Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
|
|
|
- Karen Gregory
- 5 years ago
- Views:
Transcription
1 Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong Duan State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai , China State Key Laboratory of Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai ,China Supporting Information The ratio optimization of DOPA to CaP-ZD55-IL-24 The ratio of DOPA to CaP-ZD55-IL-24 was optimized. Several concentrations of DOPA were prepared: 50 µg/ml, 100 µg/ml, 150 µg/ml, 200 µg/ml and 400 µg/ml. The mean size of CaP/Lipids-ZD55-IL-24 changed as the DOPA concentration increased (Figure S1A); the mean size decreased from 904 nm to 121 nm as the concentration of DOPA increased from 50 µg/ml to 150 µg/ml; when the concentration of DOPA was increased to 400 µg/ml, the mean size increased to 397 nm. The minimum mean size was observed at 150 µg/ml, and the compound exhibited good dispersibility (Figure S1B). DOPA did not efficiently coat the CaP-ZD55-IL-24 complex, leading to bulk aggregation (Figure S1C) at 50 µg/ml. Excessive lipids produced empty liposomes, and also caused an increase in size (Figure S1D), as shown in the negatively stained TEM images. Thus, the concentration at the minimum mean size was considered the optimum concentration. 1
2 Cellular uptake. Huh-7 cells were infected with ZD55-IL-24 or PLC-ZD55-IL-24 at 200 VPs/cell. After 6 hours, the cells were washed three times with PBS and collected. DNA samples were extracted and qualified using real time quantitative polymerase chain reaction (qpcr). Quantitative RT-PCR assay. Total RNAs were isolated by Trizol (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed with the ReverTra Ace qpcr RT Kit (Toyobo Osaka, Japan). Expression levels of IL-24 mrna was measured by SYBR Green Realtime PCR Master Mix (primers: 5 CCTTCTGGGCTGTGAAAGAC3 and 5 GACAAGGTAACAGCTCTCAG3 ). 18S was used as a reference (5 AACTTTCGATGGTAGTCGCCG3 and 5 CCTTGGATGTGGTAGCCGTTT3 ). 2
3 Figure S1. Optimization of the ratio of DOPA to CaP/ZD55-IL-24. (A) The changed size of PLC-ZD55-IL-24 at a serial concentration of DOPA. The mean size and TEM image of PLC-ZD55-IL-24 at 150 µg/ml (B), 50 µg/ml (C) and 400 µg/ml (D) DOPA. Data are presented as the means ± SD of three independent experiments. 3
4 Figure S2. Synthesis and characterization of mpeg DPPE. (A) Synthetic route for the production of mpeg DPPE. (B) 1 H NMR spectra of mpeg DPPE. 4
5 Figure S3. Cytotoxicity evaluation of PEG/Lipids /CaP. Normal cells (L-929, L02, and QSG-7701) were treated with serial concentrations of PEG/Lipids /CaP. Cell viability was measured using the MTT assay at 48 and 72 hours. Data are presented as the means ± SD of three independent experiments (***P<0.01). 5
6 Figure S4. Size distribution of PLC-ZD55-IL-24 as measured using a Nanosight 3D Plot. Figure S5. Characterization of DOTAP-ZD55-IL-24. (A) Diameter distribution and (B) zeta potential of DOTAP-ZD55-IL-24. 6
7 Figure S6. Cytotoxicity of PLC-ZD55-IL-24 in normal human liver cells (QSG-7701). QSG-7701 cells were infected with ZD55-IL-24 and PLC-ZD55-IL-24 in serial dilutions of viral particles. Cell viability was measured using the MTT assay at 48 hours postinfection. Data are presented as the means ± SD of three independent experiments (***P<0.01). Figure S7. Apoptosis of normal human liver cells (QSG-7701). Hoechst staining (A) and an Annexin V binding assay (B) were examined at 48 h after incubation with ZD55-IL-24 and PLC-ZD55-IL-24 (160 VPs/cell). No obvious nucleic fragmentation or Annexin V-FITC + cells were observed. Scale bar: 50 µm. 7
8 Figure S8. Uptake of PLC-ZD55-IL-24 in Huh-7 cells. Huh-7 cells were infected with ZD55-IL-24 or PLC-ZD55-IL-24 at 200 VPs/cell and collected at 6 h. Viral genome (E3 gene) number was quantified using an absolute real-time qpcr. Data are presented as the means ± SD of three independent experiments. NS indicates P>0.05 Figure S9. Biodistribution of PLC-ZD55-IL-24 in nude mice bearing Huh-7 xenografts. Nude mice bearing Huh-7 tumors were intravenously injected with VPs ZD55-IL-24 and PLC-ZD55-IL-24. Viral genome (E3 gene) copies in heart, kidney and brain were quantified by real time qpcr at the indicated time.(n=3). ***P < 0.01 versus the corresponding dose in the PLC-ZD55-IL-24-treated group. 8
9 Figure S10. Transfection of ZD55-GFP and PLC-ZD55-GFP in Hepa1-6 cells. Hepa1-6 and Huh-7 cells were infected with ZD55-GFP and PLC-ZD55-GFP at 200 VPs/cell. At 48 h post-infection, the cells were observed under fluorescence microscopy. Scale bar: 100 μm. Figure S11. IL-24 expression in Huh-7 tumors VPs ZD55-IL-24, PLC-ZD55-IL-24 were intravenously injected into Huh-7 tumor-bearing nude mice four times every other day. Tumor tissues were harvested from mice four days after the final intravenous injection. (A)The IL-24 mrna expression levels in Huh-7 tumors ware quantified by real time qpcr. ***P < 0.01 (n=3) (18S as reference) (B) Western blot analysis of IL-24 expression in Huh-7 tumors. 9
10 Figure S12. Correlation analysis between relative tumor volume reduction and IL-24 expression. PBS, VPs ZD55-IL-24 and PLC-ZD55-IL-24 were intravenously injected into Huh-7 tumor-bearing nude mice four times every other day. Tumor harvested at the end of treatment. The IL-24 mrna expression levels in tumors ware quantified by real time qpcr. (n=5) (18S as reference). 10
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
Supporting Information. Maximizing the Supported Bilayer Phenomenon: LCP Liposomes Comprised Exclusively
S-1 Supporting Information Maximizing the Supported Bilayer Phenomenon: LCP Liposomes Comprised Exclusively of PEGylated Phospholipids for Enhanced Systemic and Lymphatic Delivery Matthew T. Haynes and
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1
The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma
Authors Rahul K. Keswani, Mihael Lazebnik & Daniel W. Pack
Reinstatement of Retroviral Infectivity via Non-Covalent Attachment of DOTAP, DOPE and Cholesterol to Murine Leukemia Virus-Like Particles Hybrid Viral/Lipid Gene Delivery Vectors Authors Rahul K. Keswani,
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex.
Figure Captions Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. A) XRD, B) Particle size distribution and zeta potential distribution of LDHs and 5- FU(10)/LDH nanohybrids,
Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for. High-Efficiency Tracking Orthotopic Colorectal Tumor in
Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for High-Efficiency Tracking Orthotopic Colorectal Tumor in Mouse Hongda Chen, a,c Xiaodong Li, b Fuyao Liu, a Huimao
The Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Supporting Information. Design of LVFFARK and LVFFARK-Functionalized Nanoparticles. for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity
Supporting Information Design of LVFFARK and LVFFARK-Functionalized Nanoparticles for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity Neng Xiong, Xiao-Yan Dong, Jie Zheng, Fu-Feng Liu, * and
Supporting Information
Supporting Information Cancer Cell Membrane-Biomimetic Nanoprobes with Two-Photon Excitation and Near-Infrared Emission for Intravital Tumor Fluorescence Imaging Yanlin Lv 1,2,, Ming Liu 3,4,, Yong Zhang
Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
Mechanical Stress-Dependent Autophagy Components Release via Extracellular
Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
Supporting Information
Supporting Information Toward High-Efficient Red Emissive Carbon Dots: Facile Preparation, Unique Properties, and Applications as Multifunctional Theranostic Agents Shan Sun,, Ling Zhang, Kai Jiang, Aiguo
Supporting information. Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon. Nanoparticles for Synergistic Thermochemotherapy of Tumor
Supporting information Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon Nanoparticles for Synergistic Thermochemotherapy of Tumor Xian Li, Xiudan Wang, Luping Sha, Da Wang, Wei Shi, Qinfu Zhao*,,
The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells
The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells Published in: Natl Med J China, February 10, 2003; Vol 83, No 3, Page 195-197. Authors: JIAO Shun-Chang,
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology COX-2 NTera-2 NTera-2 RT-PCR FasL caspase-8 caspase-3 PARP.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 7 28 7 630 ~ 636 NTera-2 ** ** * 410081 COX-2 NTera-2 MTT NTera-2 NTera-2 Hoechest 33258
Supporting Information. for. Advanced Functional Materials, adfm Wiley-VCH 2006
Supporting Information for Advanced Functional Materials, adfm.200500627 Wiley-VCH 2006 69451 Weinheim, Germany Supporting information for: Self-assembly of a Novel Micelle Structure from Graft and Diblock
Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T
Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel
Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
Title: Vectorization of biomacromolecules into cells using extracellular vesicles with enhanced internalization induced by macropinocytosis
Scientific Reports Supplementary information Title: Vectorization of biomacromolecules into cells using extracellular vesicles with enhanced internalization induced by macropinocytosis Authors: Ikuhiko
Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by
Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1,
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
Supporting Information For
Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li
International Conference on Biomedical and Biological Engineering (BBE 2016)
International Conference on Biomedical and Biological Engineering (BBE 2016) Injury Mechanism of Sub-Micron Calcium Oxalate Monohydrate and Dihydrate Crystals on Renal Epithelial Cells Poonam BHADJA, Kai
Supporting Information
Supporting Information H 2 O 2 -Activatable and O 2 -Evolving Nanoparticles for Highly Efficient and Selective Photodynamic Therapy against Hypoxic Tumor Cells Huachao Chen, Jiangwei Tian, Weijiang He,*
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,
Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
Supplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
Supplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
Supporting Information
Supporting Information Natural small molecule FMHM inhibits lipopolysaccharide-induced inflammatory response by promoting TRAF6 degradation via K48-linked polyubiquitination Ke-Wu Zeng 1, Li-Xi Liao 1,
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC
Supplementary information Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Pathway in Pancreatic -Cells Authors: Hodaka Yamada 1,*, Masashi Yoshida 1,*, Kiyonori Ito 1, Katsuya
Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in
Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Coordination-responsive Selenium-containing Polymer Micelles for. Supporting information
Electronic Supplementary Material (ESI) for Chemical Science Coordination-responsive Selenium-containing Polymer Micelles for Controlled Drug Release Wei Cao, a Yang Li, b Yu Yi, a Shaobo Ji, a Lingwu
Supporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
Supporting Information for:
Supporting Information for: A Robust Liposomal Platform for Direct Colorimetric Detection of Sphingomyelinase Enzyme and Inhibitors Margaret N. Holme, 1,2,3,4 Subinoy Rana, 1,2,3,5 Hanna M. G. Barriga,
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified
Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing
Supporting Information. Light-enhanced hypoxia-response of conjugated polymer nanocarrier. for successive synergistic photodynamic and chemo-therapy
Supporting Information Light-enhanced hypoxia-response of conjugated polymer nanocarrier for successive synergistic photodynamic and chemo-therapy Xiaolong Zhang a,d, Ming Wu a,d, Jiong Li a,c,d, Shanyou
Supplementary information
Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu,
Optimization of the Fuse-It-mRNA Protocol for L929 Cells in the µ-plate 24 Well
Optimization of the Fuse-It-mRNA Protocol for L929 Cells in the µ-plate 24 Well 1. General Information... 1 2. Background... 1 3. Material and Equipment Required... 2 4. Experimental Procedure and Results...
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers
Supporting information Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Yulei Chang 1, Xiaodan Li 1,3, Li zhang 1,3, Lu Xia 1, Xiaomin
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
Supplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
ph and Reduction Dual Responsive Polyurethane Triblock Copolymers for Efficient Intracellular Drug Delivery
Supporting Information ph and Reduction Dual Responsive Polyurethane Triblock Copolymers for Efficient Intracellular Drug Delivery Shuangjiang Yu a, Chaoliang He* a, Jianxun Ding a,b, Yilong Cheng a,b,
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
Supporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
SUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
Gladstone Institutes, University of California (UCSF), San Francisco, USA
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
Cell type- and sizedependent in vitro toxicity of silica particles in human skin cells
Cell type- and sizedependent in vitro toxicity of silica particles in human skin cells 22 October 2014 Claudia Moia Early Stage Researcher, Cranfield University (UK) Presentation Overview Introduction
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
Nature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
Supplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes