Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
|
|
- Jack Lucas
- 6 years ago
- Views:
Transcription
1 Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or 1 mg/kg of D4F (D4F group) per day by intraperitoneal injection during the final 6 weeks. Male C57BL/6J mice were maintained on normal chow diet as a control group. (A) Body weights of mice at 0, 4 and 8 weeks. (B) Levels of serum total cholesterol (TC), high density lipoprotein-cholesterol (HDL-C) and triglyceride (TG) in mice at the end of experiment. Non-HDL-C was calculated as TC minus HDL-C. Data are presented as the mean ± SEM of at least eight independent experiments. **P<0.01 versus control group. Supplementary Figure S II: D4F reduces the upregulation of CHOP and CD36 in atherosclerotic lesions of apoe -/- mice. Mice were treated as described in Supplementary Figure S I. (A) Representative immunostained aortic sinus sections using specific antibodies against MOMA-2, CHOP and CD36. Scale bar = 50 μm. (B) Densitometric quantification of MOMA-2, CHOP and CD36 positive cells per field of view. Data are presented as the mean ± SEM of at least three independent experiments. #P<0.05 versus model group. Supplementary Figure S III: D4F attenuates TM-induced apoptosis in RAW264.7 cells. Cells were pretreated with D4F (50 mg/l) for 1 h, followed by incubation with TM (4 mg/l) for 24 h, and then cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). Data are expressed as the mean ± SEM of six independent experiments. *P<0.05, **P<0.01 versus control group; &P<0.05 versus TM group. Supplementary Figure S IV: The inhibitory effects of D4F on ox-ldl-induced macrophage 1
2 apoptosis, caspase-3 activation and CHOP upregulatin were promoted by PBA and blocked by TM. RAW264.7 cells were pretreated with D4F (50 mg/l) for 1 h, washed and followed by treatment with PBA (5 mmol/l) or TM (4 mg/l) for 1 h, and then incubated with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected by TUNEL assay. Scale bar =20 µm. (B) Caspase-3 activity was determined by colorimetric assay. (C) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group. Supplementary Figure S V: D4F inhibits TM-induced mrna upregulation of CHOP and GRP78 in RAW264.7 cells. Cells were pretreated with D4F (50 mg/l) or sd4f (50 mg/l) in the presence of TM (4 mg/l) treatment for 24 h, and then mrna levels of CHOP and GRP78 were evaluated by quantitative real-time PCR. Data are expressed as the mean ± SEM of at least four independent experiments. *P<0.05, **P<0.01 versus control group; &P<0.05 versus TM group. Supplementary Figure S VI: D4F inhibits ox-ldl-induced apoptosis and CHOP upregulation in mouse peritoneal macrophages. Peritoneal macrophages from C57BL/6J mice were harvested with PBS 3 days after intraperitoneal injection with 1 ml of 4% thioglycollate and maintained in DMEM with 10% FBS. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). (B) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group; #P<0.05 2
3 versus ox-ldl group. Supplementary Figure S VII: D4F inhibits ox-ldl-induced apoptosis and CHOP upregulation in human THP-1-derived macrophages. THP-1 cells were treated with Phorbol 12-myristate 13-acetate (PMA, 100 nm) for 3 days to induce a macrophage phenotype of differentiation. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected by TUNEL assay. Scale bar =20 µm. (B) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. **P<0.01 versus control group; #P<0.05, ##P<0.01 versus ox-ldl group. Supplementary Figure S VIII: CD36 silencing does not promote significantly the inhibitory effects of D4F on ox-ldl-induced apoptosis and CHOP upregulation. RAW264.7 cells were transfected with a sirna against CD36 or a negative control sirna for 48 h, and then the cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). (B) Caspase-3 activity was determined by colorimetric assay. (C) Western blot analysis of CHOP. (D) The silencing of CD36 was validated by Western blot. Data are expressed as mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group transfected with con-sirna; #P<0.05, ##P<0.01 versus ox-ldl group transfected with con-sirna. NS indicates no significant difference. The sirna sequences of CD36 sirna are 5' -GAAUUU GUCCUAUUGGCCAdTdT-3' (Forward) and 5' -UGGCCAAUAGGACAAAUUCdTdT-3' (Reverse). 3
4 Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or 1 mg/kg of D4F (D4F group) per day by intraperitoneal injection during the final 6 weeks. Male C57BL/6J mice were maintained on normal chow diet as a control group. (A) Body weights of mice at 0, 4 and 8 weeks. (B) Levels of serum total cholesterol (TC), high density lipoprotein-cholesterol (HDL-C) and triglyceride (TG) in mice at the end of experiment. Non-HDL-C was calculated as TC minus HDL-C. Data are presented as the mean ± SEM of at least eight independent experiments. **P<0.01 versus control group. Supplementary Figure S II: D4F reduces the upregulation of CHOP and CD36 in atherosclerotic lesions of apoe -/- mice. Mice were treated as described in Supplementary Figure S I. (A) Representative immunostained aortic sinus sections using specific antibodies against MOMA-2, CHOP and CD36. Scale bar = 50 μm. (B) Densitometric quantification of MOMA-2, CHOP and CD36 positive cells per field of view. Data are presented as the mean ± SEM of at least three independent experiments. #P<0.05 versus model group. 4
5 Supplementary Figure S III: D4F attenuates TM-induced apoptosis in RAW264.7 cells. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with TM (4 mg/l) for 24 h. Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). Data are expressed as the mean ± SEM of six independent experiments. *P<0.05, **P<0.01 versus control group; &P<0.05 versus TM group. 5
6 Supplementary Figure S IV: The inhibitory effects of D4F on ox-ldl-induced macrophage apoptosis, caspase-3 activation and CHOP upregulatin were promoted by PBA and blocked by TM. RAW264.7 cells were pretreated with D4F (50 mg/l) for 1 h, washed and followed by treatment with PBA (5 mmol/l) or TM (4 mg/l) for 1 h, and then incubated with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected by TUNEL assay. Scale bar =20 µm. (B) Caspase-3 activity was determined by colorimetric assay. (C) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group. 6
7 Supplementary Figure S V: D4F inhibits TM-induced mrna upregulation of CHOP and GRP78 in RAW264.7 cells. Cells were pretreated with D4F (50 mg/l) or sd4f (50 mg/l) in the presence of TM (4 mg/l) treatment for 24 h, and then mrna levels of CHOP and GRP78 were evaluated by quantitative real-time PCR. Data are expressed as the mean ± SEM of at least four independent experiments. *P<0.05, **P<0.01 versus control group; &P<0.05 versus TM group. 7
8 Supplementary Figure S VI: D4F inhibits ox-ldl-induced apoptosis and CHOP upregulation in mouse peritoneal macrophages. Peritoneal macrophages from C57BL/6J mice were harvested with PBS 3 days after intraperitoneal injection with 1 ml of 4% thioglycollate and maintained in DMEM with 10% FBS. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). (B) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group; #P<0.05 versus ox-ldl group. 8
9 Supplementary Figure S VII: D4F inhibits ox-ldl-induced apoptosis and CHOP upregulation in human THP-1-derived macrophages. THP-1 cells were treated with Phorbol 12-myristate 13-acetate (PMA, 100 nm) for 3 days to induce a macrophage phenotype of differentiation. Cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected by TUNEL assay. Scale bar =20 µm. (B) Western blot analysis of CHOP. Data are expressed as the mean ± SEM of at least three independent experiments. **P<0.01 versus control group; #P<0.05, ##P<0.01 versus ox-ldl group. 9
10 Supplementary Figure S VIII: CD36 silencing does not promote significantly the inhibitory effects of D4F on ox-ldl-induced apoptosis and CHOP upregulation. RAW264.7 cells were transfected with a sirna against CD36 or a negative control sirna for 48 h, and then the cells were pretreated with D4F (50 mg/l) for 1 h, washed and then followed by incubation with ox-ldl (100 mg/l) for 24 h. (A) Cell apoptosis was detected using flow cytometry and the total apoptotic cells (early and late-stage apoptosis) were represented by the right side of the panel (Annexin V staining alone or together with PI). (B) Caspase-3 activity was determined by colorimetric assay. (C) Western blot analysis of CHOP. (D) The silencing of CD36 was validated by Western blot. Data are expressed as mean ± SEM of at least three independent experiments. *P<0.05, **P<0.01 versus control group transfected with con-sirna; #P<0.05, ##P<0.01 versus ox-ldl group transfected with con-sirna. NS indicates no significant difference. The sirna sequences of CD36 sirna are 5' -GAAUUU GUCCUAUUGGCCAdTdT-3' (Forward) and 5' -UGGCCAAUAGGACAAAUUCdTdT-3' (Reverse). 10
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationSupplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
More informationMcAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.
Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationNature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
More informationSupplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationa. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationEffective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationLPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSupplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationDifferential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ
Research article Related Commentary, page 1538 Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Andrew C. Li, 1 Christoph J. Binder, 2 Alejandra
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More informationSupporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationSupplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationSupplementary Figures
Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1
More informationFang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationSupplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
More informationFigure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
More informationSUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationSupplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
More informationSupplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution
Immunity, Volume 9 Supplemental Information Regulatory T Cells Promote Macrophage Efferocytosis during Inflammation Resolution Jonathan D. Proto, Amanda C. Doran, Galina Gusarova, Arif Yurdagul Jr., Erdi
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationControl GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
More informationD4F alleviates macrophage-derived foam cell apoptosis by inhibiting CD36 expression
D4F alleviates macrophage-derived foam cell apoptosis by inhibiting CD36 expression and endoplasmic reticulum stress-chop pathway Shutong Yao 1, 2,, Hua Tian 1,, Cheng Miao 1,, Da-Wei Zhang 3, Li Zhao
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationSupplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/3/e1400244/dc1 Supplementary Materials for PlGF-induced VEGFR1-dependent vascular remodeling determines opposing antitumor effects and drug resistance to
More informationChemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationCt=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
More informationPotential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.
Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationSupplementary Figures for
Supplementary Figures for SOX2 suppresses CDKN1A to sustain growth of lung squamous cell carcinoma Takuya Fukazawa 1, Minzhe Guo 4, 5, Naomasa Ishida 1, Tomoki Yamatsuji 1, Munenori Takaoka 1, Etsuko Yokota
More informationPro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationTarget Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3
Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale i: Primers used for RT-PCR. References are provided under Source, except for primers
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationSupplementary Information File
Supplementary Information File Supplementary Table 1. List of synthesized sirna sequences for target genes sirna Species Sequence Ctrl sirna mouse sense 5 -UUCUCCGAACGUGUCACGUTT-3 Antisense 5 -ACGUGACACGUUCGGAGAATT-3
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More information