Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved

Size: px
Start display at page:

Download "Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved"

Transcription

1 1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich ELISA using specific 5 combinations of Mabs. A combination of Mab 1FB and HRP-labeled Mab B1E was used for 6 total PCSK9 quantification. A combination of Mab B1E and HRP-labeled Mab G1D was 7 used for the mature PCSK9 quantification, while Mab B1G and HRP-labeled Mab B1E were 8 used for the furin-cleaved PCSK Supplemental Figure Titration curves of the PCSK9 ELISA. 11 The ELISA was performed as described in the Supplemental Materials and Methods. The 1 purified rhpcsk9 was used as the primary calibrator for the ELISAs of total and mature PCSK9, 1 and the cell lysate containing rhδ18pcsk9 was used to calibrate the ELISA of furin-cleaved 14 PCSK9. The titration curves were made using serial dilutions (1:1,80 to 1:0) of purified 15 rhpcsk9 (closed circles), rhpcsk9 culture medium (open circles), or human plasma (open 16 triangles) for the total (A) and mature PCSK9 (B), and using serial dilutions (1:56 to 1:4) of 1

2 1 cell lysate of rh 18PCSK9 (closed circles), purified rhpcsk9 digested with furin (open circles), or human plasma (open triangles) for furin-cleaved PCSK9 (C). Each point represents the mean of triplicate determinations. 4 5 Supplemental Figure Standard curves in the ELISA for total, mature and furin-cleaved 6 PCSK9s. 7 The standard curve was made using serial dilutions (1:100 to 1:6,400) of 000 ng/ml purified 8 rhpcsk9 for total (A) and mature PCSK9 (B), and using serial dilutions (1:10 to 1:640) of cell 9 lysates rh 18PCSK9 for furin-cleaved PCSK9 (C). Each point represents the mean of triplicate 10 determinations Supplemental Figure 4 Correlation between plasma HDL-C reduction and mature PCSK9 1 reduction in FH homozygotes and FH heterozygotes. 14 (A) Correlation between plasma HDL-C reduction (Y-axis) and mature PCSK9 reduction 15 (X-axis) in FH homozygotes after a single LDL-A treatment with DS columns (N=7). 16 (B) Correlation between plasma HDL-C reduction (Y-axis) and mature PCSK9 reduction

3 1 (X-axis) in FH heterozygotes after a single LDL-A treatment with DS columns (N=11).

4

5

6

7

8 1 Supplemental Materials and Methods Construction, expression, and purification of recombinant PCSK9 proteins Human PCSK9 cdna was obtained by RT-PCR from mrna of HepG cells and a C-terminal 4 His 6 tag was added as described [1]. Briefly, PCR was carried out using the following primers: 5 5 -gacgaattccagcgacgtcgaggcgctcatggttg- and 6 5 -gacgaattctcagtgatggtgatggtgatgctggagctcctgggaggcctgcgcc- for mature PCSK9 (1-69 aa), 7 and 5 -agtcaagcttcaggccagcaagtgtgacagtcat- and 5 -agtagtcgacctggagctcctgggaggcctg- for 8 18PCSK9 (19-69 aa), which corresponds to the furin-cleaved PCSK9. The respective 9 cdnas were subcloned into the pef1 mammalian expression vector to yield pef1/pcsk9 10 or pef1/ 18PCSK9 vector. CHO-K1 cells stably transfected with the pef1/pcsk9 or 11 pef1/ 18PCSK9 vector were cultured. The mature form of recombinant human PCSK9 1 (rhpcsk9) from the culture medium was partially purified by affinity column chromatography 1 using Talon metal affinity resin (Clontech, Mountain View, CA), followed by anion exchange 14 chromatography using DEAE Sepharose CL-6B (GE Healthcare, Uppsala, Sweden). The purity 15 of rhpcsk9s and rhpcsk9 (1 µg) digested with or without recombinant human furin (0.5 µg; 16 R&D Systems) was confirmed by SDS-PAGE followed by silver staining or immunoblotting. 17 For rhδ18pcsk9, transfectant cells were collected by trypsinization, and suspended in TBS 18 containing 1% NP-40. After centrifugation of the cell suspension at 15,000 X g for 0 min at 1

9 1 4 C, the supernatant was collected and used as a calibrator for furin-cleaved PCSK9 ELISA. For immunoblotting, purified rhpcsk9 and rh 18PCSK9 in the cell lysate were detected with anti-tetra-his antibody (Qiagen, Valencia, CA). The bands were detected with an enhanced 4 chemiluminescence kit (Perkin-Elmer, Norwalk, CT). 5 6 Production of monoclonal antibodies against PCSK9 7 Balb/c mice were immunized using a DNA-based or standard immunization method with 5 µg 8 purified rhpcsk9 [1], and spleen cells from mice were fused with Sp/0 myeloma cells. The 9 supernatants of hybridoma cells were screened by ELISA using plates coated with purified 10 rhpcsk9 (100 ng/well) and by immunoblotting. Positive hybridoma cells were cloned at least 11 four times by limiting dilution and injected intraperitoneally into pristane-primed balb/c mice. 1 The IgG fraction was isolated from ascitic fluid using protein A-Sepharose FF (GE Healthcare, 1 Piscataway, NJ), dialyzed against PBS at 4 C, and stored at -80 C. The specificities of each 14 monoclonal antibody (Mab) obtained by standard immunization (1FB) and by DNA-based 15 immunization (B1G, B1E and G1D), respectively, were confirmed by ELISA and 16 immunoblotting against purified rhpcsk9. The Mab isotype was characterized using an Isostrip 17 mouse Mab isotyping kit (Roche Diagnostics, Basel, Switzerland), and was IgG1 for all Mabs. 18

10 1 Measurement of plasma mature and furin-cleaved PCSK9 concentrations Plasma mature and furin-cleaved PCSK9s were measured by an ELISA using a specific combination of Mabs as previously described (Supplemental Fig. 1) [1]. The absorbance was 4 measured at 450 nm with a microplate reader. The intra- and inter-assay coefficients of variation 5 of the ELISAs in serum samples (the total and mature PCSK9 ranged from.9 to ng/ml and furin-cleaved PCSK9 ranged from 9.4 to 9.1 ng/ml) were % (n=10) and % (n=10), respectively. No interference with either ELISA was observed with 8 hemoglobin (5.0 g/l), bilirubin (0. g/l), or triacylglycerol (4.5 g/l) Standardization of ELISA for the mature and furin-cleaved PCSK9s in plasma 11 The purified rhpcsk9 was used as the primary calibrator for the ELISAs of total and mature 1 PCSK9, and the cell lysate containing rhδ18pcsk9 was used to calibrate the ELISA of 1 furin-cleaved PCSK9. To obtain a calibration curve in the ELISA for total and mature PCSK9, 14 dilutions of the primary calibrator were made in PBS containing 0.1% Tween 0 and 0.% BSA 15 (sample diluent) to provide 0.0- ng of rhpcsk9 protein per well ( ng/ml). When 16 the rhpcsk9 culture medium, as a secondary calibrator, was diluted in sample diluent to cover 17 the same range of PCSK9 concentration, the curve was identical to that obtained with the 18 primary calibrator (Supplemental Fig. ). Similarly, the calibration curve was made using

11 1 dilutions of the cell lysate of rh 18PCSK9 for furin-cleaved PCSK9. The linearity of each ELISA was up to 000 ng/ml for total and mature PCSK9, and up to 400 ng/ml for furin-cleaved PCSK9, and was suitable for quantifying each form of PCSK9 concentration to as 4 low as 9.1 ng/ml for the total and mature PCSK9, and 6.8 ng/ml for furin-cleaved PCSK9 to 5 provide ng of rh 18PCSK9 protein per well ( ng/ml). The linearity in each 6 system was also confirmed with serially diluted rhpcsk9 culture medium and plasma samples 7 of several concentrations (6.4 to 544. ng/ml for total and mature PCSK9, and 10.8 to ng/ml for furin-cleaved PCSK9). The plasma was diluted 150-fold, which gave an absorbance 9 between 0.5 and References 1 [1] Ishihara M, Kujiraoka T, Iwasaki T, Nagano M, Takano M, Ishii J, Tsuji M, Ide H, 1 Miller IP, Miller NE, Hattori H 005 A sandwich enzyme-linked immunosorbent assay for 14 human plasma apolipoprotein A-V concentration. J Lipid Res 46:

12 Supplemental Table 1. Patient characteristics of the 18 FH subjects in this study Duration of Mutations in LDLR, Medication- Patient Medication Medication Treated plasma LDL-A Age Sex Type of FH PCSK9, or CAD anticoagulants or no. -statin -Ezetimibe volume (ml) treatment LDLRAP1 gene antiplatelets (year) 1 59 Male Homo LDLR + Pitavastatin - Aspirin Female Homo LDLR + Atorvastatin + Aspirin Male Homo LDLRAP1 + Atorvastatin + Aspirin Female Homo None + Atorvastatin - Aspirin Female Homo N/A + Atorvastatin + Warfarin, Ticlopidine Female Homo N/A - Rosuvastatin Female Homo N/A Female Hetero LDLR, PCSK9 + Rosuvastatin + Aspirin Male Hetero LDLR + Rosuvastatin + Aspirin, Clopidogrel sulfate Male Hetero LDLR + Simvastatin - Aspirin, Ticlopidine Female Hetero LDLR + Pitavastatin + Aspirin Male Hetero None + Atorvastatin + Aspirin Female Hetero None + Rosuvastatin + Aspirin Female Hetero None Aspirin, Clopidogrel sulfate Male Hetero None + Pitavastatin + Aspirin Female Hetero N/A + Pitavastatin Male Hetero N/A + Pitavastatin + Asprin, Clopidogrel sulfate 5000 Asprin, Sarpogrelate hydrochloride Male Hetero N/A + Atorvastatin - Aspirin, Ticlopidine Abbreviations: CAD, coronary artery disease; FH, familial hypercholesterolemia; N/A, genetic testing was not performed.

13 Supplemental Table. Change of plasma mature and furin-cleaved PCSK9 and lipids before and after a LDL-A treatment with DS column Patient no. Mature PCSK9 (ng/ml) Furin-cleaved PCSK9 (ng/ml) TC LDL-C HDL-C TG ApoA-I ApoA-II ApoB ApoC-II ApoC-III ApoE Lp(a) before after before after before after before after before after before after before after before after before after before after before after before after before after < N/A N/A <0.5 < < < Abbreviations: HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol; Lp(a), lipoprotein (a); TC, total cholesterol; TG, triglyceride

14 Supplemental Table. Laboratory data in FH heterozygotes before and after a single LDL-A treatment with DM column Before After Reduction (%) TC 187 ± 6 8 ± 4 a 57 LDL-C 17 ± 1 44 ± 4 a 66 HDL-C 9 ± 9 ± 17 b 6 TG 96 ± 44 9 ± 4 b 59 Apo A-I 109 ± ± 6 a Apo A-II ±.7 18 ±. a Apo B 100 ± 11 5 ± 18 a 66 Apo C-II.1 ± ± 1. b 50 Apo C-III 8.1 ± ±.0 a 49 Apo E.4 ± ± 0.6 a 56 Lp(a) 51 ± 8 18 ± 16 a 68 Abbreviations: HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol; Lp(a), lipoprotein (a); TC, total cholesterol; TG, triglyceride All values are shown as mean ± SD. N=5 a P<0.01, b P<0.05 vs. the respective values before LDL-A

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The

More information

Human LDL ELISA Kit. Innovative Research, Inc.

Human LDL ELISA Kit. Innovative Research, Inc. Human LDL ELISA Kit Catalog No: IRKTAH2582 Lot No: SAMPLE INTRODUCTION Human low-density lipoprotein (LDL) transports cholesterol from the liver to tissues where it is incorporated into cell membranes.

More information

LDL (Human) ELISA Kit

LDL (Human) ELISA Kit LDL (Human) ELISA Kit Cat. No.:DEIA3864 Pkg.Size:96T Intended use This immunoassay kit allows for the specific measurement of human low density lipoprotein, LDL concentrations in cell culture supernates,

More information

Genetic and biochemical characteristics of patients with hyperlipidemia who require LDL apheresis

Genetic and biochemical characteristics of patients with hyperlipidemia who require LDL apheresis Genetic and biochemical characteristics of patients with hyperlipidemia who require LDL apheresis Mato Nagel, Ioan Duma, Constantina Vlad, Mandy Benke, Sylvia Nagorka Zentrum für Nephrologie & Stoffwechsel,

More information

Human LDL Receptor / LDLR ELISA Pair Set

Human LDL Receptor / LDLR ELISA Pair Set Human LDL Receptor / LDLR ELISA Pair Set Catalog Number : SEK10231 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in

More information

Lipoprotein Lipase Activity Assay Kit (Fluorometric)

Lipoprotein Lipase Activity Assay Kit (Fluorometric) Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General

More information

Efficacy, Safety and Tolerability of 150 mg Q2W Dose of the PCSK9 mab REGN727/SAR236553: Data from Three Phase 2 Studies

Efficacy, Safety and Tolerability of 150 mg Q2W Dose of the PCSK9 mab REGN727/SAR236553: Data from Three Phase 2 Studies Efficacy, Safety and Tolerability of 150 mg Q2W Dose of the PCSK9 mab REGN727/SAR236553: Data from Three Phase 2 Studies Michael J. Koren, 1 Evan A. Stein, 2 Eli M. Roth, 3 James M. McKenney, 4 Dan Gipe,

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Nair S, Branagan AR, Liu J, Boddupalli CS, Mistry PK, Dhodapkar

More information

EXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids

EXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids DATA SHEET EXOTESTTM ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids INTRODUCTION Exosomes are small endosome-derived lipid nanoparticles

More information

Inhibition of PCSK9: The Birth of a New Therapy

Inhibition of PCSK9: The Birth of a New Therapy Inhibition of PCSK9: The Birth of a New Therapy Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Disclosures Dr. Kastelein

More information

Drug Class Prior Authorization Criteria PCSK9 Inhibitors

Drug Class Prior Authorization Criteria PCSK9 Inhibitors Drug Class Prior Authorization Criteria PCSK9 Inhibitors Line of Business: Medicaid P & T Approval Date: February 21, 2018 Effective Date: April 1, 2018 This policy has been developed through review of

More information

APOB (Human) ELISA Kit

APOB (Human) ELISA Kit APOB (Human) ELISA Kit Catalog Number KA4330 96 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the Assay...

More information

From Biology to Therapy The biology of PCSK9 in humans Just LDL-cholesterol or more? May 24th. Dr. Gilles Lambert

From Biology to Therapy The biology of PCSK9 in humans Just LDL-cholesterol or more? May 24th. Dr. Gilles Lambert Dr. Gilles Lambert Associate Professor in Cell Biology University of Nantes Medical School Group Leader, Laboratory of Nutrition and Metabolism, University Hospital of Nantes From Biology to Therapy The

More information

Supplemental Material. Results

Supplemental Material. Results Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was

More information

Influenza B Hemagglutinin / HA ELISA Pair Set

Influenza B Hemagglutinin / HA ELISA Pair Set Influenza B Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK11053 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

human Total Cathepsin B Catalog Number: DY2176

human Total Cathepsin B Catalog Number: DY2176 human Total Cathepsin B Catalog Number: DY2176 This DuoSet ELISA Development kit contains the basic components required for the development of sandwich ELISAs to measure natural and recombinant human Total

More information

Clinical Policy: Evolocumab (Repatha) Reference Number: ERX.SPMN.184 Effective Date: 01/2017

Clinical Policy: Evolocumab (Repatha) Reference Number: ERX.SPMN.184 Effective Date: 01/2017 Clinical Policy: (Repatha) Reference Number: ERX.SPMN.184 Effective Date: 01/2017 Last Review Date: Revision Log See Important Reminder at the end of this policy for important regulatory and legal information.

More information

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

More information

Kynamro. Kynamro (mipomersen) Description

Kynamro. Kynamro (mipomersen) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: December 2, 2016 Kynamro Description Kynamro (mipomersen)

More information

Apolipoprotein A-1 ELISA

Apolipoprotein A-1 ELISA Apolipoprotein A-1 ELISA For the quantitative determination of apolipoprotein A1 in serum and plasma. For Research Use Only. Not For Use In Diagnostic Procedures. Please read carefully due to Critical

More information

The Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia

The Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia The Addition of Ezetimibe to Statin therapy in Patients with Homozygous Familial Hypercholesterolaemia Submitted in fulfilment with the requirements for the degree Master in Medicine (MMed) Dr Adriano

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Prothrombin (Human) ELISA Kit

Prothrombin (Human) ELISA Kit Prothrombin (Human) ELISA Kit Catalog Number KA0496 96 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General

More information

Apolipoprotein A1 (Apo A1) ELISA

Apolipoprotein A1 (Apo A1) ELISA Package Insert Apolipoprotein A1 (Apo A1) ELISA 1 x 96 Wells For Research Use Only (RUO). Not for use in clinical, diagnostic or therapeutic procedures. v. 1.0 Eagle Biosciences, Inc. 20A Northwest Blvd.,

More information

Supplementary materials for manuscript entitled Development and Analytical

Supplementary materials for manuscript entitled Development and Analytical Supplementary materials for manuscript entitled Development and Analytical Validation of An Enzyme-Linked Immunosorbent assay (ELISA) for the detection of Copper in Human Hair and Serum Samples Manuscripte

More information

ab Apolipoprotein B (APOB) Human ELISA Kit

ab Apolipoprotein B (APOB) Human ELISA Kit ab108807 Apolipoprotein B (APOB) Human ELISA Kit Instructions for Use For the quantitative measurement of Human Apolipoprotein B (APOB) in plasma, serum, CSF and cell culture samples. This product is for

More information

Page 1 of 2. Standard curve of Human IFN gamma ELISA Ready- SET-Go! Product Information Contents: Human IFN gamma ELISA Ready- SET-Go!

Page 1 of 2. Standard curve of Human IFN gamma ELISA Ready- SET-Go! Product Information Contents: Human IFN gamma ELISA Ready- SET-Go! Page 1 of 2 Human IFN gamma ELISA Ready-SET-Go! Catalog Number: 88-7316 Also known as: Interferon-gamma, IFN-g, IFNg RUO: For. Not for use in diagnostic procedures. Standard curve of Human IFN gamma ELISA

More information

Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set

Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK40103 To achieve the best assay results, this manual must be read carefully before using this product and the assay

More information

SensoLyte Rh110 Cathepsin K Assay Kit *Fluorimetric* Revision#1.2 Last Updated: May 2017 Catalog # Kit Size

SensoLyte Rh110 Cathepsin K Assay Kit *Fluorimetric* Revision#1.2 Last Updated: May 2017 Catalog # Kit Size SensoLyte Rh110 Cathepsin K Assay Kit *Fluorimetric* Revision#1.2 Last Updated: May 2017 Catalog # 72152 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit detects Cathepsin K activity.

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

HIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual)

HIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual) HIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual) BACKGROUND Human Immunodeficiency Virus ( HIV ) can be divided into two major types, HIV type 1 (HIV-1) and HIV type 2 (HIV-2). HIV-1 is related to

More information

Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Product Manual Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Catalog Number STA-616 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is a lipid sterol

More information

Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set

Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Catalog Number : SEK11695 To achieve the best assay results, this manual must be read carefully before using this product

More information

Influenza A H1N1 HA ELISA Pair Set

Influenza A H1N1 HA ELISA Pair Set Influenza A H1N1 HA ELISA Pair Set for H1N1 ( A/Puerto Rico/8/1934 ) HA Catalog Number : SEK11684 To achieve the best assay results, this manual must be read carefully before using this product and the

More information

Human Oxidized LDL ELISA Kit (MDA-LDL Quantitation), General

Human Oxidized LDL ELISA Kit (MDA-LDL Quantitation), General Human Oxidized LDL ELISA Kit (MDA-LDL Quantitation), General For the detection and quantitation of human OxLDL in plasma, serum or other biological fluid samples Cat. No. KT-959 For Research Use Only.

More information

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:

More information

Data Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002

Data Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 Data Sheet PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 DESCRIPTION: The PCSK9[Biotinylated]-LDLR Binding Assay Kit is designed for screening and profiling purposes. PCSK9 is known to function

More information

Kynamro. Kynamro (mipomersen) Description

Kynamro. Kynamro (mipomersen) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: September 15, 2017 Kynamro Description Kynamro

More information

Nature Genetics: doi: /ng.3561

Nature Genetics: doi: /ng.3561 Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8

More information

Citation for published version (APA): Sivapalaratnam, S. (2012). The molecular basis of early onset cardiovascular disease

Citation for published version (APA): Sivapalaratnam, S. (2012). The molecular basis of early onset cardiovascular disease UvA-DARE (Digital Academic Repository) The molecular basis of early onset cardiovascular disease Sivapalaratnam, S. Link to publication Citation for published version (APA): Sivapalaratnam, S. (2012).

More information

Case Discussions: Treatment Strategies for High Risk Populations. Most Common Reasons for Referral to the Baylor Lipid Clinic

Case Discussions: Treatment Strategies for High Risk Populations. Most Common Reasons for Referral to the Baylor Lipid Clinic Case Discussions: Treatment Strategies for High Risk Populations Peter H. Jones MD, FNLA Associate Professor Methodist DeBakey Heart and Vascular Center Baylor College of Medicine Most Common Reasons for

More information

SUPPLEMENTAL MATERIAL. Number of patients 14

SUPPLEMENTAL MATERIAL. Number of patients 14 SUPPLEMENTAL MATERIAL Supplemental Table 1 Number of patients 14 Age, years 54.9 ± 10.0 Female gender, n (%) 6 (42.9) Diabetes, n (%) 2 (14.3) History of hypertension, n (%) 5 (35.7) Ever smoker, n (%)

More information

Validation of an ELISA development kit for apolipoprotein B measurement in dried blood spots. Geeta N Eick, Paul Kowal, J Josh Snodgrass

Validation of an ELISA development kit for apolipoprotein B measurement in dried blood spots. Geeta N Eick, Paul Kowal, J Josh Snodgrass Validation of an ELISA development kit for apolipoprotein B measurement in dried blood spots Geeta N Eick, Paul Kowal, J Josh Snodgrass Ischemic Cardiovascular Disease Leading cause of death worldwide

More information

Familial Hypercholesterolemia

Familial Hypercholesterolemia Familial Hypercholesterolemia Dr.Ramzi Al-Mohammadi Assistant Professor of Medicine Interventional Cardiologist, Advanced HF and Transplant Consultant Classification of Hyperlipedemia Primary hyperlipedemia:

More information

Nori Rabbit IL-2 ELISA Kit DataSheet

Nori Rabbit IL-2 ELISA Kit DataSheet Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

WORKSHOP 1. Management of Patients with Familial Hypercholesterolemia

WORKSHOP 1. Management of Patients with Familial Hypercholesterolemia WORKSHOP 1 Management of Patients with Familial Hypercholesterolemia Tutors: Manal Al-Kindi (Oman)/ Gilles Lambert (France) (Case 1) Zuhier Awan (KSA)/ Raul Santos (Brazil) (Case 2) Khalid Al-Waili (Oman)/

More information

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet Interleukin5 (IL5) is a secreted glycoprotein that belongs to the α-helical group of cytokines (1, 2, 3). Unlike other family members, it is present as a covalently linked antiparallel dimer (4, 5). IL-5

More information

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Human Cathepsin D ELISA Kit

Human Cathepsin D ELISA Kit GenWay Biotech, Inc. 6777 Nancy Ridge Drive San Diego, CA 92121 Phone: 858.458.0866 Fax: 858.458.0833 Email: techline@genwaybio.com http://www.genwaybio.com Human Cathepsin D ELISA Kit Catalog No. GWB-J4JVV9

More information

Antihyperlipidemic Drugs

Antihyperlipidemic Drugs Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types

More information

AssayMax Human Aldose Reductase ELISA Kit

AssayMax Human Aldose Reductase ELISA Kit AssayMax Human Aldose Reductase ELISA Kit Assaypro LLC 3400 Harry S Truman Blvd St. Charles, MO 63301 T (636) 447-9175 F (636) 395-7419 www.assaypro.com For any questions regarding troubleshooting or performing

More information

Mouse C-Peptide ELISA Kit

Mouse C-Peptide ELISA Kit Mouse C-Peptide ELISA Kit Cat.No: DEIA4507 Lot. No. (See product label) Size 96T Intended Use The Mouse C-Peptide ELISA kit is for the quantitative determination of c-peptide in mouse serum, plasma, and

More information

Long-Term Complications of Diabetes Mellitus Macrovascular Complication

Long-Term Complications of Diabetes Mellitus Macrovascular Complication Long-Term Complications of Diabetes Mellitus Macrovascular Complication Sung Hee Choi MD, PhD Professor, Seoul National University College of Medicine, SNUBH, Bundang Hospital Diabetes = CVD equivalent

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures.

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures. TNF-alpha ELISA For the quantitative determination of TNF-alpha in serum, plasma, buffered solution or cell culture medium. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number:

More information

Repatha. Repatha (evolocumab) Description

Repatha. Repatha (evolocumab) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.16.08 Subject: Repatha Page: 1 of 8 Last Review Date: September 18, 2015 Repatha Description Repatha

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

Juxtapid. Juxtapid (lomitapide) Description

Juxtapid. Juxtapid (lomitapide) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 Subject: Juxtapid Page: 1 of 6 Last Review Date: September 20, 2018 Juxtapid Description Juxtapid (lomitapide)

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

ab Lipoprotein A (APOA) Human ELISA Kit

ab Lipoprotein A (APOA) Human ELISA Kit ab108878 Lipoprotein A (APOA) Human ELISA Kit Instructions for Use For the quantitative measurement of Human Lipoprotein A (APOA) in plasma, serum, urine, milk and cell culture supernatants. This product

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Clinical Policy: Lomitapide (Juxtapid) Reference Number: ERX.SPA.170 Effective Date:

Clinical Policy: Lomitapide (Juxtapid) Reference Number: ERX.SPA.170 Effective Date: Clinical Policy: (Juxtapid) Reference Number: ERX.SPA.170 Effective Date: 01.11.17 Last Review Date: 11.17 Revision Log See Important Reminder at the end of this policy for important regulatory and legal

More information

e-figure 1. The design of the study.

e-figure 1. The design of the study. e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and

More information

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the

More information

Metabolism and Atherogenic Properties of LDL

Metabolism and Atherogenic Properties of LDL Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal

More information

B. Patient has not reached the percentage reduction goal with statin therapy

B. Patient has not reached the percentage reduction goal with statin therapy Managing Cardiovascular Risk: The Importance of Lowering LDL Cholesterol and Reaching Treatment Goals for LDL Cholesterol The Role of the Pharmacist Learning Objectives 1. Review the role of lipid levels

More information

Drug Class Monograph

Drug Class Monograph Drug Class Monograph Class: Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) Inhibitor Drugs: Praluent (alirocumab), Repatha (evolocumab) Line of Business: Medi-Cal Effective Date: February 17, 2016

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

Clinical Policy: Mipomersen (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017

Clinical Policy: Mipomersen (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017 Clinical Policy: (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017 Last Review Date: Revision Log See Important Reminder at the end of this policy for important regulatory and legal information.

More information

Hyaluronan Quantification Kit

Hyaluronan Quantification Kit Product manual (ELISA-like assay for HA / Hyaluronic Acid) Updated on Jan. 6th, 207 - Background Hyaluronan (HA) is an unbranched glycosaminoglycan composed of repeating disaccharide units of D-glucronic

More information

Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Catalog Number KA1538 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...

More information

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit 2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as

More information

PCSK9 Agents Drug Class Prior Authorization Protocol

PCSK9 Agents Drug Class Prior Authorization Protocol PCSK9 Agents Drug Class Prior Authorization Protocol Line of Business: Medicaid P & T Approval Date: February 21, 2018 Effective Date: April 1, 2018 This policy has been developed through review of medical

More information

Supporting Information

Supporting Information Supporting Information Valkenburg et al. 10.1073/pnas.1403684111 SI Materials and Methods ELISA and Microneutralization. Sera were treated with Receptor Destroying Enzyme II (RDE II, Accurate) before ELISA

More information

Mouse TrkB ELISA Kit

Mouse TrkB ELISA Kit Mouse TrkB ELISA Kit CATALOG NO: IRKTAH5472 LOT NO: SAMPLE INTENDED USE For quantitative detection of mouse TrkB in cell culture supernates, cell lysates and tissue homogenates. BACKGROUND TrkB receptor

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Low-density lipoproteins cause atherosclerotic cardiovascular disease (ASCVD) 1. Evidence from genetic, epidemiologic and clinical studies

Low-density lipoproteins cause atherosclerotic cardiovascular disease (ASCVD) 1. Evidence from genetic, epidemiologic and clinical studies Low-density lipoproteins cause atherosclerotic cardiovascular disease (ASCVD) 1. Evidence from genetic, epidemiologic and clinical studies A Consensus Statement from the European Atherosclerosis Society

More information

Comprehensive Treatment for Dyslipidemias. Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium

Comprehensive Treatment for Dyslipidemias. Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium Comprehensive Treatment for Dyslipidemias Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium Primary Prevention 41 y/o healthy male No Medications Normal BP, Glucose and BMI Social History:

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity

More information

Proprotein Convertase Subtilisin/Kexin type 9(PCSK9) Inhibitors Prior Authorization with Quantity Limit Program Summary

Proprotein Convertase Subtilisin/Kexin type 9(PCSK9) Inhibitors Prior Authorization with Quantity Limit Program Summary Proprotein Convertase Subtilisin/Kexin type 9(PCSK9) Inhibitors Prior Authorization with Quantity Limit Program Summary Proprotein Convertase Subtilisin/Kexin type 9(PCSK9) Inhibitors Prior Authorization

More information

Repatha. Repatha (evolocumab) Description

Repatha. Repatha (evolocumab) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.08 Subject: Repatha Page: 1 of 8 Last Review Date: December 2, 2016 Repatha Description Repatha (evolocumab)

More information

EPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric)

More information

Cardiovascular risk reduction in diabetes Lipids (NICE CG181)

Cardiovascular risk reduction in diabetes Lipids (NICE CG181) Cardiovascular risk reduction in diabetes Lipids (NICE CG181) Primary Prevention T1DM Offer Atorvastatin 20mg if >40 years old Diabetes duration >10 years Established nephropathy Other CVS risk factors

More information

ab Apolipoprotein A1 (APOA1) Human SimpleStep ELISA Kit

ab Apolipoprotein A1 (APOA1) Human SimpleStep ELISA Kit ab189576 Apolipoprotein A1 (APOA1) Human SimpleStep ELISA Kit Instructions for Use For the quantitative measurement of Apolipoprotein A1 (APOA1) in human serum, plasma, and cell culture supernatants. This

More information

Disclosures. Diabetes and Cardiovascular Risk Management. Learning Objectives. Atherosclerotic Cardiovascular Disease

Disclosures. Diabetes and Cardiovascular Risk Management. Learning Objectives. Atherosclerotic Cardiovascular Disease Disclosures Diabetes and Cardiovascular Risk Management Tony Hampton, MD, MBA Medical Director Advocate Aurora Operating System Advocate Aurora Healthcare Downers Grove, IL No conflicts or disclosures

More information

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

Novel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes

Novel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes Novel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes Rajat Deo, MD, MTR Assistant Professor of Medicine Division of Cardiology University of Pennsylvania April 25,

More information

Data Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002

Data Sheet. PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 Data Sheet PCSK9[Biotinylated]-LDLR Binding Assay Kit Catalog # 72002 DESCRIPTION: The PCSK9[Biotinylated]-LDLR Binding Assay Kit is designed for screening and profiling purposes. PCSK9 is known to function

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

HDL Purification Kit (Ultracentrifugation Free)

HDL Purification Kit (Ultracentrifugation Free) Product Manual HDL Purification Kit (Ultracentrifugation Free) Catalog Number STA- 607 10 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipoproteins are submicroscopic particles

More information