Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
|
|
- Kellie George
- 5 years ago
- Views:
Transcription
1 1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich ELISA using specific 5 combinations of Mabs. A combination of Mab 1FB and HRP-labeled Mab B1E was used for 6 total PCSK9 quantification. A combination of Mab B1E and HRP-labeled Mab G1D was 7 used for the mature PCSK9 quantification, while Mab B1G and HRP-labeled Mab B1E were 8 used for the furin-cleaved PCSK Supplemental Figure Titration curves of the PCSK9 ELISA. 11 The ELISA was performed as described in the Supplemental Materials and Methods. The 1 purified rhpcsk9 was used as the primary calibrator for the ELISAs of total and mature PCSK9, 1 and the cell lysate containing rhδ18pcsk9 was used to calibrate the ELISA of furin-cleaved 14 PCSK9. The titration curves were made using serial dilutions (1:1,80 to 1:0) of purified 15 rhpcsk9 (closed circles), rhpcsk9 culture medium (open circles), or human plasma (open 16 triangles) for the total (A) and mature PCSK9 (B), and using serial dilutions (1:56 to 1:4) of 1
2 1 cell lysate of rh 18PCSK9 (closed circles), purified rhpcsk9 digested with furin (open circles), or human plasma (open triangles) for furin-cleaved PCSK9 (C). Each point represents the mean of triplicate determinations. 4 5 Supplemental Figure Standard curves in the ELISA for total, mature and furin-cleaved 6 PCSK9s. 7 The standard curve was made using serial dilutions (1:100 to 1:6,400) of 000 ng/ml purified 8 rhpcsk9 for total (A) and mature PCSK9 (B), and using serial dilutions (1:10 to 1:640) of cell 9 lysates rh 18PCSK9 for furin-cleaved PCSK9 (C). Each point represents the mean of triplicate 10 determinations Supplemental Figure 4 Correlation between plasma HDL-C reduction and mature PCSK9 1 reduction in FH homozygotes and FH heterozygotes. 14 (A) Correlation between plasma HDL-C reduction (Y-axis) and mature PCSK9 reduction 15 (X-axis) in FH homozygotes after a single LDL-A treatment with DS columns (N=7). 16 (B) Correlation between plasma HDL-C reduction (Y-axis) and mature PCSK9 reduction
3 1 (X-axis) in FH heterozygotes after a single LDL-A treatment with DS columns (N=11).
4
5
6
7
8 1 Supplemental Materials and Methods Construction, expression, and purification of recombinant PCSK9 proteins Human PCSK9 cdna was obtained by RT-PCR from mrna of HepG cells and a C-terminal 4 His 6 tag was added as described [1]. Briefly, PCR was carried out using the following primers: 5 5 -gacgaattccagcgacgtcgaggcgctcatggttg- and 6 5 -gacgaattctcagtgatggtgatggtgatgctggagctcctgggaggcctgcgcc- for mature PCSK9 (1-69 aa), 7 and 5 -agtcaagcttcaggccagcaagtgtgacagtcat- and 5 -agtagtcgacctggagctcctgggaggcctg- for 8 18PCSK9 (19-69 aa), which corresponds to the furin-cleaved PCSK9. The respective 9 cdnas were subcloned into the pef1 mammalian expression vector to yield pef1/pcsk9 10 or pef1/ 18PCSK9 vector. CHO-K1 cells stably transfected with the pef1/pcsk9 or 11 pef1/ 18PCSK9 vector were cultured. The mature form of recombinant human PCSK9 1 (rhpcsk9) from the culture medium was partially purified by affinity column chromatography 1 using Talon metal affinity resin (Clontech, Mountain View, CA), followed by anion exchange 14 chromatography using DEAE Sepharose CL-6B (GE Healthcare, Uppsala, Sweden). The purity 15 of rhpcsk9s and rhpcsk9 (1 µg) digested with or without recombinant human furin (0.5 µg; 16 R&D Systems) was confirmed by SDS-PAGE followed by silver staining or immunoblotting. 17 For rhδ18pcsk9, transfectant cells were collected by trypsinization, and suspended in TBS 18 containing 1% NP-40. After centrifugation of the cell suspension at 15,000 X g for 0 min at 1
9 1 4 C, the supernatant was collected and used as a calibrator for furin-cleaved PCSK9 ELISA. For immunoblotting, purified rhpcsk9 and rh 18PCSK9 in the cell lysate were detected with anti-tetra-his antibody (Qiagen, Valencia, CA). The bands were detected with an enhanced 4 chemiluminescence kit (Perkin-Elmer, Norwalk, CT). 5 6 Production of monoclonal antibodies against PCSK9 7 Balb/c mice were immunized using a DNA-based or standard immunization method with 5 µg 8 purified rhpcsk9 [1], and spleen cells from mice were fused with Sp/0 myeloma cells. The 9 supernatants of hybridoma cells were screened by ELISA using plates coated with purified 10 rhpcsk9 (100 ng/well) and by immunoblotting. Positive hybridoma cells were cloned at least 11 four times by limiting dilution and injected intraperitoneally into pristane-primed balb/c mice. 1 The IgG fraction was isolated from ascitic fluid using protein A-Sepharose FF (GE Healthcare, 1 Piscataway, NJ), dialyzed against PBS at 4 C, and stored at -80 C. The specificities of each 14 monoclonal antibody (Mab) obtained by standard immunization (1FB) and by DNA-based 15 immunization (B1G, B1E and G1D), respectively, were confirmed by ELISA and 16 immunoblotting against purified rhpcsk9. The Mab isotype was characterized using an Isostrip 17 mouse Mab isotyping kit (Roche Diagnostics, Basel, Switzerland), and was IgG1 for all Mabs. 18
10 1 Measurement of plasma mature and furin-cleaved PCSK9 concentrations Plasma mature and furin-cleaved PCSK9s were measured by an ELISA using a specific combination of Mabs as previously described (Supplemental Fig. 1) [1]. The absorbance was 4 measured at 450 nm with a microplate reader. The intra- and inter-assay coefficients of variation 5 of the ELISAs in serum samples (the total and mature PCSK9 ranged from.9 to ng/ml and furin-cleaved PCSK9 ranged from 9.4 to 9.1 ng/ml) were % (n=10) and % (n=10), respectively. No interference with either ELISA was observed with 8 hemoglobin (5.0 g/l), bilirubin (0. g/l), or triacylglycerol (4.5 g/l) Standardization of ELISA for the mature and furin-cleaved PCSK9s in plasma 11 The purified rhpcsk9 was used as the primary calibrator for the ELISAs of total and mature 1 PCSK9, and the cell lysate containing rhδ18pcsk9 was used to calibrate the ELISA of 1 furin-cleaved PCSK9. To obtain a calibration curve in the ELISA for total and mature PCSK9, 14 dilutions of the primary calibrator were made in PBS containing 0.1% Tween 0 and 0.% BSA 15 (sample diluent) to provide 0.0- ng of rhpcsk9 protein per well ( ng/ml). When 16 the rhpcsk9 culture medium, as a secondary calibrator, was diluted in sample diluent to cover 17 the same range of PCSK9 concentration, the curve was identical to that obtained with the 18 primary calibrator (Supplemental Fig. ). Similarly, the calibration curve was made using
11 1 dilutions of the cell lysate of rh 18PCSK9 for furin-cleaved PCSK9. The linearity of each ELISA was up to 000 ng/ml for total and mature PCSK9, and up to 400 ng/ml for furin-cleaved PCSK9, and was suitable for quantifying each form of PCSK9 concentration to as 4 low as 9.1 ng/ml for the total and mature PCSK9, and 6.8 ng/ml for furin-cleaved PCSK9 to 5 provide ng of rh 18PCSK9 protein per well ( ng/ml). The linearity in each 6 system was also confirmed with serially diluted rhpcsk9 culture medium and plasma samples 7 of several concentrations (6.4 to 544. ng/ml for total and mature PCSK9, and 10.8 to ng/ml for furin-cleaved PCSK9). The plasma was diluted 150-fold, which gave an absorbance 9 between 0.5 and References 1 [1] Ishihara M, Kujiraoka T, Iwasaki T, Nagano M, Takano M, Ishii J, Tsuji M, Ide H, 1 Miller IP, Miller NE, Hattori H 005 A sandwich enzyme-linked immunosorbent assay for 14 human plasma apolipoprotein A-V concentration. J Lipid Res 46:
12 Supplemental Table 1. Patient characteristics of the 18 FH subjects in this study Duration of Mutations in LDLR, Medication- Patient Medication Medication Treated plasma LDL-A Age Sex Type of FH PCSK9, or CAD anticoagulants or no. -statin -Ezetimibe volume (ml) treatment LDLRAP1 gene antiplatelets (year) 1 59 Male Homo LDLR + Pitavastatin - Aspirin Female Homo LDLR + Atorvastatin + Aspirin Male Homo LDLRAP1 + Atorvastatin + Aspirin Female Homo None + Atorvastatin - Aspirin Female Homo N/A + Atorvastatin + Warfarin, Ticlopidine Female Homo N/A - Rosuvastatin Female Homo N/A Female Hetero LDLR, PCSK9 + Rosuvastatin + Aspirin Male Hetero LDLR + Rosuvastatin + Aspirin, Clopidogrel sulfate Male Hetero LDLR + Simvastatin - Aspirin, Ticlopidine Female Hetero LDLR + Pitavastatin + Aspirin Male Hetero None + Atorvastatin + Aspirin Female Hetero None + Rosuvastatin + Aspirin Female Hetero None Aspirin, Clopidogrel sulfate Male Hetero None + Pitavastatin + Aspirin Female Hetero N/A + Pitavastatin Male Hetero N/A + Pitavastatin + Asprin, Clopidogrel sulfate 5000 Asprin, Sarpogrelate hydrochloride Male Hetero N/A + Atorvastatin - Aspirin, Ticlopidine Abbreviations: CAD, coronary artery disease; FH, familial hypercholesterolemia; N/A, genetic testing was not performed.
13 Supplemental Table. Change of plasma mature and furin-cleaved PCSK9 and lipids before and after a LDL-A treatment with DS column Patient no. Mature PCSK9 (ng/ml) Furin-cleaved PCSK9 (ng/ml) TC LDL-C HDL-C TG ApoA-I ApoA-II ApoB ApoC-II ApoC-III ApoE Lp(a) before after before after before after before after before after before after before after before after before after before after before after before after before after < N/A N/A <0.5 < < < Abbreviations: HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol; Lp(a), lipoprotein (a); TC, total cholesterol; TG, triglyceride
14 Supplemental Table. Laboratory data in FH heterozygotes before and after a single LDL-A treatment with DM column Before After Reduction (%) TC 187 ± 6 8 ± 4 a 57 LDL-C 17 ± 1 44 ± 4 a 66 HDL-C 9 ± 9 ± 17 b 6 TG 96 ± 44 9 ± 4 b 59 Apo A-I 109 ± ± 6 a Apo A-II ±.7 18 ±. a Apo B 100 ± 11 5 ± 18 a 66 Apo C-II.1 ± ± 1. b 50 Apo C-III 8.1 ± ±.0 a 49 Apo E.4 ± ± 0.6 a 56 Lp(a) 51 ± 8 18 ± 16 a 68 Abbreviations: HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol; Lp(a), lipoprotein (a); TC, total cholesterol; TG, triglyceride All values are shown as mean ± SD. N=5 a P<0.01, b P<0.05 vs. the respective values before LDL-A
SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The
More informationHuman LDL ELISA Kit. Innovative Research, Inc.
Human LDL ELISA Kit Catalog No: IRKTAH2582 Lot No: SAMPLE INTRODUCTION Human low-density lipoprotein (LDL) transports cholesterol from the liver to tissues where it is incorporated into cell membranes.
More informationLDL (Human) ELISA Kit
LDL (Human) ELISA Kit Cat. No.:DEIA3864 Pkg.Size:96T Intended use This immunoassay kit allows for the specific measurement of human low density lipoprotein, LDL concentrations in cell culture supernates,
More informationGenetic and biochemical characteristics of patients with hyperlipidemia who require LDL apheresis
Genetic and biochemical characteristics of patients with hyperlipidemia who require LDL apheresis Mato Nagel, Ioan Duma, Constantina Vlad, Mandy Benke, Sylvia Nagorka Zentrum für Nephrologie & Stoffwechsel,
More informationHuman LDL Receptor / LDLR ELISA Pair Set
Human LDL Receptor / LDLR ELISA Pair Set Catalog Number : SEK10231 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in
More informationLipoprotein Lipase Activity Assay Kit (Fluorometric)
Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General
More informationEfficacy, Safety and Tolerability of 150 mg Q2W Dose of the PCSK9 mab REGN727/SAR236553: Data from Three Phase 2 Studies
Efficacy, Safety and Tolerability of 150 mg Q2W Dose of the PCSK9 mab REGN727/SAR236553: Data from Three Phase 2 Studies Michael J. Koren, 1 Evan A. Stein, 2 Eli M. Roth, 3 James M. McKenney, 4 Dan Gipe,
More informationHuman Apolipoprotein A1 EIA Kit
A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Nair S, Branagan AR, Liu J, Boddupalli CS, Mistry PK, Dhodapkar
More informationEXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids
DATA SHEET EXOTESTTM ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids INTRODUCTION Exosomes are small endosome-derived lipid nanoparticles
More informationInhibition of PCSK9: The Birth of a New Therapy
Inhibition of PCSK9: The Birth of a New Therapy Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Disclosures Dr. Kastelein
More informationDrug Class Prior Authorization Criteria PCSK9 Inhibitors
Drug Class Prior Authorization Criteria PCSK9 Inhibitors Line of Business: Medicaid P & T Approval Date: February 21, 2018 Effective Date: April 1, 2018 This policy has been developed through review of
More informationAPOB (Human) ELISA Kit
APOB (Human) ELISA Kit Catalog Number KA4330 96 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...
More informationFrom Biology to Therapy The biology of PCSK9 in humans Just LDL-cholesterol or more? May 24th. Dr. Gilles Lambert
Dr. Gilles Lambert Associate Professor in Cell Biology University of Nantes Medical School Group Leader, Laboratory of Nutrition and Metabolism, University Hospital of Nantes From Biology to Therapy The
More informationSupplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
More informationInfluenza B Hemagglutinin / HA ELISA Pair Set
Influenza B Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK11053 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationhuman Total Cathepsin B Catalog Number: DY2176
human Total Cathepsin B Catalog Number: DY2176 This DuoSet ELISA Development kit contains the basic components required for the development of sandwich ELISAs to measure natural and recombinant human Total
More informationClinical Policy: Evolocumab (Repatha) Reference Number: ERX.SPMN.184 Effective Date: 01/2017
Clinical Policy: (Repatha) Reference Number: ERX.SPMN.184 Effective Date: 01/2017 Last Review Date: Revision Log See Important Reminder at the end of this policy for important regulatory and legal information.
More informationSupplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
More informationKynamro. Kynamro (mipomersen) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: December 2, 2016 Kynamro Description Kynamro (mipomersen)
More informationApolipoprotein A-1 ELISA
Apolipoprotein A-1 ELISA For the quantitative determination of apolipoprotein A1 in serum and plasma. For Research Use Only. Not For Use In Diagnostic Procedures. Please read carefully due to Critical
More informationThe Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia
The Addition of Ezetimibe to Statin therapy in Patients with Homozygous Familial Hypercholesterolaemia Submitted in fulfilment with the requirements for the degree Master in Medicine (MMed) Dr Adriano
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationProthrombin (Human) ELISA Kit
Prothrombin (Human) ELISA Kit Catalog Number KA0496 96 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General
More informationApolipoprotein A1 (Apo A1) ELISA
Package Insert Apolipoprotein A1 (Apo A1) ELISA 1 x 96 Wells For Research Use Only (RUO). Not for use in clinical, diagnostic or therapeutic procedures. v. 1.0 Eagle Biosciences, Inc. 20A Northwest Blvd.,
More informationSupplementary materials for manuscript entitled Development and Analytical
Supplementary materials for manuscript entitled Development and Analytical Validation of An Enzyme-Linked Immunosorbent assay (ELISA) for the detection of Copper in Human Hair and Serum Samples Manuscripte
More informationab Apolipoprotein B (APOB) Human ELISA Kit
ab108807 Apolipoprotein B (APOB) Human ELISA Kit Instructions for Use For the quantitative measurement of Human Apolipoprotein B (APOB) in plasma, serum, CSF and cell culture samples. This product is for
More informationPage 1 of 2. Standard curve of Human IFN gamma ELISA Ready- SET-Go! Product Information Contents: Human IFN gamma ELISA Ready- SET-Go!
Page 1 of 2 Human IFN gamma ELISA Ready-SET-Go! Catalog Number: 88-7316 Also known as: Interferon-gamma, IFN-g, IFNg RUO: For. Not for use in diagnostic procedures. Standard curve of Human IFN gamma ELISA
More informationInfluenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set
Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK40103 To achieve the best assay results, this manual must be read carefully before using this product and the assay
More informationSensoLyte Rh110 Cathepsin K Assay Kit *Fluorimetric* Revision#1.2 Last Updated: May 2017 Catalog # Kit Size
SensoLyte Rh110 Cathepsin K Assay Kit *Fluorimetric* Revision#1.2 Last Updated: May 2017 Catalog # 72152 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit detects Cathepsin K activity.
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationHIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual)
HIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual) BACKGROUND Human Immunodeficiency Virus ( HIV ) can be divided into two major types, HIV type 1 (HIV-1) and HIV type 2 (HIV-2). HIV-1 is related to
More informationLecithin Cholesterol Acyltransferase (LCAT) ELISA Kit
Product Manual Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Catalog Number STA-616 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is a lipid sterol
More informationHuman Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set
Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Catalog Number : SEK11695 To achieve the best assay results, this manual must be read carefully before using this product
More informationInfluenza A H1N1 HA ELISA Pair Set
Influenza A H1N1 HA ELISA Pair Set for H1N1 ( A/Puerto Rico/8/1934 ) HA Catalog Number : SEK11684 To achieve the best assay results, this manual must be read carefully before using this product and the
More informationHuman Oxidized LDL ELISA Kit (MDA-LDL Quantitation), General
Human Oxidized LDL ELISA Kit (MDA-LDL Quantitation), General For the detection and quantitation of human OxLDL in plasma, serum or other biological fluid samples Cat. No. KT-959 For Research Use Only.
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationData Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002
Data Sheet PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 DESCRIPTION: The PCSK9[Biotinylated]-LDLR Binding Assay Kit is designed for screening and profiling purposes. PCSK9 is known to function
More informationKynamro. Kynamro (mipomersen) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: September 15, 2017 Kynamro Description Kynamro
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationCitation for published version (APA): Sivapalaratnam, S. (2012). The molecular basis of early onset cardiovascular disease
UvA-DARE (Digital Academic Repository) The molecular basis of early onset cardiovascular disease Sivapalaratnam, S. Link to publication Citation for published version (APA): Sivapalaratnam, S. (2012).
More informationCase Discussions: Treatment Strategies for High Risk Populations. Most Common Reasons for Referral to the Baylor Lipid Clinic
Case Discussions: Treatment Strategies for High Risk Populations Peter H. Jones MD, FNLA Associate Professor Methodist DeBakey Heart and Vascular Center Baylor College of Medicine Most Common Reasons for
More informationSUPPLEMENTAL MATERIAL. Number of patients 14
SUPPLEMENTAL MATERIAL Supplemental Table 1 Number of patients 14 Age, years 54.9 ± 10.0 Female gender, n (%) 6 (42.9) Diabetes, n (%) 2 (14.3) History of hypertension, n (%) 5 (35.7) Ever smoker, n (%)
More informationValidation of an ELISA development kit for apolipoprotein B measurement in dried blood spots. Geeta N Eick, Paul Kowal, J Josh Snodgrass
Validation of an ELISA development kit for apolipoprotein B measurement in dried blood spots Geeta N Eick, Paul Kowal, J Josh Snodgrass Ischemic Cardiovascular Disease Leading cause of death worldwide
More informationFamilial Hypercholesterolemia
Familial Hypercholesterolemia Dr.Ramzi Al-Mohammadi Assistant Professor of Medicine Interventional Cardiologist, Advanced HF and Transplant Consultant Classification of Hyperlipedemia Primary hyperlipedemia:
More informationNori Rabbit IL-2 ELISA Kit DataSheet
Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationWORKSHOP 1. Management of Patients with Familial Hypercholesterolemia
WORKSHOP 1 Management of Patients with Familial Hypercholesterolemia Tutors: Manal Al-Kindi (Oman)/ Gilles Lambert (France) (Case 1) Zuhier Awan (KSA)/ Raul Santos (Brazil) (Case 2) Khalid Al-Waili (Oman)/
More informationGSI Canine IL-5 ELISA Kit-2 Plates DataSheet
Interleukin5 (IL5) is a secreted glycoprotein that belongs to the α-helical group of cytokines (1, 2, 3). Unlike other family members, it is present as a covalently linked antiparallel dimer (4, 5). IL-5
More informationInfluenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set
Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationHuman Cathepsin D ELISA Kit
GenWay Biotech, Inc. 6777 Nancy Ridge Drive San Diego, CA 92121 Phone: 858.458.0866 Fax: 858.458.0833 Email: techline@genwaybio.com http://www.genwaybio.com Human Cathepsin D ELISA Kit Catalog No. GWB-J4JVV9
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types
More informationAssayMax Human Aldose Reductase ELISA Kit
AssayMax Human Aldose Reductase ELISA Kit Assaypro LLC 3400 Harry S Truman Blvd St. Charles, MO 63301 T (636) 447-9175 F (636) 395-7419 www.assaypro.com For any questions regarding troubleshooting or performing
More informationMouse C-Peptide ELISA Kit
Mouse C-Peptide ELISA Kit Cat.No: DEIA4507 Lot. No. (See product label) Size 96T Intended Use The Mouse C-Peptide ELISA kit is for the quantitative determination of c-peptide in mouse serum, plasma, and
More informationLong-Term Complications of Diabetes Mellitus Macrovascular Complication
Long-Term Complications of Diabetes Mellitus Macrovascular Complication Sung Hee Choi MD, PhD Professor, Seoul National University College of Medicine, SNUBH, Bundang Hospital Diabetes = CVD equivalent
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationTNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures.
TNF-alpha ELISA For the quantitative determination of TNF-alpha in serum, plasma, buffered solution or cell culture medium. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number:
More informationRepatha. Repatha (evolocumab) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.16.08 Subject: Repatha Page: 1 of 8 Last Review Date: September 18, 2015 Repatha Description Repatha
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationJuxtapid. Juxtapid (lomitapide) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 Subject: Juxtapid Page: 1 of 6 Last Review Date: September 20, 2018 Juxtapid Description Juxtapid (lomitapide)
More informationHuman Leptin ELISA Kit
Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone
More informationab Lipoprotein A (APOA) Human ELISA Kit
ab108878 Lipoprotein A (APOA) Human ELISA Kit Instructions for Use For the quantitative measurement of Human Lipoprotein A (APOA) in plasma, serum, urine, milk and cell culture supernatants. This product
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationClinical Policy: Lomitapide (Juxtapid) Reference Number: ERX.SPA.170 Effective Date:
Clinical Policy: (Juxtapid) Reference Number: ERX.SPA.170 Effective Date: 01.11.17 Last Review Date: 11.17 Revision Log See Important Reminder at the end of this policy for important regulatory and legal
More informatione-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
More informationand follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
More informationMetabolism and Atherogenic Properties of LDL
Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal
More informationB. Patient has not reached the percentage reduction goal with statin therapy
Managing Cardiovascular Risk: The Importance of Lowering LDL Cholesterol and Reaching Treatment Goals for LDL Cholesterol The Role of the Pharmacist Learning Objectives 1. Review the role of lipid levels
More informationDrug Class Monograph
Drug Class Monograph Class: Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) Inhibitor Drugs: Praluent (alirocumab), Repatha (evolocumab) Line of Business: Medi-Cal Effective Date: February 17, 2016
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationThe antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
More informationClinical Policy: Mipomersen (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017
Clinical Policy: (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017 Last Review Date: Revision Log See Important Reminder at the end of this policy for important regulatory and legal information.
More informationHyaluronan Quantification Kit
Product manual (ELISA-like assay for HA / Hyaluronic Acid) Updated on Jan. 6th, 207 - Background Hyaluronan (HA) is an unbranched glycosaminoglycan composed of repeating disaccharide units of D-glucronic
More informationTotal Histone H3 Acetylation Detection Fast Kit (Colorimetric)
Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Catalog Number KA1538 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...
More information2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit
2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as
More informationPCSK9 Agents Drug Class Prior Authorization Protocol
PCSK9 Agents Drug Class Prior Authorization Protocol Line of Business: Medicaid P & T Approval Date: February 21, 2018 Effective Date: April 1, 2018 This policy has been developed through review of medical
More informationSupporting Information
Supporting Information Valkenburg et al. 10.1073/pnas.1403684111 SI Materials and Methods ELISA and Microneutralization. Sera were treated with Receptor Destroying Enzyme II (RDE II, Accurate) before ELISA
More informationMouse TrkB ELISA Kit
Mouse TrkB ELISA Kit CATALOG NO: IRKTAH5472 LOT NO: SAMPLE INTENDED USE For quantitative detection of mouse TrkB in cell culture supernates, cell lysates and tissue homogenates. BACKGROUND TrkB receptor
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationLow-density lipoproteins cause atherosclerotic cardiovascular disease (ASCVD) 1. Evidence from genetic, epidemiologic and clinical studies
Low-density lipoproteins cause atherosclerotic cardiovascular disease (ASCVD) 1. Evidence from genetic, epidemiologic and clinical studies A Consensus Statement from the European Atherosclerosis Society
More informationComprehensive Treatment for Dyslipidemias. Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium
Comprehensive Treatment for Dyslipidemias Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium Primary Prevention 41 y/o healthy male No Medications Normal BP, Glucose and BMI Social History:
More informationcolorimetric sandwich ELISA kit datasheet
colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity
More informationProprotein Convertase Subtilisin/Kexin type 9(PCSK9) Inhibitors Prior Authorization with Quantity Limit Program Summary
Proprotein Convertase Subtilisin/Kexin type 9(PCSK9) Inhibitors Prior Authorization with Quantity Limit Program Summary Proprotein Convertase Subtilisin/Kexin type 9(PCSK9) Inhibitors Prior Authorization
More informationRepatha. Repatha (evolocumab) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.08 Subject: Repatha Page: 1 of 8 Last Review Date: December 2, 2016 Repatha Description Repatha (evolocumab)
More informationEPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric)
More informationCardiovascular risk reduction in diabetes Lipids (NICE CG181)
Cardiovascular risk reduction in diabetes Lipids (NICE CG181) Primary Prevention T1DM Offer Atorvastatin 20mg if >40 years old Diabetes duration >10 years Established nephropathy Other CVS risk factors
More informationab Apolipoprotein A1 (APOA1) Human SimpleStep ELISA Kit
ab189576 Apolipoprotein A1 (APOA1) Human SimpleStep ELISA Kit Instructions for Use For the quantitative measurement of Apolipoprotein A1 (APOA1) in human serum, plasma, and cell culture supernatants. This
More informationDisclosures. Diabetes and Cardiovascular Risk Management. Learning Objectives. Atherosclerotic Cardiovascular Disease
Disclosures Diabetes and Cardiovascular Risk Management Tony Hampton, MD, MBA Medical Director Advocate Aurora Operating System Advocate Aurora Healthcare Downers Grove, IL No conflicts or disclosures
More informationSTAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit
STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...
More informationHepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
More informationNovel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes
Novel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes Rajat Deo, MD, MTR Assistant Professor of Medicine Division of Cardiology University of Pennsylvania April 25,
More informationData Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002
Data Sheet PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 DESCRIPTION: The PCSK9[Biotinylated]-LDLR Binding Assay Kit is designed for screening and profiling purposes. PCSK9 is known to function
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationHDL Purification Kit (Ultracentrifugation Free)
Product Manual HDL Purification Kit (Ultracentrifugation Free) Catalog Number STA- 607 10 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipoproteins are submicroscopic particles
More information