SUPPLEMENTARY INFORMATION
|
|
- Debra Doyle
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES & TABLES
2 SUPPLEMENTARY METHODS Reagents Sodium palmitate, sodium oleate, linoleic acid and bovine serum albumin (essentially fatty acid free) were purchased from Sigma-Aldrich. T and GW3965 were obtained from Tocris. GSK2033 was purchased from Axon MedChem and HX-531 from Tocris Bioscience. CL was purchased from Sigma-Alrich. The anti-atgl antibody (#2138) was purchased from Cell Signaling Technology. Anti-G0S2 antibody was produced as previously described (Zhang et al., 2014). Antibodies for LXRα (sc- 1202) and LXRβ (sc-1001) were purchased from Santa Cruz. Horseradish peroxidaselinked secondary antibodies were purchased from Jackson Immuno-Research Laboratories. The protease inhibitor mini tablet cocktail was obtained from Roche Diagnostics. The PureLink RNA Mini Kit and High-Capacity cdna Reverse Transcription Kit were purchased from Invitrogen. Reagents for tissue culture and Bodipy 493/503 were obtained from Invitrogen. Plasma and liver metabolite analysis Plasma total triglyceride, cholesterol (Thermo Fisher Scientific), HDL/LDL (Biovision), 3-hydroxybutyrate (Wako), and glucose (Wako) were measured using enzyme colorimetric assays according to the manufacturer s protocols. Liver lipids were extracted by choloroform/methonal (2:1), dried under nitrogen gas and resuspended in 1% triton X Then total triglyceride and total cholesterol content were assayed using total TG and TC assay kits from Thermo Fisher Scientific. For hepatic glycogen measurement, liver
3 tissue was homogenized and glycogen extracted by acid hydrolysis as described previously (XD dibatetes paper). RNA Extraction and Real-Time PCR Total RNA was isolated from mouse liver samples and primary hepatocytes using the PureLink RNA Mini Kit (Invitrogen) according to the manufacturer's instruction. cdna was synthesized from total RNA by High-Capacity cdna Reverse Transcription Kit (Invitrogen) with Oligo d(t). The resulting cdna was subjected to real-time PCR analysis with SYBR Select Master Mix (Invitrogen) on an Applied Biosystems 7900 HT Real-Time PCR System. The sequences of qpcr primers are listed in (Supplementary Table 1). Data were analyzed using the comparative cycle threshold ( ΔΔ Ct) method. The mrna levels of genes normalized to β-actin were presented as relative to the control. PCR product specificity was verified by postamplification melting curve analysis and by running products on an agarose gel. Immunoblotting Liver samples were lysed at 4 C in a buffer containing 50 mm Tris-HCl (ph 7.4), 135 mm NaCl, 10 mm NaF, 1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate, 1.0 mm EDTA, 10% glycerol, and protease inhibitors (1 tablet per 10 ml of buffer). The lysates were clarified by centrifugation at 20,000 g, 4 C for 10 min and then mixed with equal volume of 2 SDS sample buffer. Equivalent amounts of protein were resolved by SDS-PAGE and transferred to nitrocellulose membranes. Individual proteins
4 were blotted with primary antibodies at appropriate dilutions. Peroxide-conjugated secondary antibodies were incubated with the membrane at a dilution of 1:5000. The signals were then visualized using ECL substrate (Pierce). H&E staining, B-galactosidase staining and light microscopy Tissue samples collected for H&E analysis were immediately immersed and fixed in 10% formalin. Paraffin embedded section and subsequent H&E staining was carried out by the Mayo Clinic Microscopy Core facility. Tissues samples collected for B-galactosidase staining were immediately frozen in liquid nitrogen. The Mayo Clinic Microscopy Core, following standard procedures, conducted cryo-sectioning and staining with X-gal. All slides were visualized on a Nikon light microscope with standard digital camera system.
5 Supplementary Figure 1 3 (-) Glycerol (+) Glycerol Relative Expression G0S2 ATGL WT primary hepatocytes were treated for 8-h in the presence or absence of 3mM glycerol. A: qpcr analysis of G0S2 and ATGL following glycerol treatment.
6 Supplementary Figure 2 A Relative Expression *** ** ** ** GW G0S2 LXRa ABCG5 ABCG8 SREBP1c ATGL B GW3965 G0S2 Actin C 60 GW3965 *** Hepatic TG (ug/mg) GW week old female WT mice were injected with 20mg/kg/day GW3965. A: qpcr analysis of G0S2, ATGL, LXRa and LXRa target genes in liver. B: Immunoblot analysis of G0S2 and C: total hepatic triglycerides. (n = 6 for qpcr, n = 8 for TG ** p < 0.001, *** p < )
7 Supplementary Figure *** Luciferase (RLU) Ctrl T09 Linoleic acid Oleic acid HepG2 cells were transfected with the Gal4-LXR:MH100-Luc plasmids at a 1:8 ratio. After 24h, cells were treated for an additional 24h with 10 μm T09, 750 μm linoleic acid or 500 μm oleic acid. Luciferase activity was assayed using the Luciferase Assay kit.
8 Supplementary Figure 4 A Plasma 3-hydroxybutyrate (mm) Wt ** G0S2 KO T * B 0.25 Wt G0S2 KO Plasma FFA (mm) T C 10 Wt G0S2 KO Plasma Glucose T Plasma parameters in T09 injected Wt and G0S2 KO mice, n=5.
9 Supplementary Figure 5 LXR agonism Fasting Reverse Cholesterol Trafficking TG FA utilization Fatty acids de novo FAs (LXR agonism) Adipose-derived FAs (Fasting) Model for the regulation of hepatic G0S2 expression and triglyceride accumulation by fasting and LXR agonism. Activation of LXRα promotes G0S2 expression and ATGL inhibition. FAs dervied from either adipose tissue (fasting) or de novo FA synthesis (LXR agonism) are packaged into intrahepatic lipid droplets as TG. Due to LXRα-mediated transcriptional activation of G0S2, inhibition of ATGL is increased and TG accumulation results. FA utilization therefore is reduced in response to decreased the availability of free FAs.
10 Supplementary Table 1 Gene Sequence of forward and reverse primers (5 to 3 ) G0S2 AAAGTGTGCAGGAGCTGA AGGGAGGCCGTCGTGCGGA ATGL AGACAGAGCTTTCTCCCAGTGAA CCCCGTGAAGCCCAACT LXR AGGAGTGTCGACTTCGCAAA CTCTTCTTGCCGCTTCAGTTT ABCG5 TGGATCCAACACCTCTATGCTAAA GGCAGGTTTTCTCGATGAACTG ABCG8 TGCCCACCTTCCACATGTC ATGAAGCCGGCAGTAAGGTAGA SREBP1c CGGAAGCTGTCGGGGTAG GTTGTTGATGAGCTGGAGCA FAS CCTGGATAGCATTCCGAACCT AGCACATCTCGAAGGCTACACA SCD1 GAGGCCTGTACGGGATCATA TGAGAGAAGAAGAAGCCACGG Primer sequence for qpcr. All sequences are mouse.
11 Supplementary Table 2 LABELED PROBES: SREBP-1C (+) LXRE 5 BIOTIN / CAGTGACCGCCAGTAACCCCAGC - 3 G0S2 LXRE 5 BIOTIN / ATCTGGCCTGTGGTTACCTTGAT - 3 NON-SPECIFIC 5 BIOTIN / AAATCAGGGGACTTTTTCAGGCG - 3 UNLABELED COMPETITORS: SREBP-1C LXRE 5 CAGTGACCGCCAGTAACCCCAGC - 3 G0S2 LXRE 5 ATCTGGCCTGTGGTTACCTTGAT - 3 NON-SPECIFIC 5 AAATCAGGGGACTTTTTCAGGCG - 3 Sequences for probes used in EMSA assays.
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationFor pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationSupplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationPair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Table S1. Primers and fluorescent probes used for qrt-pcr analysis of relative expression levels of PPP family phosphatases. gene name forward primer, 5-3 probe, 5-3 reverse primer,
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationThe antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
More informationEffec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationSupporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationHIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates
HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates Department of Microbiology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, USA
More informationSUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
More informationSUPPLEMENTARY INFORMATION
Glucose is a ligand for the oxysterol receptor LXR Supplementary Figure 1 Schematic representation of pathways influencing glucose fate in the liver. Glucose induces insulin secretion, suppressing hepatic
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationItem Catalog Number Manufacturer 1,4-Dithioerythritol (1 g) D9680 Sigma-Aldrich
SOP: Nuclei isolation from fresh mouse tissues and DNaseI treatment Date modified: 01/12/2011 Modified by: E. Giste/ T. Canfield (UW) The following protocol describes the isolation of nuclei and subsequent
More informationSupplementary Figure S1. Effect of stress during withdrawal on expression of sensitization to repeated cocaine exposure in WT and D2R / mice.
Supplementary Figure S1. Effect of stress during withdrawal on expression of sensitization to repeated cocaine exposure in WT and D2R / mice. The time course of locomotor activity for WT (a, b) or D2R
More informationWestern Immunoblotting Preparation of Samples:
Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing
More informationLoss of protein association causes cardiolipin degradation in Barth syndrome
SUPPLEMENTARY INFORMATION Loss of protein association causes cardiolipin degradation in Barth syndrome Yang Xu 1, Colin K.L. Phoon 2, Bob Berno 5, Kenneth D Souza 6, Esthelle Hoedt 4, Guoan Zhang 4, Thomas
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationHIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury
J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa
More informationGENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC
Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski
More informationSupplemental figures and figure legends (90517-INS-RG-RV-2) Supplemental Figure 1.
Supplemental figures and figure legends (957-INS-RG-RV-) Supplemental Figure. A B.5.5 Interaction p=.89 Model p
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationMammalian Tissue Protein Extraction Reagent
Mammalian Tissue Protein Extraction Reagent Catalog number: AR0101 Boster s Mammalian Tissue Protein Extraction Reagent is a ready-to-use Western blot related reagent solution used for efficient extraction
More informationImpact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationBMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice
SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationEpithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationChromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.
Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationLecithin Cholesterol Acyltransferase (LCAT) ELISA Kit
Product Manual Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Catalog Number STA-616 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is a lipid sterol
More informationSupporting Information
Supporting Information van der Windt et al. 10.1073/pnas.1221740110 SI Materials and Methods Mice and Reagents. C57BL/6 and major histocompatibility complex class I-restricted OVA-specific T-cell receptor
More informationCholesterol determination using protein-templated fluorescent gold nanocluster probes
Electronic Supplementary Information for Cholesterol determination using protein-templated fluorescent gold nanocluster probes Xi Chen and Gary A. Baker* Department of Chemistry, University of Missouri-Columbia,
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationMANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function
MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More information2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
More informationAPPENDIX Heparin 2 mg heparin was dissolved in 0.9 % NaCl (10 ml). 200 µl of heparin was added to each 1 ml of blood to prevent coagulation.
APPENDIX 1 Preparation of reagents 1.1. Preparation of dosing solution Nonylphenol 15 mg of Nonylphenol was dissolved in olive oil (10 ml) and used as stock solution. The stock solution was serially diluted
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationSupporting Information
Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationSTUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS
STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS Xiannu Jin 1, Radharaman Ray 2, Guang Xu 1 and Prabhati Ray 1 1 Department
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationRegulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
More informationGraveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document
Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley
More information