Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.

Transcription

1 Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct along with 5 ng TK-Luc construct for 12 hours. Various compounds were then added to culture media for 12 hours and luciferase activity was detected. Sample with a low TK activity (smaller than half of control) was considered to be cytotoxic and was ruled out. (b-i) Q-PCR analysis of DMSO- or IC261 (10 μm)-treated primary peritoneal macrophages stimulated by VSV (12h) and poly(i:c) (3h). (j-l) Q-PCR analysis of DMSO- or IC261 (10 μm)-treated primary peritoneal macrophages stimulated by VSV. (m) IB analysis of p52 in lysates of DMSO- or IC261-treated primary peritoneal macrophages infected with VSV. (n) Primary peritoneal macrophages cells were pretreated with DMSO or IC261 (10 μm) for 60 minutes, and then infected with VSV (MOI=0.01). The mrna level of VSV was examined by Q-PCR analysis. (o) HeLa cells were pretreated with DMSO or IC261 (10 μm) for 60 minutes, and then infected with HSV (MOI=0.001). The mrna level of HSV was examined by Q-PCR analysis. NS,not significant (P > 0.05); *P < 0.05, **P < 0.01 and ***P < (unpaired t-test (a-h)). Data are from three independent experiments with biological duplicates in each (b-o; mean and s.e.m. of n = 3). Data are representative of three independent experiments (m).

2 Supplementary Figure 2 CK1 deficiency impairs a type I interferon response. (a-h) Q-PCR analysis of WT and Csnk1e / primary peritoneal macrophages infected by VSV (12h) and poly(i:c) (3h). (i-k) Q-PCR analysis of WT and Csnk1e / primary peritoneal macrophages infected by VSV. (l) IB analysis of IRF3 phosphorylation and p52 abundance in lysates of WT and Csnk1e / primary peritoneal macrophages infected with VSV. (m, n) WT and Csnk1e / primary peritoneal macrophages cells were stimulated with poly(i:c) or LPS, and then IRF3 phosphorylation was examined by western blot. (oq) Densitometry quantification of IRF3 phosphorylation in supplementary Fig 2l-m. (r-t) Primary peritoneal macrophages were infected with WNV (MOI=1) (r, t) or VSV (MOI=0.01) (s). The WNV-E protein level (r) or mrna level of VSV or WNV (s, t) and the WNV-E protein level (r) were examined. (u) Q-PCR analysis of VSV-infected Csnk1e +/+ and Csnk1e / macrophages treated as indicated. NS, not significant (P > 0.05); *P < 0.05, **P < 0.01 and ***P < (unpaired t-test (a-k, s-u)). Data are from three independent experiments with biological duplicates in each (a-k, s-u; mean and s.e.m. of n = 3). Data are representative of three independent experiments (l-n, r).

3 Supplementary Figure 3 CK1 interacts with TRAF3. (a) IP and IB of cell lysates from HEK293T cells expressing HA-CK1 and Flag-TRAF1-6 with antibodies against HA or Flag. (b) IP and IB of cell lysates from HEK293T cells expressing indicated constructs. (c) In vitro GST precipitation assay using different purified histidine (His)-tagged CK1 deletion constructs combined with GST-TRAF3. (d) In vitro GST precipitation assay using purified histidinetagged CK1 combined with GST-MAVS or GST-TRAF3. (e) IB of mitochondria or whole cell lysate (WCL) from BMDM infected with VSV. (f-h) Confocal microscopy of MEF cells (f, g) or ibmdm (h) infected with VSV for indicated hours. Data are representative of three independent experiments (a-h).

4 Supplementary Figure 4 CK1 phosphorylates TRAF3 at Ser349. Dot blot analysis of anti-pser349, TS349-p: Ser349 phosphorylated peptide, TS349-c: Ser349 non-phosphorylated peptide. Data are one representative from two experiments.

5 Supplementary Figure 5 CK1 -mediated phosphorylation of TRAF3 is required for antiviral responses. Traf3 -/- MEFs were transfected with indicated plasmids, and then infected with VSV for indicated times. Cell lysates were subjected to IB analysis. Data is a representative of the same experiment sample as shown in Fig. 5g, 5h.

6 Supplementary Figure 6 Phosphorylation of TRAF3 promotes its ubiquitination. (a) HEK293T cells transfected with indicated plasmids were treated with IC261, and lysates and anti-traf3 IP were subjected to IB analysis as indicated. (b) IB of lysates and anti-flag IP from HEK293T cells transfected with indicated plasmids. (c) Traf3 -/- MEFs were transfected with indicated plasmids, and then infected with VSV for indicated times. Cell lysates or anti-traf3 IP were subjected to IB analysis. (d, e) IB of cell lysates and anti-traf3 IP of Csnk1e +/+ or Csnk1e -/- primary peritoneal macrophages infected with VSV (d) or stimulated with LPS (e) for the indicated times. Data are representative of three independent experiments (a-e).

7 Supplementary Figure 7 Ck1ε deficiency attenuates antiviral resistance. (a-c) IBA1 staining for macrophage (a), MPO staining for neutrophil (b) and CD3 staining for lymphocyte (c) in the central nervous system (CNS) of WT or Csnk1e -/- mice infected with WNV for 7 days. Data are representative of three independent experiments (a-c).

8 Supplementary Table1. Summary of Screening Results Compound Name Fold change Description 1-benzoyl-5-methoxy-2- methylindole-3-acetic acid 0.07 Putative inhibitor of multidrug resistance-associated protein 1 (MRP1) 7-Chloro-4-hydroxy-2-phenyl- 1,8-naphthyridine 0.09 A1 adenosine receptor antagonist Alloxazine 0.19 Selective A1 adenosine receptor agonist Diphenyleneiodonium chloride 0.16 Endothelial nitric oxide synthase inhibitor Parthenolide 0.10 Inhibits serotonin release from platelets; inhibits production of leukotriene B4 and thromboxane B2 IC Casein kinase-1 (CK-1delta/epsilon) inhibitor Rotenone 0.23 Inhibitor of mitochondrial electron transport Ciprofibrate 4.76 Carcinine dihydrochloride 3.92 Antioxidant; hydroxy radical scavanger Peroxizome proliferator;specific ligand for the nuclear peroxisome proliferator-activated receptor alpha (PPARalpha) CGS Highly potent, non-selective A1 adenosine receptor antagonist GW High affinity peroxisome proliferator-activated gamma (PPAR-gamma) Positive allosteric modulator of alpha7 neuronal nicotinic acetylcholine receptor; also modulates Ivermectin 4.75 glutamate-gaba-activated chloride channels MRS Selective A3 adenosine receptor antagonist in rat (±)-Normetanephrine hydrochloride 4.20 Norepinephrine metabolite GW Irreversible peroxisome proliferator-activated receptor-gamma (PPAR-gamma) inhibitor Tyrphostin AG Potent inducible nitric oxide synthase (inos) inhibitor; endothelial NOS (enos) inhibitor Terfenadine 5.31 Non-sedating H1 histamine receptor antagonist Trifluperidol hydrochloride 4.13 Dopamine receptor antagonist; antipsychotic Theobromine 4.80 Weak adenosine receptor antagonist; weak phosphodiesterase inhibitor; diuretic; smooth muscle relaxant Wortmannin from Penicillium funiculosum 6.88 Potent and specific phosphatidylinositol 3-kinase (P13-K) inhibitor N-Succinyl-L-proline 4.67 Potent and specific angiotensin converting enzyme (ACE) inhibitor

9 Supplementary Table 2. main PCR primers used gene name mgapdh-f mgapdh-r VSV-G (G protein)-f VSV-G (G protein)-r mifnb-f mifnb-r WNV-E (Envelope protein)-f WNV-E (Envelope protein)--r HSV-Gg (Glycoprotein)-F HSV-Gg (Glycoprotein)-R sequence (5'-3') TGGATTTGGACGCATTGGTC TTTGCACTGGTACGTGTTGAT CAAGTCAAAATGCCCAAGAGTCACA TTTCCTTGCATTGTTCTACAGATGG AGCTCCAAGAAAGGACGAACAT GCCCTGTAGGTGAGGTTGATCT CATCGATGGTAGGCTTGTC TCTCCACCAAAGCTGCGT CCCGCTGGARCTACTATGACA CATCCCGATGCTGTCSACC