Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
|
|
- Tyrone Ferguson
- 6 years ago
- Views:
Transcription
1 ody weight (g) ody weight (g) 34 3 Male 3 27 Female Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless of gender. ody weights from ages 7 to 23 weeks in male (left) and female (right) and mice fed normal chow diet.
2 ody weight (g) Supplementary Figure 2. Lean phenotypes of mice were also detected in mice given the high-fat diet (HFD). The body weight of and mice (n = 4) were monitored following feeding with HFD for 3 weeks. Data shown are at age 12 weeks and are mean ± s.e.m. Statistical analyses were done with two-tailed paired t-test. P<.5.
3 Relative mrna expression Relative mrna expression pg / ml of serum A F4/ TNFα C Small Intestine Large Intestine Supplementary Figure 3. Lean phenotypes of 24-week-old mice were not associated with inflammation. (A) Levels of proinflammatory cytokines in serum of and mice (total n = 7) by cytometric bead array mouse-inflammatory kit (D iosciences). () mrna expression levels of F4/8 (left) and TNFα (right) in adipose tissue by real-time PCR. (C) Hematoxylin-eosin staining of small and large intestines. Scale bar = 1 μm. Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 to 5 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test (A) and two-tailed paired t- test (). P<.5;, not significant.
4 Orthogonal component 1 Modeled correlation A Lactic acid Acetic acid utyric acid C Acetate Predictive component utyrate Propionate Lactate Propionic acid Covariance Supplementary Figure 4. Orthogonal partial least squares discriminate analysis (OPLS-DA) of fecal metabolome data of and mice. (A) Cross-validated score plots from OPLS-DA of 1 H-nuclear magnetic resonance (NMR) data in feces of and mice (total n = 7). () S-plots for predictive component from OPLS-DA of 1 H-NMR data of in feces of and mice (total n = 7). (C) Quantification of shortchain fatty acids (i.e., acetate, butyrate, and propionate) and lactate in feces of and mice (total n = 7) by gas chromatography-mass spectrometry. Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 to 4 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.5, P<.1.
5 ody weight (g) 32 3 (S) (CH) (CH) (S) Age (weeks) Supplementary Figure 5. Compeatory body weight of mice in co-housing (CH) cages and shared fecal microbes. ody weights of (n = 5) and (n = 4) mice in CH cages. ody weights of and mice housed separately (S) are shown by linear graphs of filled gray and blue circles, respectively.
6 EF62759_s DQ815942_s DQ815871_g_uc EF62759_f_uc_s acteroides acidifacie acteroides sartorii 4P363_s EF64598_s EF46456_s Parabacteroides distasonis A21165_s EF96_s EF63769_s DQ815871_s EU622763_s EU791194_s A66322_s AY239469_g_uc acteroidales_uc_s EF46459_s DQ815748_s EF97615_s EF64981_s EF4686_s EF6376_s HM12428_g_uc A66319_s acteroides_uc EF6319_s EF46536_s EF62759_g_uc EF46817_s EU457676_s acteroides uniformis EU456683_s EF4683_s Prevotellaceae_uc_s EF9757_s HM123997_s FJ511984_s acteroides coprocola EF63121_s EF63835_s EF46481_s EF46712_s EF46368_s Parabacteroides_uc EF63734_s A66279_s EU643_s FJ88499_s DQ815599_s EU6213_s A66254_s EF46417_s EF46766_s FJ879877_s EF63798_s EF63662_s HQ74248_s JQ8513_s DQ815311_s EU5541_s EU791177_s EF64622_s Pseudoflavonifractor_uc A626943_s EF6461_s Oscillibacter_uc GQ451281_s Lachnospiraceae_uc_s HM123978_s A66283_s DQ815599_g_uc DQ815781_s Lactobacillus brevis Ruminococcaceae_uc_s EU51538_s EU6321_s Coprobacillus_f_uc_s Faecalibacterium prausnitzii FJ881243_s EF64623_s A626922_s EF6288_s 4P1451_s JQ84524_s DQ81597_s AJ38395_s HM124141_s Helicobacter mastomyrinus Parasutterella excrementihominis A2741_s 4P3191_s EF46813_s Mycoplasmataceae_f1_uc_s AJ4239_s DQ7779_s AJ4239_g_uc Mucispirillum schaedleri ETC Supplementary Figure 6. Color legend of pyrosequencing data for species levels in feces of mice shown in Fig. 3C.
7 Relative abundance (%) Supplementary Figure 7. iological assignment of acteroides contigs in DNA metagenomes. The comparison of relative abundance of contigs number in feces of and mice (total n = 6). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test. P<.5; P<.1;, not significant.
8 Colony-Forming Units A CH -CH 5 - CH - CH 216 bp Supplementary Figure 8. Expanded were determined in feces of mice co-housed with mice. (A) Colony-forming units (CFUs) of. acidifacie on acteroides ile Esculin (E) agar with feces of and mice (n = 3) in co-housing (CH) cage for 23 weeks. () Representative gel images of PCR analysis using -specific primer (F : 5 -CTGCCTCATACTCGGGGATA-3, R : 5 - CGTAGGAGTTTGGACCGTGT- 3 ; product size : 216 bp). The 15 colonies were randomly picked per plate for DNA templates. Data shown are the mean values ± SEM from individual mice. Statistical analyses were done with two-tailed paired t-test. P<.5.
9 A Nil Day 1 after feeding DAPI. acidifacie number (x1 7 / g) Nil Days after administration Supplementary Figure 9. Orally administered. acidifacie () can temporarily reside in colon. Colon tissues and feces were obtained at Nil and on days 1 5 after oral administration of (5 1 9 CFU / 1 μl ; total n = 6) and stained with -specific FISH (fluorescence in situ hybridization) probes. (A) Representative confocal images of (white arrows) in the colon tissues. () Quantification of in the feces at indicated time points. were counted in 2 regio per slide. Data shown are the mean values ± SEM from individual mice from 3 independent experiments with 2 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test. P<.1;, not detected.
10 Energy expenditure (kcal kg -1 hr -1 ) Total activity (x1 4 ) (beam breaks per day) RER (VCO 2 / VO 2 ) lood glucose (mg dl -1 ) lood glucose (mg dl -1 ) (mm 2 ) (μm 2 ) ody weight change Food uptake (g / mouse / day) A C NCD (%) (Weeks) Area D Area E GTT 3 2 ITT 1 1 F Time (min) Time (min) Light Dark Light Dark.5 Light Dark Supplementary Figure 1. Effective functio of. acidifacie () in regulating body weight and fat mass in normal chow diet (NCD)-fed 6 mice given or. (A) Representative photos and body weight over 1 weeks (left and right panels, respectively). was administered orally (5 1 9 CFU / 1 μl) daily (total n = 1). () Oral food intake with or. (C) Magnetic resonance imaging analysis (total n = 6). (D) Histological changes of adipose tissues (left panel) and size of adipocytes (right panel) of - and -fed mice during NCD (total n = 6). (E) Glucose tolerance test (GTT) (left panel, n = 9) and iulin tolerance test (ITT) (right panel, total n = 12) results by time point after intraperitoneal injection of glucose or iulin. (F) Energy expenditure, total activity, and respiratory exchange ratio (RER) of - or -fed mice (total n = 1). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 to 6 mice per experiment. Statistical analyses were done with two-tailed paired t-test (-D) and with two-way ANOVA with onferroni post-hoc test (A and E-F). P<.5, P<.1, P <.1;, not significant.
11 ody weight change Food uptake (g / mouse / day) A (%) NCD+ NCD+S HFD+ HFD+S NCD + NCD + S HFD + HFD + S Weeks post administration Supplementary Figure 11. Mice given. sartorii (S) and normal-chow diet (NCD) or highfat diet (HFD) had similar body weight and food intake. (A) ody weight over 1 weeks following oral administration of S (total n = 1) (5 1 9 CFU / 1 μl). () Oral food intake with or S (total n = 1). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 5 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test (A) and two-tailed paired t-test ()., not significant.
12 mg/kg/min mg/kg/min Glucose infusion rate (GIR) 75 6 Hepatic glucose production (HGP) 3 15 Heat-inactivated Supplementary Figure 12.. acidifacie () administration improves both hepatic and peripheral iulin seitivity. Hyperiulinemic-euglycemic clamp studies of -, heat-inactivated -fed mice for 6 weeks and their control mice (total n = 6) fed a normal chow diet. Infusion dose of iulin during the clamp study were determined 3mU based on preliminary experiments. Whole-body glucose uptake (peripheral iulin seitivity, A) and iulin-mediated suppression of hepatic glucose production rates (hepatic iulin seitivity, ) are significantly increased in -fed mice compared to heat inactivated -fed group. Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.5;, not significant.
13 A Acetate utyrate Propionate Lactate ( P =.5742 ) ( P =.28 ) ( P =.693 ) ( P =.934) Acetate ( P =.8652 ) utyrate ( P =.596 ) Propionate ( P =.215 ) Lactate ( P =.9693) Supplementary Figure 13. Levels of short-chain fatty acids (SCFAs) and lactate in feces after oral. acidifacie () administration for 1 weeks. Levels of acetate, butyrate, propionate, and lactate in feces measured by gas chromatographymass spectrometry in mice given normal chow diet (A; total n = 6) or high-fat diet (; total n = 6). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.1;, not significant.
14 Relative mrna expression Relative mrna expression A Fatty acid synthesis β-oxidation Thermogenesis Fatty acid synthesis β-oxidation Thermogenesis Supplementary Figure 14. Similar expression levels of lipid oxidation in livers and small intestines of and mice. Expression level of mrna genes related to fatty acid synthesis (FasN, HSL, PEPCK, SCD1, and PPARγ), β-oxidation (PPARα), and thermogenesis (PRDM16, PGC1a, Cidea, and GLUT4) were determined by real-time PCR using livers (A) and small intestines () of and mice (total n = 8). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 to 5 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test.
15 Area (x 1 3, μm 2 ) A Supplementary Figure 15.. acidifacie () administration does not induce β-cell overstimulation. Pancreas tissues were obtained from mice (total n = 6) administrated with (5 1 9 CFU / 1 μl) for 1 weeks. (A) Representative confocal images of islets (red color for α-cell and green color for β-cell). Scale bar = 5 μm. The sectio were sequentially reacted with mouse anti-glucagon immunoglobulin G (IgG) Ab (K79b1; Sigma-Aldrich, St. Louis, MO) and rabbit polyclonal anti-iulin Ab (Santa Cruz iotechnology, Santa Cruz, CA), and then PE-conjugated anti-mouse IgG (eioscience, San Diego, CA) and FITC-conjugated anti-rabbit IgG (eioscience, San Diego, CA), respectively. () The size of β-cells region was quantified using ImageJ software program. The islet were randomly selected in 1 regio per slide. Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.1;, not significant.
16 Triglyceride (mg dl -1 ) Total cholesterol (mg dl -1 ) Triglyceride (mg dl -1 ) Total cholesterol (mg dl -1 ) Triglyceride (mg dl -1 ) Total cholesterol (mg dl -1 ) Triglyceride (mg dl -1 ) Total cholesterol (mg dl -1 ) A C NCD HFD Supplementary Figure 16. Triglyceride and cholesterol levels were similar in serum of, fecal microbiota traplantation (FMT), and. acidifacie ()-fed mice. Concentratio of serum triglycerides and total cholesterol were analyzed using enzymatic assay kits in mice (A; total n = 5), FMT mice (; total n = 5), and -fed mice (C; total n = 5). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 2 to 3 mice per experiment. Statistical analyses were done with two-tailed paired t-test., not significant. NCD, normal chow diet; HFD, high-fat diet.
17 (nmol / g feces) (nmol / g feces) (nmol / g feces) (nmol / g feces) (nmol / g feces) A (2) (3) C (2) D (1) E-F (5) G (25) H (1) I (1) 7 L-M (12) N (31) 8 O (9)
18 (nmol / g feces) (nmol / g feces) (nmol / g feces) (nmol / g feces) 3 P (26) 3 U-X (13) R-S (19) T (2) 3 1'- & 2'- (23) '- & 4'- (21) '- & 6'- & 7'- (15) Supplementary Figure 17. The profiles of 292 metabolites in feces of and mice. The metabolites in feces of and mice (n = 7) were measured by capillary electrophoresis timeof-flight mass spectrometry (CE-TOF-MS). All metabolites are arranged in alphabetical order. Data shown are the mean values ± SEM from individual mice. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test. P<.5, P<.1 and P<.1;, not detected.
19 Colony-Forming Units (Log 1 ) Time for co-culture (hours) Supplementary Figure 18.. acidifacie () can be regulated by autophagy machinery of CD11c + cells. Numbers of in bone marrow-derived CD11c + cells were determined on EG agar plate at 6 and 24 hours after co-cultured with (MOI=1). one marrow were obtained from or mice (total n = 6). Data shown are the mean values ± SEM from individual mice from 3 independent experiments with 2 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.5;, not detected.
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationSupplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationTissue factor-par2 signaling promotes diet-induced obesity and adipose
Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya
More informationALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More information(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationa b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
More informationSupplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
More informationTargeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationFig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationEffect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
More informationFor pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More informationFigure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow
Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationSupplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationOnline Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
More informationCOPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
More informationInflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra
Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationTable 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1
Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2
More informationGut Microbiomes of Malawian Twin Pairs Discordant for Kwashiorkor
Gut Microbiomes of Malawian Twin Pairs Discordant for Kwashiorkor Michelle I. Smith et al. Science 339, 548 (2013) Dept Meeting, 28 May 2013, M. UMEZAKI ABSTRACT. Kwashiorkor, an enigmatic form of severe
More informationHigh Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22
Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran
More informationSUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)
SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of
More informationTBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationAn introduction to the COCVD Metabolic Phenotyping Core
An introduction to the COCVD Metabolic Phenotyping Core Capabilities and procedures Manager: Wendy S. Katz, Ph.D. University of Kentucky Medical Center Department of Pharmacology 577 Charles T. Wethington
More informationSupplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
More informationSupplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationDiabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
More informationNature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSupplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationControl. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
More informationglucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationMetformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production
activates a duodenal Ampk-dependent pathway to lower hepatic glucose Frank A. Duca, Clémence D. Côté, Brittany A. Rasmussen, Melika Zadeh-Tahmasebi, Guy A. Rutter, Beatrice M. Filippi & Tony K.T. Lam Supplementary
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationGut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Gut Reaction Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Ley, R. et al (2005) PNAS vol. 102 no. 31 Bacterial diversity in the distal gut (ceca) of C57BL6 mice. (A) Phylogenetic tree of
More informationSupplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
More informationchapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists.
chapter 1 - fig. 1 The -omics subdisciplines. chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists. 201 figures chapter 1 chapter 2 - fig. 1 Schematic overview of the different steps
More informationThe Gut Microbiota: Evidence For Gut Microbes as Contributors to Weight Gain
The Gut Microbiota: Evidence For Gut Microbes as Contributors to Weight Gain Michael T. Bailey, Ph.D. Center for Microbial Pathogenesis The Research Institute, Nationwide Children s Hospital Department
More information