Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice."

Transcription

1 Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or 1 mg/kg of D4F (D4F group) per day by intraperitoneal injection during the final 6 weeks. Male C57BL/6J mice were maintained on normal chow diet as a control group. (A) Body weights of mice at 0, 4 and 8 weeks. (B) Levels of serum total cholesterol (TC), high density lipoprotein-cholesterol (HDL-C) and triglyceride (TG) in mice at the end of experiment. Non-HDL-C was calculated as TC minus HDL-C. Data are presented as the mean ± SEM of at least eight independent experiments. **P<0.01 versus control group. Supplementary Figure S II: D4F reduces the upregulation of CHOP and CD36 in atherosclerotic lesions of apoe -/- mice. Mice were treated as described in Supplementary Figure S I. (A) Representative immunostained aortic sinus sections using specific antibodies against MOMA-2, CHOP and CD36. Scale bar = 50 μm. (B) Densitometric quantification of MOMA-2, CHOP and CD36 positive cells per field of view. Data are presented as the mean ± SEM of at least three independent experiments. #P<0.05 versus model group. Supplementary Figure S III: D4F attenuates TM-induced apoptosis in RAW264.7 cells. Cells were pretreated with D4F (50 mg/l) for 1 h, followed by incubation with TM (4 mg/l) for 24 h, and then cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). Data are expressed as the mean ± SEM of six independent experiments. *P<0.05, **P<0.01 versus control group; &P<0.05 versus TM group. Supplementary Figure S IV: The inhibitory effects of D4F on ox-ldl-induced macrophage 1

2 apoptosis, caspase-3 activation and CHOP upregulatin were promoted by PBA and blocked by TM. RAW264.7 cells were pretreated with D4F (50 mg/l) for 1 h, washed and followed by treatment with PBA (5 mmol/l) or TM (4 mg/l) for 1 h, and then incubated with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected by TUNEL assay. Scale bar =20 µm. (B) Caspase-3 activity was determined by colorimetric assay. (C) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group. Supplementary Figure S V: D4F inhibits TM-induced mrna upregulation of CHOP and GRP78 in RAW264.7 cells. Cells were pretreated with D4F (50 mg/l) or sd4f (50 mg/l) in the presence of TM (4 mg/l) treatment for 24 h, and then mrna levels of CHOP and GRP78 were evaluated by quantitative real-time PCR. Data are expressed as the mean ± SEM of at least four independent experiments. *P<0.05, **P<0.01 versus control group; &P<0.05 versus TM group. Supplementary Figure S VI: D4F inhibits ox-ldl-induced apoptosis and CHOP upregulation in mouse peritoneal macrophages. Peritoneal macrophages from C57BL/6J mice were harvested with PBS 3 days after intraperitoneal injection with 1 ml of 4% thioglycollate and maintained in DMEM with 10% FBS. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). (B) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group; #P<0.05 2

3 versus ox-ldl group. Supplementary Figure S VII: D4F inhibits ox-ldl-induced apoptosis and CHOP upregulation in human THP-1-derived macrophages. THP-1 cells were treated with Phorbol 12-myristate 13-acetate (PMA, 100 nm) for 3 days to induce a macrophage phenotype of differentiation. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected by TUNEL assay. Scale bar =20 µm. (B) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. **P<0.01 versus control group; #P<0.05, ##P<0.01 versus ox-ldl group. Supplementary Figure S VIII: CD36 silencing does not promote significantly the inhibitory effects of D4F on ox-ldl-induced apoptosis and CHOP upregulation. RAW264.7 cells were transfected with a sirna against CD36 or a negative control sirna for 48 h, and then the cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). (B) Caspase-3 activity was determined by colorimetric assay. (C) Western blot analysis of CHOP. (D) The silencing of CD36 was validated by Western blot. Data are expressed as mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group transfected with con-sirna; #P<0.05, ##P<0.01 versus ox-ldl group transfected with con-sirna. NS indicates no significant difference. The sirna sequences of CD36 sirna are 5' -GAAUUU GUCCUAUUGGCCAdTdT-3' (Forward) and 5' -UGGCCAAUAGGACAAAUUCdTdT-3' (Reverse). 3

4 Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or 1 mg/kg of D4F (D4F group) per day by intraperitoneal injection during the final 6 weeks. Male C57BL/6J mice were maintained on normal chow diet as a control group. (A) Body weights of mice at 0, 4 and 8 weeks. (B) Levels of serum total cholesterol (TC), high density lipoprotein-cholesterol (HDL-C) and triglyceride (TG) in mice at the end of experiment. Non-HDL-C was calculated as TC minus HDL-C. Data are presented as the mean ± SEM of at least eight independent experiments. **P<0.01 versus control group. Supplementary Figure S II: D4F reduces the upregulation of CHOP and CD36 in atherosclerotic lesions of apoe -/- mice. Mice were treated as described in Supplementary Figure S I. (A) Representative immunostained aortic sinus sections using specific antibodies against MOMA-2, CHOP and CD36. Scale bar = 50 μm. (B) Densitometric quantification of MOMA-2, CHOP and CD36 positive cells per field of view. Data are presented as the mean ± SEM of at least three independent experiments. #P<0.05 versus model group. 4

5 Supplementary Figure S III: D4F attenuates TM-induced apoptosis in RAW264.7 cells. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with TM (4 mg/l) for 24 h. Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). Data are expressed as the mean ± SEM of six independent experiments. *P<0.05, **P<0.01 versus control group; &P<0.05 versus TM group. 5

6 Supplementary Figure S IV: The inhibitory effects of D4F on ox-ldl-induced macrophage apoptosis, caspase-3 activation and CHOP upregulatin were promoted by PBA and blocked by TM. RAW264.7 cells were pretreated with D4F (50 mg/l) for 1 h, washed and followed by treatment with PBA (5 mmol/l) or TM (4 mg/l) for 1 h, and then incubated with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected by TUNEL assay. Scale bar =20 µm. (B) Caspase-3 activity was determined by colorimetric assay. (C) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group. 6

7 Supplementary Figure S V: D4F inhibits TM-induced mrna upregulation of CHOP and GRP78 in RAW264.7 cells. Cells were pretreated with D4F (50 mg/l) or sd4f (50 mg/l) in the presence of TM (4 mg/l) treatment for 24 h, and then mrna levels of CHOP and GRP78 were evaluated by quantitative real-time PCR. Data are expressed as the mean ± SEM of at least four independent experiments. *P<0.05, **P<0.01 versus control group; &P<0.05 versus TM group. 7

8 Supplementary Figure S VI: D4F inhibits ox-ldl-induced apoptosis and CHOP upregulation in mouse peritoneal macrophages. Peritoneal macrophages from C57BL/6J mice were harvested with PBS 3 days after intraperitoneal injection with 1 ml of 4% thioglycollate and maintained in DMEM with 10% FBS. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). (B) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group; #P<0.05 versus ox-ldl group. 8

9 Supplementary Figure S VII: D4F inhibits ox-ldl-induced apoptosis and CHOP upregulation in human THP-1-derived macrophages. THP-1 cells were treated with Phorbol 12-myristate 13-acetate (PMA, 100 nm) for 3 days to induce a macrophage phenotype of differentiation. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected by TUNEL assay. Scale bar =20 µm. (B) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. **P<0.01 versus control group; #P<0.05, ##P<0.01 versus ox-ldl group. 9

10 Supplementary Figure S VIII: CD36 silencing does not promote significantly the inhibitory effects of D4F on ox-ldl-induced apoptosis and CHOP upregulation. RAW264.7 cells were transfected with a sirna against CD36 or a negative control sirna for 48 h, and then the cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). (B) Caspase-3 activity was determined by colorimetric assay. (C) Western blot analysis of CHOP. (D) The silencing of CD36 was validated by Western blot. Data are expressed as mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group transfected with con-sirna; #P<0.05, ##P<0.01 versus ox-ldl group transfected with con-sirna. NS indicates no significant difference. The sirna sequences of CD36 sirna are 5' -GAAUUU GUCCUAUUGGCCAdTdT-3' (Forward) and 5' -UGGCCAAUAGGACAAAUUCdTdT-3' (Reverse). 10

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale i: Primers used for RT-PCR. References are provided under Source, except for primers

More information

The Annexin V Apoptosis Assay

The Annexin V Apoptosis Assay The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Calcium/calmodulin-dependent protein kinase II links ER stress with Fas and mitochondrial apoptosis pathways

Calcium/calmodulin-dependent protein kinase II links ER stress with Fas and mitochondrial apoptosis pathways Research article Calcium/calmodulin-dependent protein kinase II links ER stress with Fas and mitochondrial apoptosis pathways Jenelle M. Timmins, 1 Lale Ozcan, 1 Tracie A. Seimon, 1 Gang Li, 1 Cristina

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,

More information

Molecular Medicine. Gut Microbiota Metabolism of Anthocyanin Promotes Reverse Cholesterol Transport in Mice Via Repressing mirna-10b

Molecular Medicine. Gut Microbiota Metabolism of Anthocyanin Promotes Reverse Cholesterol Transport in Mice Via Repressing mirna-10b Molecular Medicine Gut Microbiota Metabolism of Anthocyanin Promotes Reverse Cholesterol Transport in Mice Via Repressing mirna-10b Dongliang Wang, Min Xia, Xiao Yan, Dan Li, Lei Wang, Yuxuan Xu, Tianru

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

PCSK9 RNAi Therapeutics. Kevin FitzGerald

PCSK9 RNAi Therapeutics. Kevin FitzGerald PCSK9 RNAi Therapeutics Kevin FitzGerald Presenter Disclosure Information PSCK9 RNAi Therapeutics The following relationships exist related to this presentation:» Kevin Fitzgerald and Alnylam team members:

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Research Article Silence of NLRP3 Suppresses Atherosclerosis and Stabilizes Plaques in Apolipoprotein E-Deficient Mice

Research Article Silence of NLRP3 Suppresses Atherosclerosis and Stabilizes Plaques in Apolipoprotein E-Deficient Mice Mediators of Inflammation, Article ID 5728, 8 pages http://dx.doi.org/1.1155/214/5728 Research Article Silence of NLRP3 Suppresses Atherosclerosis and Stabilizes Plaques in Apolipoprotein E-Deficient Mice

More information

Suppressed monocyte recruitment drives macrophage removal from atherosclerotic plaques of Apoe / mice during disease regression

Suppressed monocyte recruitment drives macrophage removal from atherosclerotic plaques of Apoe / mice during disease regression Research article Suppressed monocyte recruitment drives macrophage removal from atherosclerotic plaques of Apoe / mice during disease regression Stephane Potteaux, 1 Emmanuel L. Gautier, 1 Susan B. Hutchison,

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR

Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA

More information

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Author's response to reviews Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Authors: Yan Zhang (zhangy2@sysucc.org.cn) Chun-Fang

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding

More information

The Bile Acid Sensor FXR Protects against Dyslipidemia and Aortic Plaques Development Induced by the HIV Protease Inhibitor Ritonavir in Mice

The Bile Acid Sensor FXR Protects against Dyslipidemia and Aortic Plaques Development Induced by the HIV Protease Inhibitor Ritonavir in Mice The Bile Acid Sensor FXR Protects against Dyslipidemia and Aortic Plaques Development Induced by the HIV Protease Inhibitor Ritonavir in Mice Andrea Mencarelli 1, Sabrina Cipriani 1, Barbara Renga 1, Daniela

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

The pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas

The pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas Received 9 Aug 3 Accepted Nov 3 Published 7 Jan DOI:.38/ncomms39 The pseudogene promotes TUSC function by binding multiple micrornas OPEN Zina Jeyapalan Rutnam,, *, William W. Du,, *, Weining Yang, Xiangling

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary

More information

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Research article Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Barbara Onnis, 1 Nicole Fer, 2 Annamaria Rapisarda, 2 Victor S. Perez, 1 and Giovanni Melillo 2 1 Developmental

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol

More information

Pathophysiology of Lipid Disorders

Pathophysiology of Lipid Disorders Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

SITA 100 mg (n = 378)

SITA 100 mg (n = 378) Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)

More information

Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma

Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma The Harvard community has made this article openly available. Please share

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE

BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE BIOFENOLI ED INIBIZIONE DELL UPTAKE DI oxldl DA PARTE DI CELLULE MACROFAGICHE UMANE E MURINE Roberta Di Benedetto Centro Nazionale per la Qualità degli Alimenti e per i Rischi Alimentari Istituto Superiore

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),

More information

Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator

Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator INCUCYTE LIVE-CELL ANALYSIS SYSTEM Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator See what your cells are doing and when they

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

ab LDL Uptake Assay Kit (Cell-Based)

ab LDL Uptake Assay Kit (Cell-Based) ab133127 LDL Uptake Assay Kit (Cell-Based) Instructions for Use For the detection of LDL uptake into cultured cells. This product is for research use only and is not intended for diagnostic use. Version

More information

Linli Yao 1,3, Enci Mary Kan 2, Jia Lu 2, Aijun Hao 1, S Thameem Dheen 3, Charanjit Kaur 3* and Eng-Ang Ling 3* JOURNAL OF NEUROINFLAMMATION

Linli Yao 1,3, Enci Mary Kan 2, Jia Lu 2, Aijun Hao 1, S Thameem Dheen 3, Charanjit Kaur 3* and Eng-Ang Ling 3* JOURNAL OF NEUROINFLAMMATION Yao et al. Journal of Neuroinflammation 2013, 10:23 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access Toll-like receptor 4 mediates microglial activation and production of inflammatory mediators in neonatal

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

(a) y = 1.0x + 0.0; r = ; N = 60 (b) y = 1.0x + 0.0; r = ; N = Lot 1, Li-heparin whole blood, HbA1c (%)

(a) y = 1.0x + 0.0; r = ; N = 60 (b) y = 1.0x + 0.0; r = ; N = Lot 1, Li-heparin whole blood, HbA1c (%) cobas b system - performance evaluation Study report from a multicenter evaluation of the new cobas b system for the measurement of HbAc and lipid panel Introduction The new cobas b system provides a point-of-care

More information

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations Title VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body Authors Hideaki Yamamoto 1, Tappei Takada 1 *, Yoshihide Yamanashi 1, Masatsune Ogura 2, Yusuke Masuo

More information

ALKA VITA DIABETES TEST

ALKA VITA DIABETES TEST ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O

More information

Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI

Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI Biochemical Analysis (Lipid Panel) Analyte Total Cholesterol Reference Range Patient A < 200 241 LDL-C /= 40 38 Triglycerides

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures and Figure Legends Supplementary Figure 1 A. HDL-C (mg/dl) 14 12 1 8 6 4 2 Noncarriers HDL Cholesterol **** Carriers B. apoa-i (mg/dl) 325 3 275 25 225 2

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

Normal ldl cholesterol levels for men over 50

Normal ldl cholesterol levels for men over 50 Normal ldl cholesterol levels for men over 50 Aug 14, 2017. Thus, the healthy bad cholesterol numbers for younger people are significantly lower because the risk charts figure their numbers will rise.

More information

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information