Supplementary Materials for

Save this PDF as:

Size: px
Start display at page:

Download "Supplementary Materials for"


1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu, Rui Liu, Si Zhang, Ainsley Coquinco, Yongting Chen, Yanhua Wen, Luba Kojic, William Jia, Max S. Cynader* *Corresponding author. (M.S.C.); (G.Y.) Published 9 July 2013, Sci. Signal. 6, ra57 (2013) DOI: /scisignal The PDF file includes: Fig. S1. Subcellular localization of JNK3 induced by PATs. Fig. S2. Kinase activity independent localization of JNK3 to the Golgi complex. Fig. S3. Enhanced phosphorylation of palmitoylated JNK3. Fig. S4. Inhibition of VSVG trafficking by palmitoylated JNK3. Fig. S5. Inhibition of vesicle secretion from the Golgi by palmitoylated JNK3. Fig. S6. Reduction of surface GluR1 induced by NMDA excitotoxicity. Fig. S7. Disruption of secretory transport system and depletion of PI4P induced by palmitoylated JNK3. Fig. S8. Reduction of neuronal surface GluR1 induced by Sac1. Fig. S9. Interaction between Sac1 and palmitoylated JNK isoforms. Fig. S10. Identification of two JNK3-binding motifs on Sac1. Fig. S11. Identification of potential Sac1-binding motifs on JNK3. Fig. S12. Enlargement of the Golgi-resident pool of PI4P in neurons by Sac1 knockdown. Fig. S13. Disruption of the Sac1-JNK3 interaction by synthetic blocking peptides.

2 Supplementary Materials Fig. S1. Subcellular localization of JNK3 induced by PATs. (A) Western blot analysis of palmitoylation of JNK3 in rat cortical neurons assessed by the fatty acyl exchange assay. PD, pulldown; IB, immunoblotting; IP: immunoprecipitation; HAM, hydroxylamine. (B) GFP- JNK3 was transfected into COS7 cells together with individual zdhhc PATs (red) as indicated by number. Images that show translocation of JNK3 to the perinuclear region induced by the PAT are underlined. (C) Wild-type JNK3 (WT) was expressed in COS7 cells with individual PATs as indicated, and profiles of JNK3 distribution along the dotted lines are shown on the right. The shaded box represents the perinuclear region. (D) Western blot analysis

3 of palmitoylated JNK3 without (control) or with the indicated PATs in HEK293 cells. Bar graph shows the means and standard error of the fold-change of palmitoylation of JNK3 in the presence of individual PATs compared with the JNK3-alone control (n=3 experiments). ** p<0.01, ANOVA with Tukey test.

4 Fig. S2. Kinase activity independent localization of JNK3 to the Golgi complex. (A) Colocalization of transiently expressed GFP-JNK3 Parlm or KD-Parlm with GM130 (red), a marker of the Golgi complex in COS7 cells. Small vesicles containing JNK3 Parlm and KD- Parlm are indicated by arrows. Profiles of subcellular distribution of JNK3 (green line) and GM130 (red line) along the dotted lines (intensity versus distance) are shown at the bottom. (B) Western blot analysis of JNK3 variants at the Golgi assessed by gradient fractionation. HEK293 cells were transfected with wild-type JNK3 (WT) or JNK3 mutants (CS or Parlm) with or without zd17. Fractions 3 to 5 (dotted box) enriched with GM130 represent Golgi contents. Representative figures from three independent experiments are shown. (C) COS7 cells were transfected with GFP-JNK3 and zd17. GFP-JNK3 and GM130 (red) was examined in cells treated with BFA (5 µm) for 30 minutes, or 4 hours after BFA washout (right top panel). Colocalization of JNK3 with GM130 is indicated by arrows. Cells transfected with GFP-JNK3

5 and zd17 were examined with aggresome markers HSP70 (red) and vimentin (red) (right panel). Arrows indicate the corresponding locations of JNK3. Scale bars: 10 µm. (D) Kinase activity of the kinase-deficient mutant JNK3 (KD) relative to wild-type JNK3 (WT) expressed in HEK293 cells. The kinase assay measured phosphorylation at Ser 63 of purified c-jun protein. All representative figures and quantifications were from three independent experiments. ** p<0.01, Two-tailed t-test.

6 Fig. S3. Enhanced phosphorylation of palmitoylated JNK3. (A) Interaction between zd17 and wild-type JNK3 (WT) or the JNK3-CS mutant in transfected HEK293 cells was examined by coimmunoprecipitation. (B) The phosphorylation of wild-type or mutant (CS) JNK3 at Thr 183 /Tyr 185 in the absence or presence of zd17 in HEK293 cells. (C) The phosphorylation of JNK3 in the

7 presence of zd15 in transfected HEK293 cells was assessed after treatment with 400 mm sorbitol (30 min) to induce osmotic stress. (D) The phosphorylation status of JNK3 WT and the Parlm mutant was assessed in transfected HEK293 cells. (E) Immunofluorescent detection of the phosphorylation (red) of GFP-tagged wild-type or mutant (CS or Parlm) JNK3 transfected with or without zd15 in HEK293 cells. Arrows and hollow arrows indicate the presence and the absence of phosphorylation signal, respectively. Scale bars: 10 µm. All images and bar graphs are representative of and quantified from three independent experiments. ** p<0.01, Two-tailed t- test.

8 Fig. S4. Inhibition of VSVG trafficking by palmitoylated JNK3. (A) VSVG- mcherry (red), myc-zd17 and GFP-JNK3 variants were expressed in cultured rat hippocampal neurons as indicated. Accumulation and colocalization of VSVG and JNK3 at the Golgi complex are indicated by arrows. (B) VSVG- mcherry (red) was coexpressed with GFP-JNK3 variants and myc-zd17 in COS7 cells as indicated. Distribution profiles of JNK3 (green line) and VSVGmcherry (red line) along the dotted line are shown at the bottom. (C) Transport velocity of VSVG-ts045 (green) to the plasma membrane of COS7 cells transfected with indicated constructs was assessed after shifting cells from 39.5 C to 32 C. Line graph shows the means of the data values for two independent experiments with bars representing the range of the original values from two experiments. Scale bars: 10 µm.

9 Fig. S5. Inhibition of vesicle secretion from the Golgi by palmitoylated JNK3. (A) GFP- NCAM, GFP-p75, or GFP-BDNF was coexpressed with DsRed2-tagged JNK3 variants and myc-zd17 in COS7 cells. Cells expressing either DsRed2-JNK3 with NCAM or only NCAM are indicated by arrows or an arrowhead, respectively. (B) The distribution of HA-GluR1 (red) was examined in COS7 cells expressing GFP-JNK3 variants and myc-zd17 (blue). (C) Localization of wild-type GFP-GluR1 (GluR1 WT ) or the C585S mutant (GluR1 C585S ) was examined in COS7 cells expressing either GFP-JNK3 WT or the CS mutant together with myc-zd17 (red). Scale bars: 10 µm. Images are representative of three experiments.

10 Fig. S6. Reduction of surface GluR1 induced by NMDA excitotoxicity. (A) Detection of GluR1 and the synaptic scaffolding protein PSD-95 (postsynaptic density protein 95) along dendrites in rat hippocampal neurons using either non-permeable (Surface) or permeable (Total) immunofluorescence methods. Surface GluR1 on dendrites in the dotted boxes are magnified below each image (X). Images are representative of two experiments. (B) NMDA induced a steady reduction of surface GluR1 in cultured rat cortical neurons in the presence of the JNK inhibitor SP (10 µm). Line graph shows the means and standard error relative to the untreated control (at 2 hours, n=14 cells; at 4 hours, n=11 cells, at 16 hours, n=14 cell; at 24 hours, n=9 cells). (C) Western blot analysis (IB) of surface or total GluR1 from rat cortical neurons 16 hours after treatment with NMDA in the presence of SP or NIMoE (1 µm). Bar graphs show the means and standard error in treated neurons relative to untreated controls (n=3 experiments). ** p<0.01, Two-tailed t-test with Bonferroni correction. Scale bars: 10 µm.

11 Fig. S7. Disruption of secretory transport system and depletion of PI4P induced by palmitoylated JNK3. (A) COS7 cells expressing GFP-JNK3 and myc-zd17 were stained with selective markers (red) as indicated across the top. Cells expressing or not expressing JNK3 and zd17 are indicated by arrows or arrowheads, respectively. (B) Golgi-resident PI4P was labeled in COS7 cells by both Fapp1-GFP (green) and an antibody against PI4P (red). (C) PI4P in COS7 cells expressing DsRed2-tagged JNK3 variants (red) and myc-zd17 was examined with Fapp1- GFP (green). The intensity profiles (control, blue; KD+zD17, red; KD-Parlm, green) of Fapp1- GFP along the dotted lines are shown to the right. The shaded box represents normal background Fapp1- GFP. (D) PI4P in COS7 cells expressing GFP-tagged JNK3 variants (green) and myczd17 was examined with an antibody against PI4P (red). The intensity profiles were measured as in (C). Scale bars: 10 µm. All data is representative of three experiments.

12 Fig. S8. Reduction of neuronal surface GluR1 induced by Sac1. (A) PI4P in rat hippocampal neurons transiently expressing FLAG-Sac1 WT, LZ or K2a (red) was assessed by Fapp1-GFP (green). Accumulation of Fapp1-GFP at the Golgi is indicated by arrows. Bar graph shows the means and standard error of the intensity of Fapp1-GFP at the Golgi complex (n=30 cells). (B) Surface GluR1 was examined in rat hippocampal neurons transiently expressing GFP-tagged WT, LZ or K2a Sac1. Bar graph shows the means and standard error of the percentage of the density of surface GluR1 in neurons expressing GFP-Sac1 variants compared to the GFP-alone control (n=18 cells). * p<0.05, ** p<0.01, ANOVA with Tukey test. Scale bars: 10 µm.

13 Fig S9. Interaction between Sac1 and palmitoylated JNK isoforms. (A) Coimmunoprecipitation and western blot analysis of the interaction between Sac1 and JNK isoforms in the presence or absence of zd17 (as indicated) in HEK293 cells. Bar graph shows the means and standard error of the percentage of the strength of the Sac1 interaction with JNK isoforms compared to the Sac1-JNK1 interaction (control) (n=3 experiments). ** p<0.01, Two-tailed t-test with Bonferroni correction; (B) COS7 cells transfected with zd17 and GFP-JNK isoforms (green) as indicated were assessed for colocalization with Golgi marker GM130 (red). Accumulation or absence of JNK isoforms at the Golgi complex is indicated by arrows or arrowheads respectively. Images are representative of three experiments. Scale bar: 5 µm.


15 Fig. S10. Identification of two JNK3-binding motifs on Sac1. (A) Analysis of the JNK3-Sac1 interaction using an in vitro binding assay. (B) Co-immunoprecipitation and western blot analysis of the interaction between JNK3 and FLAG-tagged wild-type or mutant Sac1 m139-del (motif m139 deleted), m412-del (motif m412 deleted) or m139,412-del (both motifs deleted) in HEK293 cells. Bar graph shows the means and standard error of the percentage of the strength of the GFP- JNK3 interaction with mutant FLAG-Sac1 compared to the wild-type FLAG-Sac1 control (n=3 experiments). ** p<0.01, Two-tailed t-test. (C) Protein sequences of yeast (CAA82057) and rat (NP_446250) Sac1 were aligned and the regions corresponding to motif 139 and motif 412 are marked in blue for yeast Sac1 and yellow for rat Sac1. (D) The 3D structure of yeast Sac1 fragment is from Protein Data Bank (accession number 3LWT). These two motifs (139 and 412) locate at the loop regions that are present at the surface of the proteins and are separated by a betasheet structure corresponding to region aa (E) Analysis of sequence similarity across rat non-redundant protein sequence database with motifs m139 and m412.

16 Fig. S11. Identification of potential Sac1-binding motifs on JNK3. (A) Screening of potential binding sites on a peptide array of human JNK3a2. The peptide array was incubated with in vitro with purified human Sac1 proteins, and blotted with the anti-sac1 antibody. Four clusters of spots (A, B, C, D) on the membrane were consistently identified as strongly positive in two repeats of the assay. (B) The full sequences of these positive peptide spots cover two loose regions on JNK3, as labeled in yellow shades. Based on the binding efficiency detected on the peptide array, three potent Sac1-Binding Motifs (SBM-1, 2, and 3) were marked in red squares. The sequences of these SBMs are highly conserved among JNK isoforms. The dual-phosphorylation motifs (Thr-Pro-Tyr) on JNKs are marked in red. (C) Identification of SBM2 as the key motif for Sac1 interaction. GFP- JNK3 mutants were generated by deleting corresponding motifs (SBM1, 2, and 3) individually (SBM1-del, SBM2-del, or SBM3-del) or simultaneously (SBMall-del). The interaction between Sac1 and these JNK3 mutants were examined by co-immunoprecipitation in lysates from HEK293

17 cells. Representative figures and quantifications from three independent experiments are shown. ** p<0.01, Two-tailed t-test with Bonferroni correction. (D) The structural organization of SBM2 is shown (Protein Data Bank, 3OY1).

18 Fig. S12. Enlargement of the Golgi-resident pool of PI4P in neurons by Sac1 knockdown. (A) Western blot analysis of knockdown of myc-flag-tagged rat Sac1 (NM_053798) in HEK293 cells by shrna (sir1 or sir2). Bar graph shows the means and standard error of the percentage of the amount of FLAG-Sac1 in cells expressing Sac1 shrnas compared to the psuper-expressing control (n=4 experiments). (B) Western blot analysis of knockdown of endogenous Sac1 in PC12 cells by shrna (sir1 or sir2). Bar graph shows the means and standard error of the percentage of the amount of Sac1 in cells expressing Sac1 shrnas compared to the psuper-expressing control (n=3 experiments). (C) PI4P was detected by Fapp1-GFP in rat hippocampal neurons expressing the psuper control or Sac1 shrnas for 48 hours. The enrichment of PI4P in the Golgi is indicated by arrows. Bar graph shows the means and standard error of the intensity of Fapp1-GFP at the Golgi (psuper, n=6 cells; Sac1-siR2, n=5 cells). Scale bars 10 µm. For all data, * p<0.05, ** p<0.01, Two-tailed t-test with Bonferroni correction.

19 Fig. S13. Disruption of the Sac1-JNK3 interaction by synthetic blocking peptides. (A) The endocytosis of TAT-sequence fused, FITC labeled NIMoE peptides (pep130 and pep412) in COS7 cells was examined at indicated time points. Small endocytosis vesicles are indicated by arrows. (B) Western blot analysis of the effect of pep130 and pep412 individually or in combination on the JNK3-Sac1 interaction. Peptides (5 µm) were treated to rat cortical neurons for 16 hours and the interaction between JNK3 and Sac1 were assessed by co-immunoprecipitation and quantified as mean and standard error of the percentage of the interaction between JNK3 and Sac1 in the presence of peptides compared to the untreated control: pep139 only, 111.4±5.1%, p=0.18; pep412 only, 97.5±22.3, p=1.82; pep139 and 412, 44.3±7.1%, p=0.003; Two-tailed t-test with Bonferroni correction; n=3 experiments. (C) Surface GluR1 was examined in rat hippocampal neurons treated with NMDA in the presence or absence of individual blocking peptides (pep139 or pep412). Bar graph shows the means and standard error of the percentage of surface GluR1 in treated neurons

20 compared to the untreated control (n=5 cells). Two-tailed t-test with Bonferroni correction. Scale bars: 10 µm.


SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

El Azzouzi et al., http :// /cgi /content /full /jcb /DC1

El Azzouzi et al., http :// /cgi /content /full /jcb /DC1 Supplemental material JCB El Azzouzi et al., http :// /cgi /content /full /jcb.201510043 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Acquisition of -phluorin correlates negatively with podosome

More information

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1 Maschalidi et al. a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1

More information

MCB130 Midterm. GSI s Name:

MCB130 Midterm. GSI s Name: 1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal

More information

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons

Supplemental Information. Ca V 2.2 Gates Calcium-Independent. but Voltage-Dependent Secretion. in Mammalian Sensory Neurons Neuron, Volume 96 Supplemental Information Ca V 2.2 Gates Calcium-Independent but Voltage-Dependent Secretion in Mammalian Sensory Neurons Zuying Chai, Changhe Wang, Rong Huang, Yuan Wang, Xiaoyu Zhang,

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information



More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway

More information

Selective protection of an ARF1-GTP signaling axis by a bacterial scaffold induces bidirectional trafficking arrest.

Selective protection of an ARF1-GTP signaling axis by a bacterial scaffold induces bidirectional trafficking arrest. Selective protection of an ARF1-GTP signaling axis by a bacterial scaffold induces bidirectional trafficking arrest. Andrey S. Selyunin, L. Evan Reddick, Bethany A. Weigele, and Neal M. Alto Supplemental

More information

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn. Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates

More information

Nature Biotechnology: doi: /nbt.3828

Nature Biotechnology: doi: /nbt.3828 Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

PKCλ Is Critical in AMPA Receptor Phosphorylation and Synaptic Incorporation during LTP

PKCλ Is Critical in AMPA Receptor Phosphorylation and Synaptic Incorporation during LTP Manuscript EMBO-2012-82900 PKCλ Is Critical in AMPA Receptor Phosphorylation and Synaptic Incorporation during LTP Si-Qiang Ren, Jing-Zhi Yan, Xiao-Yan Zhang, Yun-Fei Bu, Wei-Wei Pan, Wen Yao, Tian Tian

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Many G protein-coupled receptors (GPCRs) 2 are rapidly endocytosed after agonist binding, but the pathway of postendocytic

Many G protein-coupled receptors (GPCRs) 2 are rapidly endocytosed after agonist binding, but the pathway of postendocytic THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 40, pp. 29646 29657, October 5, 2007 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Hepatocyte Growth

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information


SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images

More information

Supplementary table 1

Supplementary table 1 Supplementary table 1 S. pombe strain list Fig. 1A JX38 h + ade6-m216 nda3-km311 PX476 PW775 PX545 PX546 h- ade6-m216 sgo2::ura4 + nda3-km311 h 9 mad2::ura4 + nda3-km311 h + ade6-m21 nda3-km311 rad21 +

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Ionotropic glutamate receptors (iglurs)

Ionotropic glutamate receptors (iglurs) Ionotropic glutamate receptors (iglurs) GluA1 GluA2 GluA3 GluA4 GluN1 GluN2A GluN2B GluN2C GluN2D GluN3A GluN3B GluK1 GluK2 GluK3 GluK4 GluK5 The general architecture of receptor subunits Unique properties

More information

Supplemental Information. Caldendrin Directly Couples. Postsynaptic Calcium Signals. to Actin Remodeling in Dendritic Spines

Supplemental Information. Caldendrin Directly Couples. Postsynaptic Calcium Signals. to Actin Remodeling in Dendritic Spines Neuron, Volume 97 Supplemental Information Caldendrin Directly Couples Postsynaptic Calcium Signals to Actin Remodeling in Dendritic Spines Marina Mikhaylova, Julia Bär, Bas van Bommel, Philipp Schätzle,

More information

+ + + IP: Anti-Flag. Catalytic domain. Regulatory domain. Myr SH3 SH2 Kinase domain PP2. Flag-HK1. c-src ΔSH3. HK1 N-half: C-half:

+ + + IP: Anti-Flag. Catalytic domain. Regulatory domain. Myr SH3 SH2 Kinase domain PP2. Flag-HK1. c-src ΔSH3. HK1 N-half: C-half: a d h ΔSH2 Δ(SH3SH2) Myr SH3 SH2 Kinase domain 85 5 249 55 5 csrc ΔSH3 FlagHK HAcSrc HAcSrcΔSH2 HAcSrcΔSH3 HAcSrcΔ(SH3SH2) WB: FlagHK HAcSrc HAcSrcKD HAcSrcY529F WB: HisHK2HK2 Input GSTcSrc GST : : GST

More information


THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Research Foundation, 18 month progress report THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Ekaterina Ivanova, doctoral student Elena Levtchenko, MD, PhD, PI Antonella

More information


T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Lu et al., Figure S1. Kinetics of nuclear envelope assembly, recruitment of Nup133

More information

Lecture 7: Roles for MAGUKS in Activity-dependent Synaptogenesis MCP

Lecture 7: Roles for MAGUKS in Activity-dependent Synaptogenesis MCP Lecture 7: Roles for MAGUKS in Activity-dependent Synaptogenesis MCP 9.013 04 Po st -S yn ap (P ti SD c ) De ns it y PSD site en face.25 µm From: Kennedy (2000) Science MEMBRANE ASSOCIATED GUANYLATE KINASES

More information


Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

One of the primary actions of insulin on adipose and

One of the primary actions of insulin on adipose and DIABETES-INSULIN-GLUCAGON-GASTROINTESTINAL Rab5 Activity Regulates GLUT4 Sorting Into Insulin- Responsive and Non-Insulin-Responsive Endosomal Compartments: A Potential Mechanism for Development of Insulin

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information


T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Edens and Levy, T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton

More information

1) Drop off in the Bi 150 box outside Baxter 331 or to the head TA (jcolas).

1) Drop off in the Bi 150 box outside Baxter 331 or  to the head TA (jcolas). Bi/CNS/NB 150 Problem Set 3 Due: Tuesday, Oct. 27, at 4:30 pm Instructions: 1) Drop off in the Bi 150 box outside Baxter 331 or e-mail to the head TA (jcolas). 2) Submit with this cover page. 3) Use a

More information

PI3K class II α regulates δ-opioid receptor export from the trans-golgi network

PI3K class II α regulates δ-opioid receptor export from the trans-golgi network MBoC ARTICLE PI3K class II α regulates δ-opioid receptor export from the trans-golgi network Daniel J. Shiwarski a,b, Marlena Darr a, Cheryl A. Telmer a, Marcel P. Bruchez a,c,d, and Manojkumar A. Puthenveedu

More information

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Supplemental data A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, Zachary A. Knight, David D. Goldenberg, Wei Yu, Keith E. Mostov, David Stokoe, Kevan M. Shokat, and William

More information

Vesicular Trafficking of Semaphorin 3A is Activity- Dependent and Differs Between Axons and Dendrites

Vesicular Trafficking of Semaphorin 3A is Activity- Dependent and Differs Between Axons and Dendrites Traffic 6; 7: 6 77 Blackwell Munksgaard Copyright # Blackwell Munksgaard 6 doi:./j.6-854.6.44.x Vesicular Trafficking of Semaphorin A is Activity- Dependent and Differs Between Axons and Dendrites Joris

More information

Multiple Autism-Linked Genes Mediate Synapse Elimination via Proteasomal Degradation of a Synaptic Scaffold PSD-95

Multiple Autism-Linked Genes Mediate Synapse Elimination via Proteasomal Degradation of a Synaptic Scaffold PSD-95 Multiple Autism-Linked Genes Mediate Synapse Elimination via Proteasomal Degradation of a Synaptic Scaffold PSD-95 Nien-Pei Tsai, 1,4 Julia R. Wilkerson, 1,4 Weirui Guo, 1 Marina A. Maksimova, 1 George

More information

The role of the scaffolding protein Tks5 in EGF signaling

The role of the scaffolding protein Tks5 in EGF signaling The role of the scaffolding protein Tks5 in EGF signaling PhD Thesis Anna Fekete Doctoral School in Biology Head of the School: Dr. Anna Erdei Structural Biochemistry Doctoral Program Head of the Program:

More information

gliomas. Fetal brain expected who each low-

gliomas. Fetal brain expected who each low- Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for The adhesion molecule PECAM-1 enhances the TGF- mediated inhibition of T cell function Debra K. Newman,* Guoping Fu,

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo. Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from

More information

Cofilin is one crucial mediator of actin cytoskeletal dynamics

Cofilin is one crucial mediator of actin cytoskeletal dynamics Chronophin coordinates cell leading edge dynamics by controlling active cofilin levels Violaine Delorme-Walker a,b, Ji-Yeon Seo a,b, Antje Gohla c, Bruce Fowler a,b, Ben Bohl a,b, and Céline DerMardirossian

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Yanping Li, Maho Takahashi, and Philip J. S. Stork 1 From the Vollum Institute, Oregon Health and Science University, Portland, Oregon 97239

Yanping Li, Maho Takahashi, and Philip J. S. Stork 1 From the Vollum Institute, Oregon Health and Science University, Portland, Oregon 97239 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 38, pp. 27646 27657, September 20, 2013 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Ras-mutant Cancer

More information

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z. Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3

More information

Identification of Potential Tyrosine-containing Endocytic Motifs in the Carboxyl-tail and Seventh Transmembrane Domain of the Neurokinin 1 Receptor*

Identification of Potential Tyrosine-containing Endocytic Motifs in the Carboxyl-tail and Seventh Transmembrane Domain of the Neurokinin 1 Receptor* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 4, Issue of January 24, pp. 2363 2372, 1997 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Identification

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 Date :

More information

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours) A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin

More information

Cesarini et al., http :// /cgi /content /full /jcb /DC1

Cesarini et al., http :// /cgi /content /full /jcb /DC1 Supplemental material JCB Cesarini et al., http :// /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in

More information

CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and

CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and SUPPLEMENTAL FIGURES FIGURE S1. Detection of MCs. A, Schematic representation of T cells stimulated on anti- CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and microclusters.

More information

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles

Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Quantifying Lipid Contents in Enveloped Virus Particles with Plasmonic Nanoparticles Amin Feizpour Reinhard Lab Department of Chemistry and the Photonics Center, Boston University, Boston, MA May 2014

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells

Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Research article Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Paul T. Brinkkoetter, 1 Paul Olivier, 2 Jimmy S. Wu, 1 Scott Henderson, 1 Ronald D. Krofft,

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information


SLX4 + MUS81 SLX4 + GEN1 SLX4 CONTROL SLX4 GEN MUS8 GEN MUS8 GEN MUS8 GEN MUS8 GEN C LM MUS8 XPF (loading control) D H2AX Frequency of -positive bridges (% of anaphase cells) 6 4 2 p =.8 x -4 GM855 p =.27 PSNF5 E H2AX Figure S. Analysis of anaphase

More information

Supplementary Figure 1. Flies form water-reward memory only in the thirsty state

Supplementary Figure 1. Flies form water-reward memory only in the thirsty state 1 2 3 4 5 6 7 Supplementary Figure 1. Flies form water-reward memory only in the thirsty state Thirsty but not sated wild-type flies form robust 3 min memory. For the thirsty group, the flies were water-deprived

More information


EXPERIMENTAL PROCEDURES THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 11, pp. 8207 8217, March 12, 2010 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Mutual Regulation of

More information

Feedback Circuits Monitor and Adjust Basal Lck-Dependent Events in T Cell Receptor Signaling

Feedback Circuits Monitor and Adjust Basal Lck-Dependent Events in T Cell Receptor Signaling IMMUNOLOGY Feedback Circuits Monitor and Adjust Basal Lck-Dependent Events in T Cell Receptor Signaling Jamie R. Schoenborn, 1 * Ying Xim Tan, 1 Chao Zhang, 2 Kevan M. Shokat, 2,3 Arthur Weiss 1,3 The

More information

Supplementary Figures

Supplementary Figures Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

* Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA 15213, USA.

* Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA 15213, USA. PI3K Class II regulates δ-opioid Receptor Export from the trans-golgi Network Daniel J. Shiwarski*, Marlena Darr*, Cheryl A. Telmer*, Marcel P. Bruchez*, Manojkumar A. Puthenveedu* * Department of Biological

More information

Tetherin/BST-2 Antagonism by Nef Depends on a Direct Physical Interaction between Nef and Tetherin, and on Clathrin-mediated Endocytosis

Tetherin/BST-2 Antagonism by Nef Depends on a Direct Physical Interaction between Nef and Tetherin, and on Clathrin-mediated Endocytosis Tetherin/BST-2 Antagonism by Nef Depends on a Direct Physical Interaction between Nef and Tetherin, and on Clathrin-mediated Endocytosis The Harvard community has made this article openly available. Please

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

A Reciprocal Interdependence between Nck and PI(4,5)P 2 Promotes Localized N-WASp-Mediated Actin Polymerization in Living Cells

A Reciprocal Interdependence between Nck and PI(4,5)P 2 Promotes Localized N-WASp-Mediated Actin Polymerization in Living Cells Molecular Cell, Volume 36 Supplemental Data A Reciprocal Interdependence between Nck and PI(4,5)P 2 Promotes Localized N-WASp-Mediated Actin Polymerization in Living Cells Gonzalo M. Rivera, Dan Vasilescu,

More information

Recruitment of Actin Modifiers to TrkA Endosomes Governs Retrograde NGF Signaling and Survival

Recruitment of Actin Modifiers to TrkA Endosomes Governs Retrograde NGF Signaling and Survival Recruitment of Actin Modifiers to TrkA Endosomes Governs Retrograde Signaling and Survival Anthony W. Harrington, 1,3 Coryse St. Hillaire, 1,3 Larry S. Zweifel, 1,4 Natalia O. Glebova, 1,5 Polyxeni Philippidou,

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information