Releasing SNP Data and GWAS Results with Guaranteed Privacy Protection
|
|
- Gavin Williams
- 6 years ago
- Views:
Transcription
1 integrating Data for Analysis, Anonymization, and SHaring Releasing SNP Data and GWAS Results with Guaranteed Privacy Protection Xiaoqian Jiang, PhD and Shuang Wang, PhD
2 Overview Introduction idash healthcare Privacy Protection Challenge» Tasks overview Summary of results» Task 1: Privacy-preserving SNP data sharing» Task 2: Privacy-preserving GWAS results sharing Conclusions 9/25/2014 Supported by the NIH Grant U54 HL to the University of California, San Diego 2
3 Human genome privacy Human genomes are important to biomedical research, e.g., Genome-wide association studies (GWAS) But genomic data are also highly sensitive» Diseases association: predisposition to Diabetes, Cancer» Re-identification: name» Information disclosure of blood relatives» A great fear of unknown Supported by the NIH Grant U54 HL to the University of California, San Diego 3
4 Privacy risk at SNP level Lin et. al science: as few as 75 statistically independent SNPs (Single-nucleotide polymorphism) will be sufficient to identify a single person Gymrek et al Science: surnames can be recovered from personal genomes by profiling short tandem repeats on the Y chromosome and querying recreational genetic genealogy databases Supported by the NIH Grant U54 HL to the University of California, San Diego 4
5 Even statistics might be unsafe G Y Reference population Person of interest F Mixture Homer et. al PLoS genetics: aggregate genome data (i.e., allele frequencies) can also be used for re-identifying an individual in a case group with a certain disease Supported by the NIH Grant U54 HL to the University of California, San Diego 5
6 Even statistics might be unsafe G Y Reference population Person of interest F Mixture Most likely to be in the mixture Equally likely to be in the mixture in the reference population Most likely to be in the reference population Homer et. al PLoS genetics: aggregate genome data (i.e., allele frequencies) can also be used for re-identifying an individual in a case group with a certain disease Supported by the NIH Grant U54 HL to the University of California, San Diego 6
7 Even statistics might be unsafe G Y Reference population Person of interest F Mixture Most likely to be in the mixture Equally likely to be in the mixture in the reference population Most likely to be in the reference population Homer et. al PLoS genetics: aggregate genome data (i.e., allele frequencies) can also be used for re-identifying an individual in a case group with a certain disease Supported by the NIH Grant U54 HL to the University of California, San Diego 7
8 idash healthcare Privacy Protection Challenge Evaluate solutions of guaranteed privacy protection Task 1: Privacy-preserving SNP Data Sharing» Four teams (i.e., IU, OU, UT Dallas, and McGill) Task 2: Privacy-preserving release of top K most significant SNPs» Two teams (i.e., UT Austin and CMU) Supported by the NIH Grant U54 HL to the University of California, San Diego 8
9 Data preparation Task 1: data publishing Case: 200 PGP individuals Control: 174 CEU individuals Data set 1: 311 SNVs Data set 2: 600 SNVs Filtered and genotyped Task 2: top-k SNP identification Case: 200 PGP individuals Control: 174 CEU individuals Data set 1: 5000 SNVs Data set 2: 106,129 SNVs Overview and methodology papers are under review for BMC Biomedical Informatics and Decision Making 9/25/2014 Supported by the NIH Grant U54 HL to the University of California, San Diego 9
10 Overview Introduction idash healthcare Privacy Protection Challenge» Tasks overview Summary of results» Task 1: Privacy-preserving SNP data sharing» Task 2: Privacy-preserving GWAS results sharing Conclusions 9/25/2014 Supported by the NIH Grant U54 HL to the University of California, San Diego 10
11 Task 1: Privacy-preserving SNP Data Sharing Goal: Understand privacy-utility balance in released SNP data, after proper protection Utility: number of significant SNPs identified by the Chi-square association test over the 200 case samples and 174 control samples Also checked: published data s resistance to the likelihood ratio attack (Sankararaman et. al Nature Genetics) Supported by the NIH Grant U54 HL to the University of California, San Diego 11
12 Task 2: Privacy-preserving GWAS results sharing Goal: assess GWAS utility in differentially private data analysis Utility: how likely top-k (e.g., K=1 or 5) most significant SNPs (using chi-square tests) can be preserved in differentially private queries Privacy Protection: Differential privacy with a budget ε=1.0 Supported by the NIH Grant U54 HL to the University of California, San Diego 12
13 Utility: Case-Control Association Test Adopt from Supported by the NIH Grant U54 HL to the University of California, San Diego 13
14 Overview Introduction idash healthcare Privacy Protection Challenge» Tasks overview Summary of results» Task 1: Privacy-preserving SNP data sharing» Task 2: Privacy-preserving GWAS results sharing Conclusions 9/25/2014 Supported by the NIH Grant U54 HL to the University of California, San Diego 14
15 Experimental results *Re-identification power was calculated at the 0.95 confidence level (i.e., false positive rate of 0.05). Supported by the NIH Grant U54 HL to the University of California, San Diego 15
16 Overview Introduction idash healthcare Privacy Protection Challenge» Tasks overview Summary of results» Task 1: Privacy-preserving SNP data sharing» Task 2: Privacy-preserving GWAS results sharing Conclusions 9/25/2014 Supported by the NIH Grant U54 HL to the University of California, San Diego 16
17 Results in Task 2 Probabilities that top K (K = 1, 3, 5, 10, 30) most significant SNPs have been preserved in the release data over 1000 trials Mechanism Utility function UT Austin Exponential mechanism Hamming distance CMU Exponential mechanism Chi-squared statistics Small Dataset: 201 cases and 174 controls 5000 SNPs Large Dataset: All valid genotypes on 201 cases and 174 controls 106,129 SNPs Supported by the NIH Grant U54 HL to the University of California, San Diego 17
18 Conclusions of Task 1 It remains a challenge to privacy-preserved sharing of SNP data, while maintaining their utilities in GWAS using differential privacy» Even for a single genomic locus involving a few hundreds of SNPs, the utility of the data was large damaged after noise-adding to ensure privacy protection It is un-likely that current differential privacy techniques will scale well for sharing whole human genomic data Supported by the NIH Grant U54 HL to the University of California, San Diego 18
19 Conclusions of Task 2 Privacy-preserving techniques work surprisingly well on publishing outcomes of GWAS-like analyses» Good accuracy can be achieved when only a small number of most significant SNPs are concerned from the users perspective This task is well aligned with the centralized data/computing model» The centralized data/computing center will host human genomic data as well as service for customized analyses on these data, and will only release the results of these analyses to users Supported by the NIH Grant U54 HL to the University of California, San Diego 19
20 Papers under review Jiang, X., Zhao, Y., Wang, X., Malin, B., Wang, S., Ohno-, L., & Tang, H. (n.d.). A Community Assessment of Privacy Preserving Techniques for Human Genomes. BMC Medical Informatics Decision Making (under Review). Wang, S., Mohammed, N., & Chen, R. (2014). Differentially Private Genome Data Dissemination through Top-Down Specialization. BMC Medical Informatics Decision Making (under Review). Yu, F., & Ji, Z. (2014). Scalable Privacy-Preserving Data Sharing Methodology for Genome-Wide Association Studies : An Application to idash Healthcare Privacy Protection Challenge. BMC Medical Informatics Decision Making (under Review). Roozgard, A., Barzigar, N., Verma, P., & Cheng, S. (2014). Genomic Data Privacy Protection using Compressed Sensing. BMC Medical Informatics Decision Making (under Review). 9/25/2014 Supported by the NIH Grant U54 HL to the University of California, San Diego 20
21 Acknowledgements NIH idash U54HK NIH R01 HG NLM R00 LM NHGRI K99 1K99HG Supported by the NIH Grant U54 HL to the University of California, San Diego 21
22 Thank you! Questions? 9/25/2014 Supported by the NIH Grant U54 HL to the University of California, San Diego
23 Protection against attack Likelihood Ratio Test 0.05 significance level LR test statistics Participants Sankararaman, S., Obozinski, G., Jordan, M. I., & Halperin, E. (2009). Nature Genetics, 41(9), doi: /ng.436 Supported by the NIH Grant U54 HL to the University of California, San Diego 23
SNPrints: Defining SNP signatures for prediction of onset in complex diseases
SNPrints: Defining SNP signatures for prediction of onset in complex diseases Linda Liu, Biomedical Informatics, Stanford University Daniel Newburger, Biomedical Informatics, Stanford University Grace
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationNew Enhancements: GWAS Workflows with SVS
New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More informationSingle SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach)
High-Throughput Sequencing Course Gene-Set Analysis Biostatistics and Bioinformatics Summer 28 Section Introduction What is Gene Set Analysis? Many names for gene set analysis: Pathway analysis Gene set
More informationComputer Models for Medical Diagnosis and Prognostication
Computer Models for Medical Diagnosis and Prognostication Lucila Ohno-Machado, MD, PhD Division of Biomedical Informatics Clinical pattern recognition and predictive models Evaluation of binary classifiers
More informationDNA Analysis Techniques for Molecular Genealogy. Luke Hutchison Project Supervisor: Scott R. Woodward
DNA Analysis Techniques for Molecular Genealogy Luke Hutchison (lukeh@email.byu.edu) Project Supervisor: Scott R. Woodward Mission: The BYU Center for Molecular Genealogy To establish the world s most
More informationBST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
More informationI, Mary M. Langman, Director, Information Issues and Policy, Medical Library Association
I, Mary M. Langman, Director, Information Issues and Policy, Medical Library Association (MLA), submit this statement on behalf of MLA and the Association of Academic Health Sciences Libraries (AAHSL).
More informationGenome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54
CORRECTION NOTICE Nat. Genet. 42, 759 763 (2010); published online 22 August 2010; corrected online 27 August 2014 Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects
More informationUsing Network Flow to Bridge the Gap between Genotype and Phenotype. Teresa Przytycka NIH / NLM / NCBI
Using Network Flow to Bridge the Gap between Genotype and Phenotype Teresa Przytycka NIH / NLM / NCBI Journal Wisla (1902) Picture from a local fare in Lublin, Poland Genotypes Phenotypes Journal Wisla
More informationWhat can we contribute to cancer research and treatment from Computer Science or Mathematics? How do we adapt our expertise for them
From Bioinformatics to Health Information Technology Outline What can we contribute to cancer research and treatment from Computer Science or Mathematics? How do we adapt our expertise for them Introduction
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationOncoPhase: Quantification of somatic mutation cellular prevalence using phase information
OncoPhase: Quantification of somatic mutation cellular prevalence using phase information Donatien Chedom-Fotso 1, 2, 3, Ahmed Ashour Ahmed 1, 2, and Christopher Yau 3, 4 1 Ovarian Cancer Cell Laboratory,
More informationDeriving Rules and Assertions From Pharmacogenomic Knowledge Resources In Support Of Patient Drug Metabolism Efficacy Predictions!
Deriving Rules and Assertions From Pharmacogenomic Knowledge Resources In Support Of Patient Drug Metabolism Efficacy Predictions! Casey L. Overby 1,2, Beth Devine 1, Peter Tarczy-Hornoch 1, Ira Kalet
More informationA rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France
A rare variant in MYH6 confers high risk of sick sinus syndrome Hilma Hólm ESC Congress 2011 Paris, France Disclosures I am an employee of decode genetics, Reykjavik, Iceland. Sick sinus syndrome SSS is
More informationCalculate the percentage of cytosine for the beetle. (2)
Questions Q1. (i) Figure 10 shows the percentages of bases for three organisms. Calculate the percentage of cytosine for the beetle.... % (ii) Explain why the information given about the Ebola virus indicates
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationThe Foundations of Personalized Medicine
The Foundations of Personalized Medicine Jeremy M. Berg Pittsburgh Foundation Professor and Director, Institute for Personalized Medicine University of Pittsburgh Personalized Medicine Physicians have
More informationAudGenDB: a Public, Internet-Based, Audiologic - Otologic - Genetic Database for Pediatric Hearing Research
AudGenDB: a Public, Internet-Based, Audiologic - Otologic - Genetic Database for Pediatric Hearing Research John Germiller 1,2, Michael Italia 4, Jeffrey Pennington 4, Byron Ruth 4, Peter White 4,5, Joy
More informationDETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview
More informationDan Koller, Ph.D. Medical and Molecular Genetics
Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationData mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
More informationInter-session reproducibility measures for high-throughput data sources
Inter-session reproducibility measures for high-throughput data sources Milos Hauskrecht, PhD, Richard Pelikan, MSc Computer Science Department, Intelligent Systems Program, Department of Biomedical Informatics,
More informationEvaluating Classifiers for Disease Gene Discovery
Evaluating Classifiers for Disease Gene Discovery Kino Coursey Lon Turnbull khc0021@unt.edu lt0013@unt.edu Abstract Identification of genes involved in human hereditary disease is an important bioinfomatics
More informationBjoern Peters La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012
www.iedb.org Bjoern Peters bpeters@liai.org La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012 Overview 1. Introduction to the IEDB 2. Application: 2009 Swine-origin influenza virus
More informationProtecting Patient Privacy in Genomic Analysis
Protecting Patient Privacy in Genomic Analysis David Wu Stanford University based on joint works with: Gill Bejerano, Bonnie Berger, Johannes A. Birgmeier, Dan Boneh, Hyunghoon Cho, and Karthik A. Jagadeesh
More informationMapping evolutionary pathways of HIV-1 drug resistance using conditional selection pressure. Christopher Lee, UCLA
Mapping evolutionary pathways of HIV-1 drug resistance using conditional selection pressure Christopher Lee, UCLA HIV-1 Protease and RT: anti-retroviral drug targets protease RT Protease: responsible for
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationCausal modeling in the lung Combining multiple data types to enhance clinical diagnosis
Causal modeling in the lung Combining multiple data types to enhance clinical diagnosis Takis Benos Department of Computational & Systems Biology University of Pittsburgh, SOM CCM Workshop, Pittsburgh,
More informationChallenges and Opportunities with Rapidly-Changing Biomedical Technologies:
Challenges and Opportunities with Rapidly-Changing Biomedical Technologies: Insights from Genetic Testing for Colorectal Cancer 2016 CADTH Symposium Joanne Kim, M.Sc., Ph.D. 1 Disclosure The views expressed
More informationBST227: Introduction to Statistical Genetics
BST227: Introduction to Statistical Genetics Lecture 11: Heritability from summary statistics & epigenetic enrichments Guest Lecturer: Caleb Lareau Success of GWAS EBI Human GWAS Catalog As of this morning
More informationCreating Interpretable Collaborative Patterns to Detect Insider Threats
Creating Interpretable Collaborative Patterns to Detect Insider Threats You Chen Department of Biomedical Informatics, Vanderbilt University You.chen@vanderbilt.edu http://hiplab.org/~ychen 1 What Makes
More informationCorporate Medical Policy
Corporate Medical Policy Common Genetic Variants to Predict Risk of Nonfamilial Breast File Name: Origination: Last CAP Review: Next CAP Review: Last Review: common_genetic_variants_to_predict_risk_of_nonfamilial_breast_cancer
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More information2) Cases and controls were genotyped on different platforms. The comparability of the platforms should be discussed.
Reviewers' Comments: Reviewer #1 (Remarks to the Author) The manuscript titled 'Association of variations in HLA-class II and other loci with susceptibility to lung adenocarcinoma with EGFR mutation' evaluated
More informationIL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B
IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,
More informationIntroduction of Genome wide Complex Trait Analysis (GCTA) Presenter: Yue Ming Chen Location: Stat Gen Workshop Date: 6/7/2013
Introduction of Genome wide Complex Trait Analysis (GCTA) resenter: ue Ming Chen Location: Stat Gen Workshop Date: 6/7/013 Outline Brief review of quantitative genetics Overview of GCTA Ideas Main functions
More informationReliability of Ordination Analyses
Reliability of Ordination Analyses Objectives: Discuss Reliability Define Consistency and Accuracy Discuss Validation Methods Opening Thoughts Inference Space: What is it? Inference space can be defined
More informationImaging Genetics: Heritability, Linkage & Association
Imaging Genetics: Heritability, Linkage & Association David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University July 17, 2011 Memory Activation & APOE ε4 Risk
More informationWorld Leading Expertise in Use of Medical Records
World Leading Expertise in Use of Medical Records Frank Sullivan FRSE, FRCP, FRCGP, CCFP General Medical Practitioner, North Glen Practice, Glenrothes Professor of Primary Care Medicine, University of
More informationEXTRACTION AND IDENTIFICATION OF KNOWN GENES OF LIFESTYLE DISEASES IN MEN AND WOMEN 20 YEARS AND OVER: A PILOT STUDY IN ILOCOS, BICOL AND METRO MANILA
EXTRACTION AND IDENTIFICATION OF KNOWN GENES OF LIFESTYLE DISEASES IN MEN AND WOMEN 20 YEARS AND OVER: A PILOT STUDY IN ILOCOS, BICOL AND METRO MANILA Celeste C. Tancho, Ph.D., Mario V. Capanzana, Ph.D.,
More informationGenetic Heterogeneity of Clinically Defined AD. Andrew J. Saykin, PsyD Indiana ADC ADC Clinical Core Leaders Meeting April 22, 2017
Genetic Heterogeneity of Clinically Defined AD Andrew J. Saykin, PsyD Indiana ADC ADC Clinical Core Leaders Meeting April 22, 2017 Disclosures & Acknowledgements Disclosures Eli Lilly (Collaborative Grant),
More informationA computational framework for discovery of glycoproteomic biomarkers
A computational framework for discovery of glycoproteomic biomarkers Haixu Tang, Anoop Mayampurath, Chuan-Yih Yu Indiana University, Bloomington Yehia Mechref, Erwang Song Texas Tech University 1 Goal:
More informationProblem 3: Simulated Rheumatoid Arthritis Data
Problem 3: Simulated Rheumatoid Arthritis Data Michael B Miller Michael Li Gregg Lind Soon-Young Jang The plan
More informationPERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST
INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED
More informationintegrating Data for Analysis, Anonymization, and SHaring
integrating Data for Analysis, Anonymization, and SHaring Informed Consent for Biospecimen Collection and Data Sharing among Low-income, Uninsured and Underinsured Women: Is it a Matter of Trust? Maria
More informationHost Genomics of HIV-1
4 th International Workshop on HIV & Aging Host Genomics of HIV-1 Paul McLaren École Polytechnique Fédérale de Lausanne - EPFL Lausanne, Switzerland paul.mclaren@epfl.ch Complex trait genetics Phenotypic
More informationSupplementary Figure 1: Classification scheme for non-synonymous and nonsense germline MC1R variants. The common variants with previously established
Supplementary Figure 1: Classification scheme for nonsynonymous and nonsense germline MC1R variants. The common variants with previously established classifications 1 3 are shown. The effect of novel missense
More informationComplex Trait Genetics in Animal Models. Will Valdar Oxford University
Complex Trait Genetics in Animal Models Will Valdar Oxford University Mapping Genes for Quantitative Traits in Outbred Mice Will Valdar Oxford University What s so great about mice? Share ~99% of genes
More information10/19/2017. How Nutritional Genomics Affects You in Nutrition Research and Practice Joyanna Hansen, PhD, RD & Kristin Guertin, PhD, MPH
Disclosures Joyanna Hansen How Affects You in Nutrition Research and Practice Joyanna Hansen, PhD, RD & Kristin Guertin, PhD, MPH Consultant Nutricia North America Research Support Academy of Nutrition
More informationNational Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant
National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant Reporting Period July 1, 2012 June 30, 2013 Formula Grant Overview The NSABP Foundation
More informationVisualizing Temporal Patterns by Clustering Patients
Visualizing Temporal Patterns by Clustering Patients Grace Shin, MS 1 ; Samuel McLean, MD 2 ; June Hu, MS 2 ; David Gotz, PhD 1 1 School of Information and Library Science; 2 Department of Anesthesiology
More informationCan DNA Witness Race?: Forensic Uses of an Imperfect Ancestry Testing Technology
Can DNA Witness Race?: Forensic Uses of an Imperfect Ancestry Testing Technology The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters.
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationIN SILICO EVALUATION OF DNA-POOLED ALLELOTYPING VERSUS INDIVIDUAL GENOTYPING FOR GENOME-WIDE ASSOCIATION STUDIES OF COMPLEX DISEASE.
IN SILICO EVALUATION OF DNA-POOLED ALLELOTYPING VERSUS INDIVIDUAL GENOTYPING FOR GENOME-WIDE ASSOCIATION STUDIES OF COMPLEX DISEASE By Siddharth Pratap Thesis Submitted to the Faculty of the Graduate School
More informationGenome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant
More informationInvestigating causality in the association between 25(OH)D and schizophrenia
Investigating causality in the association between 25(OH)D and schizophrenia Amy E. Taylor PhD 1,2,3, Stephen Burgess PhD 1,4, Jennifer J. Ware PhD 1,2,5, Suzanne H. Gage PhD 1,2,3, SUNLIGHT consortium,
More informationStatistical Tests for X Chromosome Association Study. with Simulations. Jian Wang July 10, 2012
Statistical Tests for X Chromosome Association Study with Simulations Jian Wang July 10, 2012 Statistical Tests Zheng G, et al. 2007. Testing association for markers on the X chromosome. Genetic Epidemiology
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationSVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN
SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect
More informationThe Six Ws of DNA testing A scenario-based activity introducing medical applications of DNA testing
The Six Ws of DNA testing A scenario-based activity introducing medical applications of DNA testing Overview This activity introduces a number of different ways that genetic tests can be used in medicine.
More informationWhite Paper Estimating Complex Phenotype Prevalence Using Predictive Models
White Paper 23-12 Estimating Complex Phenotype Prevalence Using Predictive Models Authors: Nicholas A. Furlotte Aaron Kleinman Robin Smith David Hinds Created: September 25 th, 2015 September 25th, 2015
More informationBig Data Phenomics in the VA. Outline
Big Phenomics in the VA Mary Whooley MD Director, VA Measurement Science QUERI San Francisco VA Health Care System University of California, San Francisco Kelly Cho PhD MPH Phenomics Lead, Million Veteran
More informationSupplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations
Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations Kouichi Ozaki 1, Hiroshi Sato 2, Katsumi Inoue 3, Tatsuhiko Tsunoda 4, Yasuhiko
More informationNutrigenomics and Personalised Nutrition. John Hesketh
Nutrigenomics and Personalised Nutrition How close is science-based evidence to support personalised nutrition? How best can these technical capabilities be put to use? John Hesketh Newcastle University
More informationWho Subscribe to Identity Theft Protection Service
DECISION SCIENCES INSTITUTE? An Exploration of Antecedent Factors Yuan Li University of Illinois at Springfield Email: yli295@uis.edu Jingguo Wang University of Texas at Arlington Email: jwang@uta.edu
More informationAn Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018
An Introduction to Quantitative Genetics I Heather A Lawson Advanced Genetics Spring2018 Outline What is Quantitative Genetics? Genotypic Values and Genetic Effects Heritability Linkage Disequilibrium
More informationTesting the robustness of anonymization techniques: acceptable versus unacceptable inferences - Draft Version
Testing the robustness of anonymization techniques: acceptable versus unacceptable inferences - Draft Version Gergely Acs, Claude Castelluccia, Daniel Le étayer 1 Introduction Anonymization is a critical
More informationMassoud Houshmand National Institute for Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran
QUID 2017, pp. 669-673, Special Issue N 1- ISSN: 1692-343X, Medellín-Colombia NON-GENE REGION AND INFLUENCES TUMOR CHARACTERISTICS BY LOW-RISK ALLELES IN BREAST CANCER (Recibido el 21-06-2017. Aprobado
More informationCancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer
Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:
More informationMULTIFACTORIAL DISEASES. MG L-10 July 7 th 2014
MULTIFACTORIAL DISEASES MG L-10 July 7 th 2014 Genetic Diseases Unifactorial Chromosomal Multifactorial AD Numerical AR Structural X-linked Microdeletions Mitochondrial Spectrum of Alterations in DNA Sequence
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationComment 4. Below are a few areas where NLM might be able to apply these twin areas of recommendation:
Comment 1 Current NLM elements that are of the most, or least, value to the research community (including biomedical, clinical, behavioral, health services, public health, and historical researchers) and
More informationNational Disease Research Interchange Annual Progress Report: 2010 Formula Grant
National Disease Research Interchange Annual Progress Report: 2010 Formula Grant Reporting Period July 1, 2011 June 30, 2012 Formula Grant Overview The National Disease Research Interchange received $62,393
More informationGENETIC LINKAGE ANALYSIS
Atlas of Genetics and Cytogenetics in Oncology and Haematology GENETIC LINKAGE ANALYSIS * I- Recombination fraction II- Definition of the "lod score" of a family III- Test for linkage IV- Estimation of
More informationPerceived challenges in genomic-based drug development. Garret A. FitzGerald University of Pennsylvania
Perceived challenges in genomic-based drug development Garret A. FitzGerald University of Pennsylvania Genomics Based Personalization of Medicine A Case in Point in Cancer Aside from emerging resistance.
More informationSupplementary webappendix
Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Hartman M, Loy EY, Ku CS, Chia KS. Molecular
More informationUses of the NIH Collaboratory Distributed Research Network
Uses of the NIH Collaboratory Distributed Research Network Jeffrey Brown, PhD for the DRN Team Harvard Pilgrim Care Institute and Harvard Medical School March 11, 2016 The Goal The NIH Collaboratory DRN
More informationPhenDisco: a new phenotype discovery system for the database of genotypes and phenotypes
PhenDisco: a new phenotype discovery system for the database of genotypes and phenotypes Son Doan, Hyeoneui Kim Division of Biomedical Informatics University of California San Diego Open Access Journal
More informationAnalysis of glutathione peroxidase 1 gene polymorphism and Keshan disease in Heilongjiang Province, China
Analysis of glutathione peroxidase 1 gene polymorphism and Keshan disease in Heilongjiang Province, China H.L. Wei, J.R. Pei, C.X. Jiang, L.W. Zhou, T. Lan, M. Liu and T. Wang Center for Endemic Disease
More informationName: PS#: Biol 3301 Midterm 1 Spring 2012
Name: PS#: Biol 3301 Midterm 1 Spring 2012 Multiple Choice. Circle the single best answer. (4 pts each) 1. Which of the following changes in the DNA sequence of a gene will produce a new allele? a) base
More informationAssessing Accuracy of Genotype Imputation in American Indians
Assessing Accuracy of Genotype Imputation in American Indians Alka Malhotra*, Sayuko Kobes, Clifton Bogardus, William C. Knowler, Leslie J. Baier, Robert L. Hanson Phoenix Epidemiology and Clinical Research
More informationSupplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles
Supplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles (green) of (A) HLA-A, HLA-B, (C) HLA-C, (D) HLA-DQA1,
More informationEtiology of Chronic Diseases. Complex Diseases Genes and Environment Initiative
Etiology of Chronic Diseases Complex Diseases Genes and Environment Initiative Top 10 Causes of Mortality in 2003 Death Rate per 100,000 Heart disease...232 Cancer...190 Cerebrovascular disease....54 Chronic
More informationNDRI Private Donor Program: Accelerating Biomedical Research via Private Donation
1 NDRI Private Donor Program: Accelerating Biomedical Research via Private Donation Jeffrey Thomas Vice President, Strategic Initiatives Honesto Nunez III Private Donor/Rare Disease Manager Webinar Objectives
More informationCase-based reasoning using electronic health records efficiently identifies eligible patients for clinical trials
Case-based reasoning using electronic health records efficiently identifies eligible patients for clinical trials Riccardo Miotto and Chunhua Weng Department of Biomedical Informatics Columbia University,
More informationTB trends and TB genotyping
Management of a TB Contact Investigation for Public Health Workers Albuquerque, NM October 1, 214 TB trends and TB genotyping Marcos Burgos MD October 1, 214 Marcos Burgos, MD has the following disclosures
More informationNature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
More informationCitation for published version (APA): van Munster, B. C. (2009). Pathophysiological studies in delirium : a focus on genetics.
UvA-DARE (Digital Academic Repository) Pathophysiological studies in delirium : a focus on genetics van Munster, B.C. Link to publication Citation for published version (APA): van Munster, B. C. (2009).
More informationLeveraging Interaction between Genetic Variants and Mammographic Findings for Personalized Breast Cancer Diagnosis
Leveraging Interaction between Genetic Variants and Mammographic Findings for Personalized Breast Cancer Diagnosis Jie Liu, PhD 1, Yirong Wu, PhD 1, Irene Ong, PhD 1, David Page, PhD 1, Peggy Peissig,
More informationSimplifying Treatment Protocol Development with.. By Healthy at Work and SaluGenecists
Simplifying Treatment Protocol Development with.. By Healthy at Work and SaluGenecists Artificial Intelligence for Healthcare: Why the Functional Medicine Model is Much Better. There is increasing interest
More informationLorne A. Becker MD Emeritus Professor SUNY Upstate Medical University. Co-Chair, Cochrane Collaboration Steering Group
Lorne A. Becker MD Emeritus Professor SUNY Upstate Medical University Co-Chair, Cochrane Collaboration Steering Group Many different types Vary in Complexity Trustworthiness of conclusions http://www.ahrq.gov/clinic/uspstf/uspscopd.htm
More informationHuman Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980
Human Genetics of Tuberculosis Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human genetics in tuberculosis? Concept Epidemiological/familial
More informationAsthma Surveillance Using Social Media Data
Asthma Surveillance Using Social Media Data Wenli Zhang 1, Sudha Ram 1, Mark Burkart 2, Max Williams 2, and Yolande Pengetnze 2 University of Arizona 1, PCCI-Parkland Center for Clinical Innovation 2 {wenlizhang,
More informationHeart Attack Readmissions in Virginia
Heart Attack Readmissions in Virginia Schroeder Center Statistical Brief Research by Mitchell Cole, William & Mary Public Policy, MPP Class of 2017 Highlights: In 2014, almost 11.2 percent of patients
More informationChildren, Toronto, Ontario, Canada. Department of Laboratory Medicine and Pathobiology Hospital for Sick Children, Toronto, Ontario, Canada, M5G 1X8
Supplementary Information for Clinically Relevant Copy Number Variations Detected In Cerebral Palsy Maryam Oskoui 1, *, Matthew J. Gazzellone 2,3, *, Bhooma Thiruvahindrapuram 2,3, Mehdi Zarrei 2,3, John
More informationDeciphering the Role of micrornas in BRD4-NUT Fusion Gene Induced NUT Midline Carcinoma
www.bioinformation.net Volume 13(6) Hypothesis Deciphering the Role of micrornas in BRD4-NUT Fusion Gene Induced NUT Midline Carcinoma Ekta Pathak 1, Bhavya 1, Divya Mishra 1, Neelam Atri 1, 2, Rajeev
More information