Supplementary information Disrupting ceramide-cd300f interaction prevents septic peritonitis by stimulating neutrophil recruitment
|
|
|
- Paul Wade
- 6 years ago
- Views:
Transcription
1 Supplementary information Disrupting ceramide-cd3f interaction prevents septic peritonitis by stimulating neutrophil recruitment Kumi Izawa 1,2, Akie Maehara 1,2, Masamichi Isobe 1,2, Yuka Yasuda 3, Makoto Urai 4, Yasutaka Hoshino 4, Keigo Ueno 4, Toshihiro Matsukawa 2,5, Mariko Takahashi 2, Ayako Kaitani 1,2, Emiko Shiba 1,6, Ayako Takamori 1, Shino Uchida 1,7, Koichiro Uchida 1, Keiko Maeda 1, Nobuhiro Nakano 1, Yoshinori Yamanishi 2,8, Toshihiko Oki 2, David Voehringer 9, Axel Roers 1, Susumu Nakae 11, Junko Ishikawa 3, Yuki Kinjo 4, Toshiaki Shimizu 1,6, Hideoki Ogawa 1, Ko Okumura 1, Toshio Kitamura 2 & Jiro Kitaura 1,2
2 Supplementary figure legends S1-S9 Figure S1. Concentrations of all and indicated ceramide species in plasma. Concentrations of all and indicated ceramide species in plasma before (n =3) or 4 h after a sham operation (n = 4) or CLP (n = 4) in WT mice. The data are expressed as mean ± SD. Figure S2. Disruption of ITIMs and ITSM of CD3f attenuated the inhibition of E. coli-stimulated mast cell activation. (a) Expression of c-kit, FcεRIα, or CD3f in CD3f -/- BMMCs transduced with CD3f WT, CD3f-Y241F/Y289F/Y325F mutant, or mock. (b,c) These BMMC transfectants were stimulated with 5 x 1 7 CFU/ml heat-killed E. coli on plates coated with ceramide, PC, or vehicle. Production of (b) the release of β-hexosaminidase or (c) KC. The data are representative of three independent experiments and are expressed as mean ± SD. *P <.1 (Student s t-test). Figure S3. Expression of CD11b, Gr-1, and CD3f in WT or CD3f -/- neutrophils. Neutrophils purified from WT or CD3f -/- BM were stained with an anti-cd11b Ab, anti-gr-1 Ab, or anti-cd3f Ab. The data are representative of three independent experiments. Figure S4. Neither CD3f expression nor ceramide-cd3f interaction significantly influenced bactericidal activity of neutrophils or BMMCs against E. coli. (a,b) Neutrophils (a) or (b) BMMCs were incubated with E. coli (4 x 1 5 cells per 1 6 CFU/ml) for 6 min on plates coated with the indicated lipids or vehicle. Numbers
3 of viable E. coli cells were estimated by colony-counting methods. The data are representative of three independent experiments and are expressed as mean ± SD. Figure S5. Transfusion of 1 7 WT or CD3f -/- neutrophils equally improved the survival of CLP-operated mice. CLP-operated WT mice were intraperitoneally injected with 1 7 WT or CD3f -/- neutrophils or PBS as a control (n = 6 per group) and were monitored regarding survival. *p <.1 compared to CLP-operated control mice; n.s.: not significant (long-rank test). Figure S6. Kit W-sh/W-sh mice reconstituted intraperitoneally with WT or CD3f -/- BMMCs had equivalent numbers of peritoneal mast cells. (a) Peritoneal lavage cells from Kit W-sh/W-sh mice that received a transplant of WT or CD3f -/- BMMCs were stained for FcεRI and c-kit to determine the percentage of mast cells among peritoneal lavage cells (upper). Surface expression levels of CD3f in FcεRI + c-kit + mast cell populations of peritoneal lavage cells (lower). (b) Numbers of mast cells among peritoneal lavage cells from Kit W-sh/W-sh mice that received a transplant of WT or CD3f -/- BMMCs (each, n = 7). The data are representative of two independent experiments. The data are expressed as mean ± SD. Figure S7. Mcpt5-Cre/R-DTA mice reconstituted intraperitoneally with WT or CD3f -/- BMMCs had equivalent numbers of peritoneal mast cells. Numbers of mast cells among peritoneal lavage cells from Mcpt5-Cre/R-DTA mice with a transplant of WT or CD3f -/- BMMCs (each, n = 5). The data are representative of two independent experiments and are expressed as mean and ± SD.
4 Figure S8. Reconstitution with CD3f -/- BMMCs increased the number of neutrophils recruited to the peritoneal cavity and improved survival in CLP-operated Kit W-sh/W-sh CD3f -/- mice. (a) Kit W-sh/W-sh CD3f -/- mice that had received an intraperitoneal transplant of WT or CD3f -/- BMMCs (n = 11 per genotype) or were injected with PBS (n = 3) were subjected to CLP and monitored regarding survival; *p <.1 compared to the mice with a transplant of CD3f -/- BMMCs. (b) Numbers of neutrophils recruited into the peritoneal cavity (n = 4 per group). The data are expressed as mean ± SD; *p <.1 (Student s t-test). The data are representative of two independent experiments. (c) Numbers of mast cells among peritoneal lavage cells from Kit W-sh/W-sh CD3f -/- mice with a transplant of WT or CD3f -/- BMMCs (each, n = 6). The data are representative of two independent experiments. The data are expressed as mean ± SD. Figure S9. Transfusion of WT or CD3f -/- BM-derived macrophages equally improved the survival of macrophage-depleted WT mice after CLP. Macrophage-depleted WT mice were intravenously injected with 1 6 WT or CD3f -/- or PBS as a control (n = 7 per group) 6 h before CLP induction and were monitored regarding survival. *p <.1 compared to CLP-operated control mice; n.s.: not significant (long-rank test).
5 Supplementary Fig. S1 Total ceramide (ng/ml) Total ceramide (ng/ml) Plasma normal Sham-4 sham-4hrh CLP-4hr h Ceramide (ng/ml) d18:1/16: d18:1/18: d18:1/2: normal Sham-4 sham-4hrh CLP-4hr h d18:1/22: d18:1/24: d18:1/24:1 Plasma
6 Supplementary Fig. S2 A mock CD3f-WT CD3f-YF B β-hexosaminidase release (%) c-kit FcεRI CD3f * KO-MC (-) Cer PC mock Mock CD3f-WT LMIR3(WT) CD3f-YF LMIR3(YF) C KC (pg/ml) 35 3 * vehicle ceramide PC vehicle (-) ceramide Cer PC KO-MC Mock mock LMIR3(WT) CD3f-WT LMIR3(YF) CD3f-YF
7 Supplementary Fig. S3 WT neutrophils KO neutrophils Gr CD11b CD3f
8 Supplementary Fig. S4 A PBS WT-neutrophils KO-neutrophils 1 B 1 PBS WT-MC KO-MC KO-MC 1 CFU CFU 1 1 CFU CFU MetOH Cer PC PS MetOH Cer PC PS Vehicle ceramide PC PS vehicle ceramide PC PS
9 Supplementary Fig. S5 Percent Survival survival (%) *p <.1 *p <.1 WT PBS+ PBS (n = 6) WT Cd3lf + WT +/+ - neutrophils (1 7 ) (n = 6) WT Cd3lf + KO-neutrophils -/- (1 7 ) (n = 6) n.s Days after CLP
10 Supplementary Fig. S6 A c-kit Kit Wsh/Wsh % Kit W-sh/W-sh + WT-MC FcεRI 1 8 Kit W-sh/W-sh + KO-MC B Percentage of c-kit + FcεRI + cells (/peritoneal cavity) Kit WT W-sh/W-sh + WT-MC Kit KO W-sh/W-sh + KO-MC CD3f
11 Supplementary Fig. S7 Percentage of c-kit + FcεRI + cells (/peritoneal cavity) WT-MC KO-MC Mcpt5-Cre/R-DTA
12 Supplementary Fig. S8 A Survival (%) (%) Kit W-sh/W-sh CD3f -/- (n = 3) Kit W-sh/W-sh CD3f -/- + WT-MC (n = 11) Kit W-sh/W-sh CD3f -/- + KO-MC (n = 11) *p <.1 B CD11b + Gr-1 high cells (x1 6 cells/peritoneal cavity) * Days Days after after CLP CLP PBS WT-MC KO-MC Kit W-sh/W-sh CD3f -/- C Percentage of c-kit + FcεRI + cells (/peritoneal cavity) WT-MC KO-MC Kit W-sh/W-sh CD3f -/-
13 Supplementary Fig. S9 Survival (%) clodronate ΜΦ-depleted WT (n = 7) clodronate+wt-mf ΜΦ-depleted + WT-ΜΦ (n = 7) clodronate+ko-mf ΜΦ-depleted WT + KO-ΜΦ (n = 7) *p <.1 *p <.1 n.s Days after mild CLP
Ceramide-CD300f binding inhibits lipopolysaccharide-induced skin inflammation
Ceramide-CD3f binding inhibits lipopolysaccharide-induced skin inflammation Emiko Shiba ǂ, Kumi Izawa ǂ, Ayako Kaitani ǂ, Masamichi Isobe ǂ, Akie Maehara ǂ, Koichiro Uchida ǂ, Keiko Maeda ǂ, Nobuhiro Nakano
crossmark Edited by Luke O Neill
crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 292, NO. 7, pp. 2924 2932, February 17, 2017 Author s Choice 2017 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
In vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay
In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.
Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
MPO-KO MPO-KO , NADPH. O 2, , MPO-KO 5. HOCl, H 2 O 2., MPO, MPO-KO. HOCl. ., MPO-KO 3., MPO MPO 1, 2. MPO, ., Candida albicans ATCC O 2, MPO-KO
Jpn. J. Med. Mycol. Vol. 47, 195 199, 26 ISSN 916 484 MPO,. MPO MPO-KO,. MPO-KO., C. albicans,, MPO-KO 5., A. fumigatus, C. tropicalis, T. asahii 2,. MPO-KO C. neoformans 7, 3., MPO., MPO-KO C. albicans
February 14, 2003 Report on preclinical studies in gc-ko mice Fabio Candotti
February 14, 2003 Report on preclinical studies in gc-ko mice Fabio Candotti Five published reports (see details below) have described the development of peripheral blood lymphocytes as well as cellular
Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c)
1 Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c) Serum IgG1 (a), IgM (b) and IgG2 (c) concentrations in response to papain immediately before primary immunization (day
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Inhibitory Immunoreceptors on Mast Cells in Allergy and Inflammation
Inhibitory Immunoreceptors on Mast Cells in Allergy and Inflammation Akira Shibuya, Chigusa Nakahashi-Oda, and Satoko Tahara-Hanaoka Abstract Activation of immune cells is regulated by positive and negative
Supplementary table I. Real-time primers used in the study. The fold change was obtained by
Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
Nature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
Nature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
Supplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
a surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells
a CD11c Na + K + ATPase Na + K + ATPase CD11c x-y CD11c Na + K + ATPase Na + K + ATPase CD11c x-z c b x-y view BoNT NAPs CD11c BoNT CD11c NAPs BoNT NAPs CD11c 90 x-z view Apical Basolateral Supplementary
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Heat-killed Lactobacillus casei
Heat-killed Lactobacillus casei confers broad protection against influenza A virus primary infection and develops heterosubtypic immunity against future secondary infection Yu-Jin Jung, Young-Tae Lee,
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Regulation of Type 2 Immunity by Basophils Prof. Dr. David Voehringer
Regulation of Type 2 Immunity by Basophils Department of Infection Biology Institute of Clinical Microbiology, Immunology and Hygiene Outline of the presentation The concept of type 2 immunity Basophil
Supplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
Supplementary Information
Supplementary Information Distinct bone marrow-derived and tissue resident macrophage lineages proliferate at key stages during inflammation. 1 Luke C. Davies, 1 Marcela Rosas, 2 Stephen J. Jenkins, 1
Supplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15
Cell Host & Microbe, Volume 15 Supplemental Information Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection Arya Khosravi, Alberto Yáñez, Jeremy G. Price, Andrew Chow, Miriam Merad, Helen
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
fig. S1 Gene silencing of LC3B by sirna enhances IL-1β secretion. Peritoneal
15 Scramble sirna LC3B sirna IL-1β (pg/ml) 1 5 LC3B (kda) - 18 (LC3B I) - 16 (LC3B II) β-actin - 42 ( _ ) LPS LPS ATP fig. S1 Gene silencing of LC3B by sirna enhances IL-1β secretion. Peritoneal macrophages
Supplementary information
Supplementary information Supplementary Figure S1: Ex[Ca 2+ ]-induced IL-1ß production of monocytes primed with different TLR ligands IL-1ß release of CD14+ monocytes in response to stimulation for 16
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik
SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
Supplemental Figure 1. Protein L
Supplemental Figure 1 Protein L m19delta T m1928z T Suppl. Fig 1. Expression of CAR: B6-derived T cells were transduced with m19delta (left) and m1928z (right) to generate CAR T cells and transduction
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
Supplementary Material
Supplementary Material Taghon, Yui, and Rothenberg: Mast cell diversion of T-lineage precursor cells by the essential T-lineage transcription factor GATA Supplemental Table Supplemental Figures 1-6 Supplemental
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
Reviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In the manuscript Rational Combination of CXCL11-Expressing Oncolytic Virus and PD-L1 Blockade Works Synergistically to Enhance Therapeutic Efficacy
Felix Yarovinsky. Department of Immunology, UT Southwestern Medical Center. Innate immune defense to Toxoplasma gondii
Felix Yarovinsky Department of Immunology, UT Southwestern Medical Center Innate immune defense to Toxoplasma gondii Pathogen recognition by innate immune cells Pathogen Parasites Viruses Bacteria Initiator
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
Supplementary Figure 1. Tamoxifen does not promote chemotaxis or chemokinesis in the absence of additional stimulation. Transwell chemotaxis assays
Supplementary Figure 1. Tamoxifen does not promote chemotaxis or chemokinesis in the absence of additional stimulation. Transwell chemotaxis assays revealed that tamoxifen treatment alone did not stimulate
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
Expanded View Figures
Gregory T Ellis et al Lung damage by monocyte TRIL allows coinfection EMO reports Expanded View Figures % survival Clinical score Influenza Matrix /HPRT (log ) CFU/L (log ) 3 irway early.7.7 + h Survival
SUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.
Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
WT Xid (h) poly(da:dt) Alum. Poly(dA:dT) 0.05
IL1 (ng/ml) (1 x 1 3 cells) DMSO LFMA13 R46 IL1 (ng/ml) Control shrna TNFa (ng/ml) Alum Nigericin ATP IL1 (ng/ml) IL1 (ng/ml) IL1 (ng/ml) a c f 3 2 1 1 8 6 4 2 Sup 1 8 6 4 DMSO Alum/DMSO Alum/LFMA13 ***
Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
Supplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11351 a 3.. b 3.. #$%&%&'()(%$ #:=>,3 >3. 3.. 2. 1. 0. /.. 45 68,9:5 9:+&' 9:+&' ;555< c 3.. #$%&%&'()(%$ 2. 1. 0. /.. *+ #$%,-, &'$(,-, &)*+,,-, 2. 2. #$%&%&'()(%$
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Supporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
NK cells promote neutrophil recruitment in the brain during sepsisinduced. neuroinflammation
NK cells promote neutrophil recruitment in the brain during sepsisinduced neuroinflammation Hao He 1, Tingting Geng 1, Piyun Chen 1, Meixiang Wang 1, Jingxia Hu 1, Li Kang 1, Wengang Song 1, * & Hua Tang
Nature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
Supplementary material page 1/10
Supplementary Figure 1. Metoprolol administration during ongoing AMI reduces MVO in STEMI patients (a, b) Complete representative CMR exams (short-axis covering the entire left ventricle (LV) from base
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in
T u m o r v o lu m e (m m 3 ) P e rc e n t s u rv iv a l P e rc e n t s u rv iv a l Supplementary data a 1 8 6 4 2 5 1 1 5 2 2 5 3 3 5 4 T im e a fte r tu m o r in o c u la tio n (d ) b c 1 5 1 1 5 * *
Online Data Supplement. Induction of Pulmonary Granuloma Formation by Propionibacterium acnes is regulated by. MyD88 and Nox2
Online Data Supplement Induction of Pulmonary Granuloma Formation by Propionibacterium acnes is regulated by MyD88 and Nox2 Jessica L. Werner *, Sylvia G. Escolero *, Jeff T. Hewlett *, Tim N. Mak *3,