden ortic cells from cholesterol-fed rits. III. Intrcellulr locliztion of cholesterol nd cholesteryl ester. L. Invest. 41, (1979). 2. Rpp, J. H., Connor, W. E., Lin, D. S., Inhr, T. & Porter, J. M. Lipids of humn therosclerotic plques nd xnthoms: clues to the mechnism of plque progression. J. Lipid Res. 24, (1983). 3. Smll, D. M., Bond, M. G., Wugh, D., Prck, M. & Swyer, J. K. Physicochemicl nd histologicl chnges in the rteril wll of non-humn primtes during progression nd regression of therosclerosis. J. Clin. Invest. 73, (1984). 4. Kruth, H. S. & Fry, D. L. Histochemicl detection nd differentition of free nd esterified cholesterol in swine therosclerosis using filipin. Exp. Mol. Pthol. 4, (1984). 5. Liy, P. & Clinton, S. K. The role of mcrophges in therogenesis. Curr. Opin. Lipidol. 4, (1993). 6. Bll, R. Y. et l. Evidence tht the deth of mcrophge fom cells contriutes to the lipid core of therom. Atherosclerosis 114, 4554 (1995). 7. Fzio, S. et l. Incresed therosclerosis in LDL receptor-null mice lcking ACAT1 in mcrophges. J. Clin. Invest. 17, (21). 8. Ts, I. Consequences of cellulr cholesterol ccumultion: sic concepts nd physiologicl implictions. J. Clin. Invest. 11, (22). 9. Kellner-Weiel, G. et l. Effects of intrcellulr free cholesterol ccumultion on mcrophge viility: model for fom cell deth. Arterioscler. Throm. Vsc. Biol. 18, (1998). 1. Yo, P. M. & Ts, I. Free cholesterol loding of mcrophges induces poptosis involving the fs pthwy. J. Biol. Chem. 275, (2). 11. Yo, P. M. & Ts, I. Free cholesterol loding of mcrophges is ssocited with widespred mitochondril dysfunction nd ctivtion of the mitochondril poptosis pthwy. J. Biol. Chem. 276, (21). 12. Kellner-Weiel, G., Geng, Y. J. & Rothlt, G. H. Cytotoxic cholesterol is generted y the hydrolysis of cytoplsmic cholesteryl ester nd trnsported to the plsm memrne. Atherosclerosis 146, (1999). 13. Yegle, P. L. Modultion of memrne function y cholesterol. Biochimie 73, (1991). 14. Bretscher, M. S. & Munro, S. Cholesterol nd the Golgi pprtus. Science 261, (1993). 15. Ptil, C. & Wlter, P. Intrcellulr signling from the endoplsmic reticulum to the nucleus: the unfolded protein response in yest nd mmmls. Curr. Opin. Cell Biol. 13, (21). 16. Trvers, K. J. et l. Functionl nd genomic nlyses revel n essentil coordintion etween the unfolded protein response nd ER-ssocited degrdtion. Cell 11, (2). 17. Zhng, D. et l. Mcrophges deficient in CTP:Phosphocholine cytidylyltrnsferse-α re vile under norml culture conditions ut re highly susceptile to free cholesterol-induced deth. Moleculr genetic evidence tht the induction of phosphtidylcholine iosynthesis in free cholesterol-loded mcrophges is n dptive response. J. Biol. Chem. 275, (2). NATURE CELL BIOLOGY VOLUME 5 NUMBER 9 SEPTEMBER