Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI

LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

The art of tracing dietary fat in humans. Leanne Hodson

The art of tracing dietary fat in humans Leanne Hodson Dietary fat Other lipoproteins: IDL, LDL, HDL Hodson and Fielding linical Lipidology (2010) Relationship between blood & dietary fatty acids Typically:

Hepatic oleate regulates adipose tissue lipogenesis and fatty acid oxidation

Hepatic oleate regulates adipose tissue lipogenesis and fatty acid oxidation Maggie S. Burhans 1, Matthew T. Flowers 2, Kristin R. Harrington 2, Laura M. Bond 2, Chang-An Guo 2, Rozalyn M. Anderson 3,4,

Metabolic defects underlying dyslipidemia in abdominal obesity

Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/

Supplementary Figure S1

Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

LIPID METABOLISM

LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

3-Thia Fatty Acids A New Generation of Functional Lipids?

Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

The Role of LCPUFA in Obesity. M.Tom Clandinin. The Alberta Institute for Human Nutrition The University of Alberta Edmonton, Alberta, Canada

The Role of LCPUFA in Obesity by M.Tom Clandinin The Alberta Institute for Human Nutrition The University of Alberta Edmonton, Alberta, Canada How big is the Conceptual Problem? Some assumptions: 150lb

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

AN ABSTRACT OF THE DISSERTATION OF. Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012.

AN ABSTRACT OF THE DISSERTATION OF Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012. Title: Polyunsaturated Fatty Acid Synthesis and Type 2 Diabetes Complications Abstract

Leen Alsahele. Razan Al-zoubi ... Faisal

25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals

Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram

Widespread concern about the role of SFA in heart disease: Is it justified?

Widespread concern about the role of SFA in heart disease: Is it justified? 1. What is the association of SFA intake and LDL-C? 2. Is LDL-C the best biomarker? 3. If SFA is reduced, does it matter what

number Done by Corrected by Doctor Faisal Al-Khatibe

number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

Integrative Metabolism: Significance

Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell

The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis

Review Article Endocrinol Metab 2017;32:6-10 https://doi.org/10.3803/enm.2017.32.1.6 pissn 2093-596X eissn 2093-5978 The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis Young-Ah Moon Department of

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

Biochemical and physiological function of stearoyl-coa desaturase

Am J Physiol Endocrinol Metab 297: E28 E37, 2009. First published December 9, 2008; doi:10.1152/ajpendo.90897.2008. Biochemical and physiological function of stearoyl-coa desaturase Chad M. Paton and James

PROMINENT ROLE OF LIVER IN ELEVATED PLASMA PALMITOLEATE LEVELS IN RESPONSE TO ROSIGLITAZONE IN MICE FED HIGH-FAT DIET

JOURNAL OF PHYSIOLOGY AND PHARMACOLOGY 2009, 60, 4, 135-140 www.jpp.krakow.pl O. KUDA 1, B. STANKOVA 2, E. TVRZICKA 2, M. HENSLER 1, T. JELENIK 1, M. ROSSMEISL 1, P. FLACHS 1, J. KOPECKY 1 PROMINENT ROLE

Fatty acids synthesis

Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular

Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng

298 Biomed Environ Sci, 2015; 28(4):

298 Biomed Environ Sci, 2015; 28(4): 298-302 Letter to the Editor Effects of Maternal Linseed Oil Supplementation on Metabolic Parameters in Cafeteria Diet-induced Obese Rats * BENAISSA Nawel 1, MERZOUK

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

Emerging roles of SIRT1 in fatty liver diseases

852 Review Ivyspring International Publisher International Journal of Biological Sciences 2017; 13(7): 852-867. doi: 10.7150/ijbs.19370 Emerging roles of SIRT1 in fatty liver diseases Ren-Bo Ding, Jiaolin

MILK BIOSYNTHESIS PART 3: FAT

MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

Fatty Acids, lipolysis and goat flavour (1) Specificities of lipid metabolim in goats :

Specificities of lipid metabolim in goats : Yves Chilliard INRA Clermont-Ferrand / Theix France - milk FA profile (high C8 & C1, and B-CFA) - lipolytic system (LPL regulations; flavour) (e.g. Chilliard

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:

Molecular mechanisms involved in hepatic steatosis and insulin resistance

MINI REVIEW Molecular mechanisms involved in hepatic steatosis and insulin resistance Takashi Matsuzaka, Hitoshi Shimano* ABSTRACT Increased hepatic lipid content is associated with hepatic as well as

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients

Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier

Integration & Hormone Regulation

Integration Branchpoints in metabolism where metabolites can go several directions 1. Glucose 6-phosphate Energy needed (low energy charge): glycolysis Low blood sugar: high [glucagon], low [insulin] glycogen

2.5. AMPK activity

Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

Cornstarch

Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

AMPK. Tomáš Kučera.

AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary

The Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress

Wayne State University Wayne State University Dissertations 1-1-2015 The Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress Roberto Mendez Wayne State University, Follow this and additional

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

Metabolism of acylglycerols and sphingolipids. Martina Srbová

Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins

AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze

AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic

ANSC/NUTR 618 Lipids & Lipid Metabolism

I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate

The lipogenic transcription factor ChREBP dissociates hepatic steatosis from insulin resistance in mice and humans

Research article The lipogenic transcription factor ChREBP dissociates hepatic steatosis from insulin resistance in mice and humans Fadila Benhamed, 1,2,3 Pierre-Damien Denechaud, 1,2,3 Maud Lemoine, 4,5,6

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

Synthesis of Fatty Acids and Triacylglycerol

Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM

Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

SteatoNet- Modelling steatosis identifies candidate systemic flux distribution

SteatoNet- Modelling steatosis identifies candidate systemic flux distribution deregulations Adviti Naik 1,2, Damjana Rozman 3, Aleš Belič 2* 1 Faculty of Computer Sciences and Informatics, University

Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.

Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson Fatty acid composition as a biomarker of intake Complements dietary

Insulin-induced gene 1 (insig-1) mrna increases dramatically in

Insig-1 brakes lipogenesis in adipocytes and inhibits differentiation of preadipocytes Jinping Li*, Kiyosumi Takaishi*, William Cook*, Sara Kay McCorkle*, and Roger H. Unger* *Touchstone Center for Diabetes

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel

Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the

Supplementary Figure 1.

Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

Hepatic De Novo Lipogenesis and Regulation of Metabolism

Hepatic De Novo Lipogenesis and Regulation of Metabolism James M. Ntambi Editor Hepatic De Novo Lipogenesis and Regulation of Metabolism Editor James M. Ntambi Department of Biochemistry University of

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic

Fatty acid synthesis. Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai - 116

Fatty acid synthesis Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai 116 Harper s biochemistry 24 th ed, Pg 218 Fatty acid Synthesis Known as

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild

Metabolism. Chapter 5. Catabolism Drives Anabolism 8/29/11. Complete Catabolism of Glucose

8/29/11 Metabolism Chapter 5 All of the reactions in the body that require energy transfer. Can be divided into: Cell Respiration and Metabolism Anabolism: requires the input of energy to synthesize large

Steven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of.

Reduced SCD1 activity decreases fatty acid re-esterification and alters markers of glyceroneogenesis and lipolysis in murine white adipose tissue and 3T3-L1 adipocytes by Steven Michael Dragos A Thesis

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Introduction Unique characteristics of Fructose Metabolism Mechanism for Fructose-Induced Insulin Resistance Epidemiological Studies

New hepatic fat activates PPAR to maintain glucose, lipid, and cholesterol homeostasis

New hepatic fat activates PPAR to maintain glucose, lipid, and cholesterol homeostasis Manu V. Chakravarthy, 1,3 Zhijun Pan, 1,3 Yimin Zhu, 1 Karen Tordjman, 1 Jochen G. Schneider, 1 Trey Coleman, 1 John

Lipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels

Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital

Liver-specific deletion of acetyl-coa carboxylase 1 reduces hepatic triglyceride accumulation without affecting glucose homeostasis.

Liver-specific deletion of acetyl-coa carboxylase 1 reduces hepatic triglyceride accumulation without affecting glucose homeostasis Jianqiang Mao*, Francesco J. DeMayo, Huiguang Li, Lutfi Abu-Elheiga*,

Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics

Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein

NCBA Ground Beef Diet/Health Study

NCBA Ground Beef Diet/Health Study Stephen B. Smith Department of Animal Science Rosemary L. Walzem Department of Poultry Science Texas A&M University Assumptions: Corn-fed beef is healthier than pasture-fed

Critical review. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver

SPOTLIGHT Critical review SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver Jay D. Horton, 1,2 Joseph L. Goldstein, 1 and Michael S. Brown 1 1 Department of

Physiological Chemistry II Exam IV Dr. Melissa Kelley April 13, 2004

Name Write your name on the back of the exam Physiological Chemistry II Exam IV Dr. Melissa Kelley April 13, 2004 This examination consists of forty-four questions, each having 2 points. The remaining

Hormones and Target Tissues

Hormones and Target Tissues The hypothalamus is the coordination center of the endocrine system Hypothalamus is a small region of the forebrain in animals with skulls It receives and integrates nerve signals

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

Chapter 2 The Molecular Basis of Hepatic De Novo Lipogenesis in Insulin Resistance

Chapter 2 The Molecular Basis of Hepatic De Novo Lipogenesis in Insulin Resistance Mengwei Zang Abstract Humans with obesity and type 2 diabetes exhibit the classic triad of hyperinsulinemia, hyperglycemia,

Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity

Regulation of hepatic fatty acid elongase and desaturase expression in diabetes and obesity Yun Wang,*,1 Daniela Botolin,*,1 Jinghua Xu,,1 Barbara Christian,* Ernestine Mitchell,* Bolleddula Jayaprakasam,

Biochimica et Biophysica Acta

Biochimica et Biophysica Acta 1812 (2011) 995 1006 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis Review Cross-regulation of hepatic

The Pennsylvania State University. The Graduate School. College of Health and Human Development

The Pennsylvania State University The Graduate School College of Health and Human Development ROLES OF DIETARY FACTORS AND HEPATIC GENES IN THE DEVELOPMENT OF NON-ALCOHOLIC FATTY LIVER DISEASE A Dissertation

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski

SCHOOL OF HEALTH SCIENCES DIVISION OF DIETETICS, NUTRITION AND BIOLOGICAL SCIENCES, PHYSIOTHERAPY, PODIATRY, RADIOGRAPHY LEVEL 2 / DIET 1

SCHOOL OF HEALTH SCIENCES DIVISION OF DIETETICS, NUTRITION AND BIOLOGICAL SCIENCES, PHYSIOTHERAPY, PODIATRY, RADIOGRAPHY LEVEL 2 / DIET 1 D2143/ Nutrition DATE: 28/04/2014 WRITING TIME: 120 minutes TIME:

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden

Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential

thematic review DGAT enzymes and triacylglycerol biosynthesis Thematic Review Series: Glycerolipids

thematic review Thematic Review Series: Glycerolipids DGAT enzymes and triacylglycerol biosynthesis Chi-Liang Eric Yen,* Scot J. Stone, Suneil Koliwad,, **, Charles Harris,, **, and Robert V. Farese, Jr.

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies

Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:

DGAT enzymes and triacylglycerol biosynthesis

thematic review Thematic Review Series: Glycerolipids DGAT enzymes and triacylglycerol biosynthesis Chi-Liang Eric Yen,* Scot J. Stone, Suneil Koliwad,, **, Charles Harris,, **, and Robert V. Farese, Jr.

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure

Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids

Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Stephen B. Smith and Seong Ho Choi Texas A&M University Bradley J. Johnson Texas Tech University, Lubbock RMC 2012 June 18, 2012 Researchers

Synthesis and degradation of fatty acids Martina Srbová

Synthesis and degradation of fatty acids Martina Srbová martina.srbova@lfmotol.cuni.cz Fatty acids (FA) mostly an even number of carbon atoms and linear chain in esterified form as component of lipids

Biochem. q1) the amount of cholesterol lost per day is: +a.1g/day b.10g/week c.15g/day d.5g/day

Biochem q1) the amount of cholesterol lost per day is: +a.1g/day b.10g/week c.15g/day d.5g/day q2) which of the following carry cholestrol to peripheral tissue : a.hdl b.ldl c.vldl d.chylomicrons q3) esterification

EXPRESSION OF FATTY ACID OXIDATION-RELATED GENES IN Acsl4 L -/- PRIMARY HEPATOCYTES. Dennis Lin

EXPRESSION OF FATTY ACID OXIDATION-RELATED GENES IN Acsl4 L -/- PRIMARY HEPATOCYTES Dennis Lin Senior Honors Thesis Department of Nutrition University of North Carolina at Chapel Hill April 2018 Approved

ChREBP, but not LXRs, is required for the induction of glucose-regulated genes in mouse liver

Research article Related Commentary, page 841 ChREBP, but not LXRs, is required for the induction of glucose-regulated genes in mouse liver Pierre-Damien Denechaud, 1,2 Pascale Bossard, 1,2 Jean-Marc A.

Expanded View Figures

Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old

Acetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol