SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

Size: px
Start display at page:

Download "SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of"

Transcription

1 SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium for 10 minutes at 37ºC. Cells were washed in depletion medium three times on ice (30 minutes total) to completely remove the puromycin and then incubated in [ 35 S]cysteine/methionine containing media (with or without 25 μm MG132) for 5 minutes at 37ºC. Following the pulse, the medium was removed and chase medium (also with or without MG132) was added and cells were harvested at 5 minute intervals up to 20 minutes. Cell lysis and analysis of apob-100 was performed as described in Materials and Methods. Immunoblot Analysis - Cells were treated for 16 h with U0126 or transfected with NT or sigp78 and harvested by lysis in 1% SDS 72 hours post-transfection. Total cell lysates were resolved by SDS-PAGE in 10% (w/v) polyacrylamide gels and the indicated proteins were visualized by immunoblotting. Primary antibodies to diacylglycerol acyltransferase 1 (DGAT1) (H-255, Santa Cruz Biotechnology, Santa Cruz, CA), microsomal triglyceride transfer protein (MTP)(Novus Biologicals, Littleton, CO), hydroxymethylglutaryl coenzyme A reductase (HMGCoAR)(Upstate Cell Signalling Solutions, Lake Placid, NY), sterol regulatory element binding protein 1a (SREBP1a)(Chemicon, Temecula, CA), peroxisome proliferator activated receptor (PPAR (Chemicon), peroxisome proliferator activated receptor (PPAR (Santa Cruz Biotechnology), ERK1/2 (#9102; Cell Signaling Technology, Danvers, MA) and Phospho- ERK1/2 (#9101; Cell Signaling Technology, Danvers, MA) were incubated overnight and secondary antibodies and chemiluminescence were performed as described in Materials and Methods. 1

2 Trypsin digestion in radiolabelled cells Transfected HepG2 cells were depleted of cysteine and methionine and then incubated in [ 35 S]cysteine/methionine containing media for one hour. The cells were then permeabilized with digitonin and trypsin digestion was performed as described in Materials and Methods. ApoB and apoai were then collected by immunoprecipitation, visualized by SDS-PAGE with autoradiography and quantified by liquid scintillation counting. SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Gp78 knockdown reduces the cellular accumulation of nascent apob-100 in puromycin-synchronized HepG2 cells. Seventy-two hours following transfection with either NT or gp78-targeting sirna, HepG2 cells were treated with 10 μm puromycin for 5 minutes and then washed for 3 x 10 minutes on ice. Cells were immediately pulse-labeled for 5 minutes at 37ºC in medium containing [ 35 S]cysteine/methionine and then chased for up to 20 minutes. Where indicated, 25 μm MG132 was included in the pulse and chase medium. ApoB was recovered from the cells by immunoprecipitation and visualized by autoradiography. Supplemental Figure 2. Gp78 sirna does not alter levels of proteins involved in lipid metabolism. Cells were transfected with NT or and harvested by lysis 72 hours posttransfection. Total cell lysates were resolved by SDS-PAGE and the indicated proteins were visualized by immunoblotting. 2

3 Supplemental Figure 3. Reduced gp78 expression protects radiolabelled apob-100 from trypsin digestion in digitonin-permeabilized HepG2 cells. A. Cells were transfected with either non-targeting (NT) or gp78-targeting sirna. Seventy-two hours post-transfection the cells were labelled with [ 35 S]cysteine/methionine for 1 hour. Cells were then permeabilized with digitonin and the supernatant was discarded. The remaining monolayers were then treated with trypsin at the indicated concentration for 30 minutes on ice. Soybean trypsin inhibitor was then added and the monolayers were collected. ApoB-100 and apoai were recovered from cells by immunoprecipitation and visualized by autoradiography. B. ApoB-100 and apoai bands were excised and quantified by liquid scintillation counting. The ratio of apob-100 to apoai is expressed as percent of 0 µg/ml trypsin control (NT and ) to demonstrate the relative level of digestion. Supplemental Figure 4. U0126 does not affect global ubiquitination during MG132 treatment and does not affect phospho-erk. A. Cells were pre-treated for 16 hours with either DMSO or 10 μm U0126. Cells were incubated for one hour with 360 μm oleic acid prior to the 25 μm MG132 treatment. From total cell lysates, 6% input was loaded per lane for the total ubiquitin blot (upper left panel) and 2% input was loaded for the actin blot (lower left panel). ApoB immunoprecipitates (right panel) were performed on total cell lysates with a polyclonal anti-apob and the elutions analyzed by Western blot with anti-ubiquitin antibody. B. Cells were harvested 72 hours post-transfection or after 16 h incubation with 10 μm U0126. Total cell lysates were resolved by SDS-PAGE and total ERK and phospho-erk were visualized by immunoblot analysis. 3

4 NT - MG132 + MG132 - MG132 + MG Chase (min) apob100 incomplete apob polypeptides Fisher et al, Supplemental Figure 1

5 NT DGAT1 MTP HMGCoAR SREBP1a PPARα PPARγ actin Fisher et al, Supplemental Figure 2

6 A NT apob-100 apoai Trypsin (µg/ml) B apob-100/apoai (% of control) NT Trypsin ( g/ml) Fisher et al, Supplemental Figure 3

7 A Total cell lysate anti-apob IP MG132 (min) U Total ubiquitin Ub-apoB actin B DMSO U0126 NT - phospho-erk1/2 - total ERK1/2 Fisher et al, Supplemental Figure 4

Appendix. Table of Contents

Appendix. Table of Contents Appendix Table of Contents Appendix Figures Figure S1: Gp78 is not required for the degradation of mcherry-cl1 in Hela Cells. Figure S2: Indel formation in the MARCH6 sgrna targeted HeLa clones. Figure

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6

More information

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and

More information

Supplementary Figure S1 Supplementary Figure S2

Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented

More information

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- 1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

SUPPLEMENT. Materials and methods

SUPPLEMENT. Materials and methods SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR

More information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for

Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for 15 min at 37 C and replaced with fresh complete medium.

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of

Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein

More information

Inhibition of hepatocyte apob secretion by naringenin: enhanced rapid intracellular degradation independent of reduced microsomal cholesteryl esters

Inhibition of hepatocyte apob secretion by naringenin: enhanced rapid intracellular degradation independent of reduced microsomal cholesteryl esters Inhibition of hepatocyte apob secretion by naringenin: enhanced rapid intracellular degradation independent of reduced microsomal cholesteryl esters Nica M. Borradaile,* Linda E. de Dreu,* P. Hugh R. Barrett,

More information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion

More information

Apolipoprotein B-containing lipoprotein assembly in microsomal triglyceride transfer protein-deficient McA-RH7777 cells

Apolipoprotein B-containing lipoprotein assembly in microsomal triglyceride transfer protein-deficient McA-RH7777 cells Apolipoprotein B-containing lipoprotein assembly in microsomal triglyceride transfer protein-deficient McA-RH7777 cells Yanwen Liu, 1, * Medha Manchekar, 1, * Zhihuan Sun, * Paul E. Richardson, and Nassrin

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis

More information

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,

More information

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,

More information

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

A. List of selected proteins with high SILAC (H/L) ratios identified in mass Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Cell Lysis Buffer. Catalog number: AR0103

Cell Lysis Buffer. Catalog number: AR0103 Cell Lysis Buffer Catalog number: AR0103 Boster s Cell Lysis Buffer is a ready-to-use Western blot related reagent solution used for efficient extraction of total soluble protein in nondenatured state

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products.. INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1

More information

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Legends for Supplemental Figures.

Legends for Supplemental Figures. 1 Legends for Supplemental Figures. Supplemental Figure 1. Proteasome Inhibition does not abrogate the expression of FA core complex proteins or formation of the FA core complex. (Full-length blots are

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

Sterol-induced degradation of HMG CoA reductase depends on interplay of two Insigs and two ubiquitin ligases, gp78 and Trc8

Sterol-induced degradation of HMG CoA reductase depends on interplay of two Insigs and two ubiquitin ligases, gp78 and Trc8 Sterol-induced degradation of reductase depends on interplay of two Insigs and two ubiquitin ligases, and Youngah Jo 1, Peter. W. Lee 1, Peter V. Sguigna, and Russell A. Deose-oyd 2 Department of Molecular

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

CAN Resubmission SUPPLEMENTAL INFORMATION

CAN Resubmission SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION CAN-05-0686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6*

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6* Supplementary Information for Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling Elissaveta Petrova 1,5, Jessica Rios-Esteves 1,2, Ouathek Ouerfelli 3, J. Fraser Glickman 4, and Marilyn

More information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated

More information

Recruitment of HBO1 Histone Acetylase and Blocks

Recruitment of HBO1 Histone Acetylase and Blocks Molecular Cell, Volume 44 Supplemental Information JNK1 Phosphorylation of Cdt1 Inhibits Recruitment of HO1 Histone cetylase and locks Replication Licensing in Response to Stress enoit Miotto and Kevin

More information

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes

More information

supplementary information

supplementary information DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Supporting Information

Supporting Information Supporting Information Chen et al. 10.1073/pnas.0807991106 SI Methods Sucrose Gradient Fractionation. Fractionation by sucrose gradient was performed as described by Gasparini et al. [(2001) J Neurosci

More information

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark

More information

CAN Resubmission SUPPLEMENTAL INFORMATION

CAN Resubmission SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION CAN-5-686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)

More information

ab Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions.

ab Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions. ab139409 Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions. This product is for research use only and is not intended

More information

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e

More information

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley

More information

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Peli1 negatively regulates T-cell activation and prevents autoimmunity Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Boucher et al NCOMMS B

Boucher et al NCOMMS B 1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna

More information