Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1

Size: px
Start display at page:

Download "Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1"

Transcription

1 Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species of O-acyl-ω-hydroxy fatty (OAHFA) acids displayed significant positive correlations to age; while (C) several poly-unsaturated phospholipids showed significant negative correlations to age. (D) Species of wax esters containing oleic-acid (FA 18:1) as the fatty acid moieties were positively correlated with age. Only lipid species demonstrating statistically significant (p<5) correlations with the respective clinical parameters were shown. Red eclipse indicates region within 95% confidence interval of the correlating parameters. OAHFA OAHFA Poly-unsaturated phospholipids A B C D WE (FA18:1) OAHFA 18:1/28: OAHFA 18:1/28:1 OAHFA 18:1/31: PE4:2p,4:3e OAHFA 18:1/26: OAHFA 18:1/31:1 PE4:3p,4:4e OAHFA 18:1/26:1 OAHFA 18:2/31: PE4:4p,4:5e OAHFA 18:1/25: OAHFA 18:1/3:1 OAHFA 18:2/33:1 C18:1C27: C18:1C26:1 C18:1C25: PE34:2p, 34:3e C18:1C24:1 OAHFA 18:1/24: OAHFA 18:1/3:2 PS 38:4 C18:1C23: OAHFA 18:2/3:

2 Figure S2, related to Figure 1. Heatmaps illustrating the correlations between lipid levels in tears with dry-eye associated clinical parameters including the Schirmer s length (Schir I), tear breakup time (TBUT), modified ocular surface disease index (OSDI) and Baylor s score for corneal staining. Correlation coefficients were plotted with red indicating a positive correlation and blue indicating a negative correlation. Statistical significance was denoted by the respective symbols. Correlations between (A) normalized levels and (B) molar concentrations of lipid classes with clinical parameters, respectively. The correlations between normalized levels of individual lipid species from selected lipid classes including (C) cholesteryl esters, (D) phosphatidylcholines, (E) phosphatidic acids and (F) phosphatidylglycerols were also presented. Individual species of PC, PA and PG were negatively correlated with Schir and TBUT; while positively correlated with OSDI and Baylor. The observed trend was consistent across the respective lipid classes, indicating that elevated levels of these species might be associated with dry eye disease pathogenesis. # 5<p<.1; p<5; p<1; p<1. A Normalized (Mol Fraction) B Molar Concentration (μmol/ml) C D Total WE Total CE Total CS Free Cho Total TAG Total DAG Total OAHFA Total SM Total Cer Total GluCer Total GM3 Total PC Total PE Total PS Total PI Total PA Total PG Total LPC Total LPE Total LpPE Total LPS Total LPI Total LPA Total LBPA PC32:2e,32:1p PC32:1e,32:p PC32:2 PC32:1 PC32: PC34:2e,34:1p PC34:1e,34:p PC34:e PC34:4 PC34:3 PC34:2 PC34:1 PC34: PC36:5e,36:4p PC36:4e,36:3p PC36:3e,36:2p PC36:2e,36:1p PC36:1e,36:p PC36:e PC36:5 PC36:4 PC36:3 PC36:2 PC36:1 PC36: PC38:6e,38:5p PC38:5e,38:4p PC38:4e,38:3p PC38:3e,38:2p PC38:2e,38:1p PC38:7 PC38:6 PC38:5 PC38:4 PC38:3 PC38:2 PC38:1 PC38: PC4:6e,4:5p PC4:5e,4:4p PC4:7 PC4:6 PC4:5 PC4:4 PC4:3 PC4:2 PC4:1 PC4: E F Total WE Total CE Total CS Free Cho Total TAG Total DAG Total OAHFA Total SM Total Cer Total GluCer Total GM3 Total PC Total PE Total PS Total PI Total PA Total PG Total LPC Total LPE Total LpPE Total LPS Total LPI Total LPA Total LBPA PA32:1 PA32: PA34:2 PA34:1 PA36:3 PA36:2 PA36:1 PA38:6 PA38:5 PA38:4 PA38:3 PA38:2 PA4:7 PA4:6 PA4:5 PA4:4 PA4:3 LPA16: LPA18: PG34:1 PG34: PG36:3 PG36:2 PG36: CE-14:1 CE-14: CE-16:1 CE-16: CE-17:1 CE-17: CE-18:3 CE-18:2 CE-18:1 CE-18: CE-19:1 CE-19: CE-2:5 CE-2:4 CE-2:3 CE-2:2 CE-2:1 CE-2: CE-21:1 CE-21: CE-22:6 CE-22:4 CE-22:3 CE-22:2 CE-22:1 CE-22: CE-23:1 CE-23: CE-24:2 CE-24:1 CE-24: CE-25:1 CE-25: CE-26:2 CE-26:1 CE-26: CE-27:1 CE-27: CE-28:2 CE-28:1 CE-28: CE-29:1 CE-29: CE-3:2 CE-3:1 CE-3: CE-31:2 CE-31:1 CE-31: CE-32:2 CE-32:1 CE-32: CE-33:2 CE-33:1 CE-33: CE-34:2 CE-34:1 CE-35: CE-36:2 CE-36:

3 Figure S3, related to Figure 2. Clinical classification of study cohort. (A) Schematic diagram illustrating the stratification of subjects into various clinical groups. The comparison of dry eyeassociated clinical parameters between various clinical groups including the (B) modified ocular surface disease index (OSDI); (C) Schirmer s length (Schir I); (D) tear breakup time (TBUT); (E) central corneal staining; (F) inferior corneal staining; (G) Baylor s score for corneal staining; (H) age and (I) total molar concentration of lipids detected in tears. Symptomatic score was used primarily to define dry eye as symptoms represent the essence of the disorder for patients. As tear film instability manifests as an imitating event in all dry eye subtypes, TBuT was used to identify asymptomatic individuals at risks of developing the disease. A Total Clinical Cohort (93) OSDI Nonpatient <12.9 >12.9 Patient TBUT Schir I <5 secs >5 secs <5.5mm >5.5mm Risk Schir I Normal Patient (AqD) Patient (Non-AqD) <5.5mm >5.5mm Risk Risk (AqD) (Non-AqD) Normal Risk Risk (AqD) Patient Patient (AqD) B OSDI C Schir I D Central Inferior E F G # # TBuT Baylor s score H I Total Lipids

4 Figure S4, related to Figure 2. Comparison of the levels of lipid classes among various clinical groups. (A) Neutral lipids including waxes (WE), cholesteryl esters (CE), triacylglycerides (TAG), diacylglycerides (DAG), free cholesterols (Free Cho); (B) O-acyl-ω-hydroxy-fatty acids (OAHFA), cholesteryl sulfate (CS), and sphingolipids including sphingomyelins (SM), ceramides (Cer), glucosylceramides (GluCer), and monosialo-dihexosyl gangliosides (GM3); (C) phospholipids including phosphatidylcholines (PC), phosphatidylethanolamines (PE), phosphatidylserines (PS), phosphatidylinositols (PI), phosphatidic acids (PA), phosphatidylglycerols (PG) and lysobiphosphatidic acids (LBPA); and (D) lyso-phospholipids including lyso-pc (LPC), lyso-pe (LPE), lyso-plasmalogen PE (LpPE), lyso-ps (LPS), lyso-pi (LPI) and lyso-pa (LPA). Normal Risk Risk (AqD) Patient Patient (AqD) Mol Fraction A C WE CE TAG DAG Free Cho B # 2 1 4e-4 2e-4 # e+ OAHFA CS SM Cer GluCer GM3 D Mol Fraction 14 4e-4 2e e-4 4e-4 e+ PC PE PS PI PA PG LBPA e+ LPC LPE LpPE LPS LPI LPA

5 Figure S5, related to Figure 3. Correlations of individual wax esters with DES clinical signs and symptoms. Heatmaps summarizing the correlations between individual wax ester species of (A) low molecular mass (range: ) and (B) medium to high molecular mass (range: ) with clinical parameters for DES. Values were plotted as correlation coefficients. Red indicates positive correlation while blue indicates negative correlation. R: Individuals at risk; RA: Individuals at risk with aqueous deficiency; P: Patients (non-aqueous-deficient); PA: Patients with aqueous deficiency; N: Normal. A C16:1C17:1 C18:1C15:1 C16:1C17: C17:1C16: C18:1C15: C16:2C18: C16:1C18:1 C18:2C16: C18:1C16:1 C16:1C18: C17:1C17: C18:1C16: C15:2C2: C17:1C18:1 C18:2C17: C16:1C19: C17:1C18: C18:1C17: C16:2C2: C16:1C2:1 C17:1C19:1 C18:2C18: C18:1C18:1 C16:1C2: C17:1C19: C18:1C18: C15:2C22: C16:2C21: C16:1C21:1 C17:1C2:1 C18:2C19: C16:1C21: C17:1C2: C18:1C19: C14:2C24: C16:1C22:1 C18:2C2: C18:1C2:1 C16:1C22: C17:1C21: C18:1C2: C16:1C23:1 C17:1C22:1 C18:2C21: C18:1C21:1 C16:1C23: C17:1C22: C18:1C21: C16:2C24: C16:1C24:1 C18:2C22: C18:1C22:1 Schir i TBuT OSDI Baylor Correlation coefficient B C16:1C24: C17:1C23: C16:C24:1 C18:1C22: C18:C22:1 C16:1C25: C15:C26:1 C17:1C24: C18:1C23: C17:C24:1 C15:2C27: C16:2C26: C16:1C26:1 C17:1C25:1 C18:2C24: C18:1C24:1 C16:1C26: C17:1C25: C16:C26:1 C18:C24:1 C14:2C29: C16:2C27: C17:1C26:1 C18:2C25: C18:1C25:1 C16:1C27: C17:1C26: C18:1C25: C17:C26:1 C18:C25:1 C16:2C28: C16:1C28:1 C17:1C27:1 C18:2C26: C18:1C26:1 C16:1C28: C17:1C27: C16:C28:1 C18:1C26: C18:C26:1 C2:1C24: C15:2C3: C16:2C29: C17:1C28:1 C18:1C27:1 C16:1C29: C15:C3:1 C18:1C27: C17:C28:1 C2:1C25: C16:1C3:1 C18:2C28: C18:1C28:1 C16:1C3: C16:C3:1 C18:1C28: C2:1C26: C17:1C3:1 C18:2C29: C16:1C31: C17:1C3: C16:C31:1 C18:1C29: C17:C3:1 C2:1C27: C16:1C32:1 C18:2C3: C18:1C3:1 C16:1C32: C16:C32:1 C18:1C3: C18:C3:1 C18:1C31: Schir i TBuT OSDI Baylor Correlation coefficient

6 Figure S6, related to Figure 4. Classification of clinical cohort based on molar concentrations of lipids. (A) Dot plots illustrating the distribution of total lipid levels in the study cohort. The study cohort was stratified into three groups using thresholds defined by the 25 th and 75 th percentiles of the cohort based on total lipid levels in molar concentration (molml -1 ). The comparison of dry eye-associated clinical parameters between the low, medium and high groups defined by total lipid levels, including the (B) modified ocular surface disease index (OSDI); (C) Schirmer s length (Schir); (D) tear breakup time (TBUT); (E) central corneal staining; (F) inferior corneal staining; (G) Baylor s score for corneal staining; (H) age were shown. A Molar Conc of Total Lipids (molml 1 ) LOW 25 th MEDIUM 2 percentile Subject Number HIGH 75 th percentile OSDI Schir I B C D Low Medium High TBuT Central Inferior E 1. F 2. G Baylor Score H

7 Figure S7, related to Figures 4. Comparison of the levels of lipid classes among low, medium and high groups defined by total lipid levels. (A) Neutral lipids including waxes (WE), cholesteryl esters (CE), triacylglycerides (TAG), diacylglycerides (DAG), free cholesterols (Free Cho); (B) O- acyl-ω-hydroxy-fatty acids (OAHFA), cholesteryl sulfate (CS), and sphingolipids including sphingomyelins (SM), ceramides (Cer), glucosylceramides (GluCer), and monosialo-dihexosyl gangliosides (GM3); (C) phospholipids including phosphatidylcholines (PC), phosphatidylethanolamines (PE), phosphatidylserines (PS), phosphatidylinositols (PI), phosphatidic acids (PA), phosphatidylglycerols (PG) and lyso-biphosphatidic acids (LBPA); and (D) lysophospholipids including lyso-pc (LPC), lyso-pe (LPE), lyso-plasmalogen PE (LpPE), lyso-ps (LPS), lyso-pi (LPI) and lyso-pa (LPA). Mol Fraction A # WE CE TAG DAG Free Cho B e-4 4e-4 3e-4 2e-4 1e-4 e+ Low Medium High OAHFA CS SM Cer GluCer GM3 # Mol Fraction C # LPC LPE LpPE LPS LPI LPA # D e # # PC PE PS PI PA PG LBPA

8 Supplementary Figure S8, related to Figure 4. Compositional alterations in tear lipids with varying amounts of total lipids. Subjects were stratified into three groups (i.e. low, medium and high) based on the total absolute concentrations of lipids detected using the 25 th and 75 th percentiles as cutoffs. Changes in the molar fractions of selected lipid classes including (A) DAG; (B) CE; and (C) PC amongst the three groups were observed. The Schirmer s lengths for selected subjects in the low-lipid category with elevated CS and GluCer were indicated with dotted lines. Blue: Subjects without aqueous-deficiency; Red: Subjects with aqueous-deficiency. A Total DAG B Total CE C Total PC Mol Fraction Low Medium High Low Medium High Low Medium High Absolute Lipid Levels in Tears

9 Table S1, related to Figures 1-3 (see attached spreadsheet). Demographic and clinical information of the dry eye cohort used for derivation of dry eye biomarkers. A total of 93 subjects were recruited and stratified into various clinical groups according to the criteria described in Figure S11.

10 Table S2 (see attached spread sheet), related to Fig. 2. P-values and q-values for ANOVA of wax ester species. Only species with both p- and q-values <5 were considered statistically significant and marked in Figure 4.

Meibum Lipid Composition in Asians with Dry Eye Disease

Meibum Lipid Composition in Asians with Dry Eye Disease Meibum Lipid Composition in Asians with Dry Eye Disease Sin Man Lam 1, Louis Tong 2,3,4, Siew Sian Yong 2, Bowen Li 5, Shyam S. Chaurasia 2, Guanghou Shui 5,6 *, Markus R. Wenk 1,5 * 1 Department of Biological

More information

Extensive characterization of human tear fluid collected using different techniques unravels

Extensive characterization of human tear fluid collected using different techniques unravels Extensive characterization of human tear fluid collected using different techniques unravels the presence of novel lipid amphiphiles Authors: Sin Man Lam 1,2, Louis Tong 3,4,5,6, Xinrui Duan 7, Andrea

More information

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions

More information

Glycerolipid Analysis. LC/MS/MS Analytical Services

Glycerolipid Analysis. LC/MS/MS Analytical Services Glycerolipid Analysis LC/MS/MS Analytical Services Molecular Characterization and Quantitation of Glycerophospholipids in Commercial Lecithins by High Performance Liquid Chromatography with Mass Spectrometric

More information

Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols

Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols Chem 431A-L24-F'07 page 1 of 5 Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols (0) REVIEW: FA s are very reduced

More information

The use of mass spectrometry in lipidomics. Outlines

The use of mass spectrometry in lipidomics. Outlines The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid

More information

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction

More information

By: Dr Hadi Mozafari 1

By: Dr Hadi Mozafari 1 Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms

More information

PHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY

PHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY PHOSPHOLIPIDS METABOLISM BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 1. State the definition and classification of Phospholipids. 2. Describe the general structure

More information

Reduced dietary levels of EPA and DHA have a major impact on the composition of

Reduced dietary levels of EPA and DHA have a major impact on the composition of Supplementary materials Reduced dietary levels of EA and DHA have a major impact on the composition of skin membrane lipids in Atlantic salmon (Salmo salar L.) Ken Cheng *,, Marta Bou, Bente Ruyter, Jana

More information

ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd

ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd I. Classes of membrane lipids A. Glycerolipids (quantitatively the most important of the three membrane lipids) B. Shingolipids

More information

Mass-Spectrometric Analysis of Lipids (Lipidomics)

Mass-Spectrometric Analysis of Lipids (Lipidomics) Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:

More information

Supplementary material

Supplementary material Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Epithelial-to-mesenchymal transition involves triacylglycerol accumulation in DU145

More information

Phospholipids Metabolism

Phospholipids Metabolism Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester

More information

LC/MS Method for Comprehensive Analysis of Plasma Lipids

LC/MS Method for Comprehensive Analysis of Plasma Lipids Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,

More information

LIPIDS Introduction - complex lipids. Marek Vecka

LIPIDS Introduction - complex lipids. Marek Vecka LIPIDS Introduction - complex lipids Marek Vecka CLASSIFICATION OF LIPIDS IV - biosynthetic route Lipid class Fatty acyls Glycerolipids Glycerophospholipids Sphingolipids Sterol lipids Prenol lipids Other

More information

Overview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer

Overview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer Overview on the identification of different classes of lipids by HPTLC (High Performance Thin Layer Chromatography) and ITLC (Immuno Thin Layer Chromatography) Iuliana Popa 1, Marie-Jeanne David 2, Daniel

More information

MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS

MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,

More information

Phospholipid Analysis. P NMR Analytical Services

Phospholipid Analysis. P NMR Analytical Services Phospholipid Analysis 31 P NMR Analytical Services Quantitative Phospholipid Analysis of Soy Lecithin and Krill Lecithin by 31 P NMR Katherine L Lanier; Jeff D Moore; Dale Smith; Shengrong Li; Ben Davis;

More information

Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention

Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Piyushkumar A. Mundra,, Peter J. Meikle, LIPID Study Investigators JCI Insight. 2018;3(17):e121326..

More information

MEMBRANE STRUCTURE. Lecture 8. Biology Department Concordia University. Dr. S. Azam BIOL 266/

MEMBRANE STRUCTURE. Lecture 8. Biology Department Concordia University. Dr. S. Azam BIOL 266/ 1 MEMBRANE STRUCTURE Lecture 8 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University Plasma Membrane 2 Plasma membrane: The outer boundary of the cell that separates it from the world

More information

New Frontiers for MS in Metabolipidomics

New Frontiers for MS in Metabolipidomics New Frontiers for MS in Metabolipidomics Giuseppe Astarita, PhD Principal Scientist Discovery & Life Sciences Milford, MA USA 2011 Waters Corporation 1 Why Metabolipidomics? Biomedical Sciences o Biomarker

More information

Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson

Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter

More information

MPS Advanced Plant Biochemistry Course

MPS Advanced Plant Biochemistry Course MPS 587 - Advanced Plant Biochemistry Course Lipids section guest lecture: Philip Bates Post-doc Browse lab Office: 453 Clark Hall Email: phil_bates@wsu.edu Lecture 9 Lipids I 1. What is a lipid? 2. Fatty

More information

Dengue Virus Infection Perturbs Lipid Homeostasis in Infected Mosquito Cells

Dengue Virus Infection Perturbs Lipid Homeostasis in Infected Mosquito Cells University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Biochemistry -- Faculty Publications Biochemistry, Department of 2012 Dengue Virus Infection Perturbs Lipid Homeostasis

More information

SUPPLEMENTAL MATERIAL. A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in. diabetic patients

SUPPLEMENTAL MATERIAL. A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in. diabetic patients SUPPLEMENTAL MATERIAL A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in diabetic patients Cubedo et al: ApoA-I truncated form in diabetes By Judit Cubedo a, Teresa Padró

More information

Lipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague

Lipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Molecular Organization of the Cell Membrane

Molecular Organization of the Cell Membrane Molecular Organization of the Cell Membrane A walk from molecules to a functional biostructure Cell Membrane Definition An ultrastructure separating connecting the cell to the environment 1 Coarse chemical

More information

Biological relevance of fatty acyl heterogeneity to the neural membrane dynamics of Rhesus macaques during normative aging

Biological relevance of fatty acyl heterogeneity to the neural membrane dynamics of Rhesus macaques during normative aging /, Vol. 7, No. 35 Biological relevance of fatty acyl heterogeneity to the neural membrane dynamics of Rhesus macaques during normative aging Sin Man Lam 1, Gek Huey Chua 1, Xiao-Jiang Li 1, Bing Su 2 and

More information

UMR 8612, Faculty of Pharmacy Chatenay-Malabry. Natura-Brasil. EA Laboratory of Dermatological Research,

UMR 8612, Faculty of Pharmacy Chatenay-Malabry. Natura-Brasil. EA Laboratory of Dermatological Research, Iuliana Popa 1, Noëlle Remoué 2 and Jacques Portoukalian 3 1 UMR 8612, Faculty of Pharmacy Chatenay-Malabry 2 Natura-Brasil 3 EA 41 69 Laboratory of Dermatological Research, University of Lyon I, Faculty

More information

Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid Quadrupole-Orbitrap-Linear Ion Trap Mass Spectrometer

Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid Quadrupole-Orbitrap-Linear Ion Trap Mass Spectrometer B American Society for Mass Spectrometry, 2014 J. Am. Soc. Mass Spectrom. (2015) 26:133Y148 DOI: 10.1007/s13361-014-1013-x RESEARCH ARTICLE Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Supplemental Methods Lipid extraction. Tissue was pulverized with a mortar and pestle or a ball-grinding method (Mikro Dismembrator, Sartorius). All subsequent steps were performed

More information

TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON

TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON Link full download: https://testbankservice.com/download/testbank-for-lehninger-principles-of-biochemistry-6th-edition-bynelson TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON

More information

Lipid Class Separation Using UPC 2 /MS

Lipid Class Separation Using UPC 2 /MS Michael D. Jones, 1,3 Giorgis Isaac, 1 Giuseppe Astarita, 1 Andrew Aubin, 1 John Shockcor, 1 Vladimir Shulaev, 2 Cristina Legido-Quigley, 3 and Norman Smith 3 1 Waters Corporation, Milford, MA, USA 2 Department

More information

Supplemental Information. LipiDex: An Integrated Software Package. for High-Confidence Lipid Identification

Supplemental Information. LipiDex: An Integrated Software Package. for High-Confidence Lipid Identification Cell Systems, Volume 6 Supplemental Information LipiDex: An Integrated Software Package for High-Confidence Lipid Identification Paul D. Hutchins, Jason D. Russell, and Joshua J. Coon Figure S1. Omics

More information

Mass Spectrometry based metabolomics

Mass Spectrometry based metabolomics Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (

More information

Perfluoroalkyl Acids (PFAAs) in Plasma of the West Indian Manatee (Trichechus manatus)

Perfluoroalkyl Acids (PFAAs) in Plasma of the West Indian Manatee (Trichechus manatus) Perfluoroalkyl Acids (PFAAs) in Plasma of the West Indian Manatee (Trichechus manatus) 6 th Florida Marine Mammal Conference March 29, 2018 Orlando, Fl John A. Bowden National Institute of Standards and

More information

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier

More information

Large-Scale Metabolite Analysis by Laser Desorption Ionization Mass Spectrometry from Silicon Nanopost Arrays

Large-Scale Metabolite Analysis by Laser Desorption Ionization Mass Spectrometry from Silicon Nanopost Arrays Supporting Information Large-Scale Metabolite Analysis by Laser Desorption Ionization Mass Spectrometry from Silicon Nanopost Arrays Andrew R. Korte, Sylwia A. Stopka, Nicholas Morris, Trust Razunguzwa,

More information

Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents

Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Xiaoning Lu, Jennifer E. Claus, and David S. Bell Supelco, Div. of Sigma-Aldrich Bellefonte, PA 16823

More information

Emerging science on omega-3: A lipidomic view of omega-3 in health and disease. Health benefits of omega 3 fatty acids

Emerging science on omega-3: A lipidomic view of omega-3 in health and disease. Health benefits of omega 3 fatty acids Emerging science on omega-3: A lipidomic view of omega-3 in health and disease Peter Meikle 04 May 2017 Health benefits of omega 3 fatty acids Can lower plasma triacylglycerol can reduce the risk of metabolic

More information

PCs Acyl chain double bonds. PEs

PCs Acyl chain double bonds. PEs Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2014 Male/Female ratio Male/Female ratio PCs 1.3 1.2 1.1 1 0.9 0.8 0.7 0.6 0.5 0.4 0 1 2

More information

King Saud University College of Science Department of Biochemistry. General Biochemistry-II (BCH 302) Chapter 4. Lipids

King Saud University College of Science Department of Biochemistry. General Biochemistry-II (BCH 302) Chapter 4. Lipids King Saud University College of Science Department of Biochemistry General Biochemistry-II (BCH 302) Chapter 4 Lipids Prepared by Dr. Farid Ataya http://fac.ksu.edu.sa/fataya http://faculty.ksu.edu.sa/75112

More information

MASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES. Cassie J.

MASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES. Cassie J. MASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES By Cassie J. Fhaner A DISSERTATION Submitted to Michigan State University in partial

More information

7/11/17. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell

7/11/17. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell Molecular and Cellular Biology Cell Function & Chemistry 2. Bio-Chemical Foundations & Key Molecules of a Cell Prof. Dr. Klaus Heese Interaction Molecular Bonds Define Cellular Functions Water H 2 O Interactions

More information

Biomarkers of NAFLD progression an omics approach to an epidemic

Biomarkers of NAFLD progression an omics approach to an epidemic Biomarkers of NAFLD progression an omics approach to an epidemic D. Lee Gorden 1,2, David S. Myers 3, Pavlina T. Ivanova 3, Eoin Fahy 4, Mano R. Maurya 4, Shakti Gupta 4, Jun Min 4, Nathanael J. Spann

More information

FATTY ACIDS (FAs) SIMPLE AND COMPLEX LIPIDS

FATTY ACIDS (FAs) SIMPLE AND COMPLEX LIPIDS FATTY ACIDS (FAs) SIMPLE AND COMPLEX LIPIDS Dicarboxylic acids, ketone bodies. Department of General Chemistry Structure and classification of lipids Lipids can be divided into five categories, on the

More information

Master class Biomolecular Sciences Molecular Cell Biology.

Master class Biomolecular Sciences Molecular Cell Biology. Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track

More information

Supplementary Material

Supplementary Material 10.1071/FP14336_AC CSIRO 2015 Supplementary Material: Functional Plant Biology, 2015, 42(7), 630 642. Supplementary Material The role of oxidative stress in determining the level of viability of black

More information

Lipid Analysis by Evaporative Light Scattering Detection

Lipid Analysis by Evaporative Light Scattering Detection Grace Davison Discovery Sciences Lipid Analysis by Evaporative Light Scattering Detection Brochure #A www.discoverysciences.com High Performance Analysis of Polar and Non-Polar Lipid Introduction The composition

More information

1 Corresponding author: Hideo Shindou, Department of Biochemistry and Molecular Biology,

1 Corresponding author: Hideo Shindou, Department of Biochemistry and Molecular Biology, Recent progress on Acyl-CoA:lysophospholipid acyltransferase research* Hideo Shindou 1, Daisuke Hishikawa, Takeshi Harayama, Koichi Yuki, and Takao Shimizu From the Department of Biochemistry and Molecular

More information

Principles of Shotgun Lipidomics

Principles of Shotgun Lipidomics Principles of Shotgun Lipidomics Xianlin Han Diabetes and Obesity Research Center Sanford-Burnham Medical Research Institute Lake Nona Orlando, FL 32827 What is shotgun lipidomics? Original definition

More information

Sphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids, Phytosphingosines, Inhibitors, Agonists

Sphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids, Phytosphingosines, Inhibitors, Agonists Avanti Price List January 2015 Lipidomics Products Monoclonal Antibodies, Lipid Snoopers, Lipidomix Toolbox, MS Standards General Products Sphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids,

More information

Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.

Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations. Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson Fatty acid composition as a biomarker of intake Complements dietary

More information

Biological role of lipids

Biological role of lipids Lipids Lipids Organic compounds present in living organisms, insoluble in water but able to be extracted by organic solvents such as: chloroform, acetone, benzene. Extraction = the action of taking out

More information

DECLARATION OF CONFLICT OF INTEREST. None

DECLARATION OF CONFLICT OF INTEREST. None DECLARATION OF CONFLICT OF INTEREST None Plasma Lipidomic Analysis of Stable and Unstable Coronary Artery Disease Peter J Meikle 1, Gerard Wong 1, Despina Tsorotes 1, Christopher K Barlow 1, Jacquelyn

More information

Lipids and Biological Membranes

Lipids and Biological Membranes Lipids and Biological Membranes Lipids: Found in all living organisms Especially important as components of biological membranes Defined functionally, not structurally, as compounds that are totally or

More information

Lipids. Water vsoil. Water is a Polar Molecule δ + Polarity vs Nonpolarity H O

Lipids. Water vsoil. Water is a Polar Molecule δ + Polarity vs Nonpolarity H O Water vsil SCBC203 Lipids Jirundon Yuvaniyama, Ph.D. Department of Biochemistry Faculty of Science Mahidol University Figure taken from https://www.healthtap.com/user_questions/558342 Figures taken from

More information

Lipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair

Lipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair Lipid Chemistry Presented By Ayman Elsamanoudy Salwa Abo El-khair 4 Objectives: 1. By the end of this chapter the student should be able to: define lipids. describe the biological importance of lipids.

More information

1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant

1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant 1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant Lipid: Definition Biological molecules that are insoluble in aqueous solutions and

More information

A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids

A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids Jeremy Netto, 1 Stephen Wong, 1 Federico Torta, 2 Pradeep Narayanaswamy, 2

More information

Obtaining Answers to Biological Questions Sample Prep to Data Analysis. Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS

Obtaining Answers to Biological Questions Sample Prep to Data Analysis. Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS Obtaining Answers to Biological Questions Sample Prep to Data Analysis Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS OMICS Research Why Quantitative OMICS? 2 2015 AB Sciex SCIEX

More information

SUPPORTING INFORMATION FOR:

SUPPORTING INFORMATION FOR: SUPPORTING INFORMATION FOR: Metabolomics and lipidomics profiling of a combined mitochondrial plus endoplasmic reticulum fraction of human fibroblasts: a robust tool for clinical studies Charlotte Veyrat-Durebex

More information

Synthesis and elongation of fatty acids

Synthesis and elongation of fatty acids Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008

More information

Lysophosphatidic acid (LPA) signaling through LPA1 in organ fibrosis: A pathway with pleiotropic pro-fibrotic effects. and Andrew M.

Lysophosphatidic acid (LPA) signaling through LPA1 in organ fibrosis: A pathway with pleiotropic pro-fibrotic effects. and Andrew M. 78 Special Issue: Cellular and Molecular Bases for Fibrotic Diseases Review Article Lysophosphatidic acid (LPA) signaling through LPA1 in organ fibrosis: A pathway with pleiotropic pro-fibrotic effects

More information

Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS

Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS Alexei Belenky CASSS, Meritage Resort, Napa 2008 Outline Role of lipid analysis in drug discovery and disease diagnostics Analytical tools and

More information

Dr. Nafith Abu Tarboush

Dr. Nafith Abu Tarboush 6 Dr. Nafith Abu Tarboush June 26 th 2013 Noor Salem 1 Not corrected Review Lipids are composed of two main connected parts : o Alcohol Sphingosine Glycerol o Fatty Acids (3 in number) Saturated Long Chain

More information

Introduction to biomembranes

Introduction to biomembranes King Saud University College of Science Department of Biochemistry Biomembranes and Cell Signaling (BCH 452) Chapter 1 Introduction to biomembranes Prepared by Dr. Farid Ataya http://fac.ksu.edu.sa/fataya

More information

Physical effects underlying the transition from primitive to modern cell membranes

Physical effects underlying the transition from primitive to modern cell membranes Physical effects underlying the transition from primitive to modern cell membranes Itay Budin and Jack W. Szostak* *To whom correspondence should be addressed. Email: szostak@molbio.mgh.harvard.edu This

More information

Recognition of Lyso-Phospholipids by Human Natural Killer T Lymphocytes

Recognition of Lyso-Phospholipids by Human Natural Killer T Lymphocytes Recognition of Lyso-Phospholipids by Human Natural Killer T Lymphocytes Lisa M. Fox 1, Daryl G. Cox 2, Jennifer L. Lockridge 1, Xiaohua Wang 1, Xiuxu Chen 1, Louise Scharf 3, David L. Trott 4, Rachel M.

More information

MCQS ON LIPIDS. Dr. RUCHIKA YADU

MCQS ON LIPIDS. Dr. RUCHIKA YADU MCQS ON LIPIDS Dr. RUCHIKA YADU Q1. THE FATS AND OILS ARE RESPECTIVELY RICH IN a) Unsaturated fatty acids b) Saturated fatty acids c) Saturated and unsaturated fatty acids d) None of these Q2. ESSENTIAL

More information

Lipids Analysis. Lipids

Lipids Analysis. Lipids Lipids Analysis Stephen Barnes 3 5 15 Lipids Lipids are mostly very hydrophobic Most are conjugates of fatty acids of a variety of chain lengths, which have different degrees of unsaturation, cis trans

More information

Lipids and Membranes

Lipids and Membranes Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Lipids and Membranes I. overview Lipids are related

More information

Supporting information

Supporting information Supporting information A novel lipidomics workflow for improved human plasma identification and quantification using RPLC-MSn methods and isotope dilution strategies Evelyn Rampler 1,2,3, Angela Criscuolo

More information

Drug permeability across biological barriers estimated by the PVPA

Drug permeability across biological barriers estimated by the PVPA Drug permeability across biological barriers estimated by the PVPA Gøril Eide Flaten, professor, Drug Transport and Delivery Research Group, UiT The Arctic University of Norway, Tromsø, Norway Norecopa

More information

BIOCATALYTIC CONVERSION OF OTHER LIPIDS

BIOCATALYTIC CONVERSION OF OTHER LIPIDS Chapter 6 BIOCATALYTIC CONVERSION OF OTHER LIPIDS In Chapters 4 and 5, lipase-mediated conversion of acylglycerols were presented. The Chapter 6 deals with biocatalytic modification of phospholipids, sphingolipids,

More information

Agilent Solutions for Lipidomics. Greater Insight into

Agilent Solutions for Lipidomics. Greater Insight into Agilent Solutions for Lipidomics Greater Insight into Lipid Metabolism Understanding Lipidomics What is Lipidomics? The term "lipidome" refers to all the lipids that exist in an organism and their effects

More information

Lipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10

Lipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10 1 Lipids Lehninger 3 rd ed. Chapter 11 (For biosynthesis see Chapter 21) 2 Lipids: a Diverse group of chemicals Insolubility in water. Fats and oils: energy stores. Phospholipids and sterols: structural

More information

Sphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids, Phytosphingosines, Inhibitors, Agonists

Sphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids, Phytosphingosines, Inhibitors, Agonists Avanti Price List January 2016 Lipidomics Products Monoclonal Antibodies, Lipid Snoopers, Lipidomix Toolbox, MS Standards General Products Sphingolipids Sphingosines, Ceramides, SM, Glycosphingolipids,

More information

Paper 4. Biomolecules and their interactions Module 22: Aggregates of lipids: micelles, liposomes and their applications OBJECTIVE

Paper 4. Biomolecules and their interactions Module 22: Aggregates of lipids: micelles, liposomes and their applications OBJECTIVE Paper 4. Biomolecules and their interactions Module 22: Aggregates of lipids: micelles, liposomes and their applications OBJECTIVE The main aim of this module is to introduce the students to the types

More information

Human Complex Milk Lipids: Concentrations, benefits and the implications for Paediatric Nutrition

Human Complex Milk Lipids: Concentrations, benefits and the implications for Paediatric Nutrition Human Complex Milk Lipids: Concentrations, benefits and the implications for Paediatric Nutrition Alastair MacGibbon, Bertram Fong, Angela Rowan and Paul McJarrow Fonterra Research and Development Centre,

More information

Ahmad O. Olimat. Abdallah Al-Qawasmeh. Dr.Mamoun

Ahmad O. Olimat. Abdallah Al-Qawasmeh. Dr.Mamoun 10 Ahmad O. Olimat Abdallah Al-Qawasmeh Mohammed Yousef Dr.Mamoun A QUICK RECAP Eicosanoids They are derived from Arachidonic acid, a fatty acid that contains 20 carbon atoms and four double bonds. They

More information

UNIVERSITY OF CALGARY. Interactions of Inorganic Mercury and Inorganic Cadmium with Biomimetic and Complex

UNIVERSITY OF CALGARY. Interactions of Inorganic Mercury and Inorganic Cadmium with Biomimetic and Complex UNIVERSITY OF CALGARY Interactions of Inorganic Mercury and Inorganic Cadmium with Biomimetic and Complex Biological Membranes and their Influence on Membrane Packing and Size by Evan Kerek A THESIS SUBMITTED

More information

ICAP 2017, 3rd - 6th July 2017, Caparica, Portugal Philip Morris International is the sole source of funding and sponsor of this project.

ICAP 2017, 3rd - 6th July 2017, Caparica, Portugal Philip Morris International is the sole source of funding and sponsor of this project. Thomas Schneider PMI R&D, Philip Morris Products S.A., Quai Jeanrenaud 5, CH-2000 Neuchâtel, Switzerland (Part of Philip Morris International group of companies) ICAP 2017, 3rd - 6th July 2017, Caparica,

More information

Classification, functions and structure

Classification, functions and structure Classification, functions and structure Elena Rivneac PhD, Associate Professor Department of Biochemistry and Clinical Biochemistry State University of Medicine and Pharmacy "Nicolae Testemitanu" Lipids

More information

Opinion on the safety assessment of phospholipds obtained from egg yolk as food produced using a new process

Opinion on the safety assessment of phospholipds obtained from egg yolk as food produced using a new process EUROPEAN COMMISSION DIRECTORATE-GENERAL XXIV CONSUMER POLICY AND CONSUMER HEALTH PROTECTION Directorate B - Scientific opinions on health matters Unit B3 - Management of scientific committees II SCIENTIFIC

More information

Inhibitory effect of dietary lipids on chaperonemediated

Inhibitory effect of dietary lipids on chaperonemediated Inhibitory effect of dietary lipids on chaperonemediated autophagy Jose Antonio Rodriguez-Navarro a, Susmita Kaushik a, Hiroshi Koga a, Claudia Dall Armi b, Guanghou Shui c, Markus R. Wenk c, Gilbert Di

More information

Chapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2.

Chapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2. BCH 4053 Spring 2001 Chapter 8 Lecture Notes 1 Chapter 8 Lipids 2 Functions of Lipids Energy Storage Thermal Insulation Structural Components of Membranes Protective Coatings of Plants and Insects Hormonal

More information

COR 011 Lecture 9: ell membrane structure ept 19, 2005

COR 011 Lecture 9: ell membrane structure ept 19, 2005 COR 011 Lecture 9: ell membrane structure ept 19, 2005 Cell membranes 1. What are the functions of cell membranes? 2. What is the current model of membrane structure? 3. Evidence supporting the fluid mosaic

More information

SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics

SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics ANSWERS FOR SCIENCE. KNOWLEDGE FOR LIFE. SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics Baljit Ubhi, Ph.D ASMS Baltimore, June 2014 Lipidomics Profiling Needs and Deliverables

More information

2. Simple lipids: Triacylglycerols and waxes are classified as simple lipids. The characteristics of each are described in the sections below.

2. Simple lipids: Triacylglycerols and waxes are classified as simple lipids. The characteristics of each are described in the sections below. Paper 4: Biomolecules and their interactions Module 21: Classification of Lipids: simple and compound lipids, phospholipids, Cholesterol OBJECTIVE The main aim of this module is to introduce the students

More information

Supplementary Information

Supplementary Information Supplementary Information Nano-LC/NSI MS refines lipidomics by enhancing lipid coverage, measurement sensitivity, and linear dynamic range Niklas Danne-Rasche 1, Cristina Coman 1, Robert Ahrends 1 1) Leibniz-Institut

More information

Firoze B. Jungalwala, James E. Evans, and Robert H. McCluer

Firoze B. Jungalwala, James E. Evans, and Robert H. McCluer Compositional and molecular species analysis of phospholipids by high performance liquid chromatography coupled with chemical ionization mass spectrometry Firoze B. Jungalwala, James E. Evans, and Robert

More information

Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI

Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI Biology Informatics Chemistry Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind Course: Search of MS/MS files with the NIST MS Search GUI http://fiehnlab.ucdavis.edu/staff/kind

More information

Lipids. Dr. Mamoun Ahram Summer semester, Resources This lecture Campbell and Farrell s Biochemistry, Chapter 8

Lipids. Dr. Mamoun Ahram Summer semester, Resources This lecture Campbell and Farrell s Biochemistry, Chapter 8 Lipids Dr. Mamoun Ahram Summer semester, 2017-2018 Resources This lecture Campbell and Farrell s Biochemistry, Chapter 8 Lipids Lipids are a heterogeneous class of naturally occurring organic compounds

More information

SUPPLEMENTAL DATA. Ahn_Supp. Fig. 1 * * * * BSA Oleate. Triglyceride SBI-477 ( M) Veh Veh TriC DGATi 1.5. Normalized FA Uptake

SUPPLEMENTAL DATA. Ahn_Supp. Fig. 1 * * * * BSA Oleate. Triglyceride SBI-477 ( M) Veh Veh TriC DGATi 1.5. Normalized FA Uptake SUPPLEMENTAL DATA Ahn_Supp. Fig. 1 A Triglyceride ( g/mg protein) 35 30 25 20 15 10 5 BSA Oleate B Normalized FA Uptake 1.5 1.0 0.5 0 Veh Veh 0.3 1.0 3.0 10.0 30.0 TriC DGATi 0.0 Veh SBI-477 SBI-477 (

More information

Nafith Abu Tarboush DDS, MSc, PhD

Nafith Abu Tarboush DDS, MSc, PhD Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Lipids (cholesterol, cholesterol esters, phospholipids & triacylglycerols) combined with proteins (apolipoprotein) in

More information

Industrial production of lecithin and its derivates

Industrial production of lecithin and its derivates Industrial production of lecithin and its derivates W. van Nieuwenhuyzen Lecipro Consulting www.lecipro.nl Øresund Food Network ACS Phospholipid Seminar Lecipro Consulting - Copenhagen 10-2008 1 Topics

More information