*To whom correspondence should be addressed. This PDF file includes:

Size: px
Start display at page:

Download "*To whom correspondence should be addressed. This PDF file includes:"

Transcription

1 Supporting Online Material for Partial Retraction to Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue Syndrome Vincent C. Lombardi, Francis W. Ruscetti, Jaydip Das Gupta, Max A. Pfost, Kathryn S. Hagen, Daniel L. Peterson, Sandra K. Ruscetti, Rachel K. Bagni, Cari Petrow-Sadowski, Bert Gold, Michael Dean, Robert H. Silverman,* Judy A. Mikovits *To whom correspondence should be addressed. This PDF file includes: Materials and Methods SOM Text Figs. S1 to S4 Tables S1 and S2 References Posted 22 September 2011 DOI: /science

2 Presence of XMRV Plasmid in Samples of Chronic Fatigue Syndrome Patient DNA Background In 2009, Lombardi et al.(1) reported an association between the retrovirus xenotropic murine leukemia virus-related virus (XMRV) and chronic fatigue syndrome (CFS), a debilitating disease of unknown etiology. The evidence included detection of XMRV DNA by PCR, culturing infectious XMRV from plasma and blood cells, electron microscopy of viral particles, and presence of circulating antibody reactive against a murine leukemia virus (MLV) envelope protein. However, with the exception of a single report of different polytropic and modified-polytropic MLV sequences in CFS blood (2), no other research team has published a confirmatory report. Instead, there have been at least 16 failed attempts to detect XMRV in CFS patients [e.g. (3, 4)]. To arrive at the truth about the association, or lack thereof, between XMRV and CFS, it is important to investigate the reasons for these discrepancies. Materials and Methods In early 2009 we received PBMC DNA samples from CFS patients and healthy controls from the Whittemore Peterson Institute (WPI), Reno, Nevada. The PBMC DNA samples were taken directly to a clean room upon arrival and stored in a -20 o C freezer in the same room. Precautions were taken to minimize the possibility of crosscontamination of the human samples with laboratory sources of XMRV DNA. In particular, neither plasmid XMRV VP62/pcDNA3.1(-) nor XMRV PCR products were ever taken into the clean room. Also, new pipetmans (Gilson) were purchased for exclusive use in the clean room and were never used elsewhere. At the entrance to the clean room there is a sticky pad on the floor and lab personnel must change lab coats upon entering and exiting the clean room. The clean room is locked when not in use. The PCR reaction mixtures that contained PBMC DNA were pipetted in an AirClean 600 PCR Work Station (ISC Bio Express) in the clean room. The PCR Work Station was purchased for use in the clean room and never used elsewhere. The single-round PCR on human DNA samples was performed in a BioRad PCR thermocycler, used exclusively for that purpose, in a separate room from the clean room. The PCR on the plasmid XMRV VP62/pcDNA3.1(-) was performed in yet another room in a different PCR thermocycler from the one used on patient DNA samples. The samples that were re-examined in this report were previously used to produce Figures 1 and S2 and Table S1 of Lombardi et al. (1). The CFS and healthy control PBMC DNA samples were treated identically. To detect DNA sequences of the XMRV genome and of the parent cloning vector, pcdna3.1(-) (Invitrogen), specific PCR primers were designed (Table 1). Single-round PCR and sequencing of the PCR products from PBMC DNA and from plasmid DNA were performed as described previously(1). PCR products were obtained from the XMRV env gene, the neomycin (neo) gene in pcdna3.1(-), and a junction consisting of the CMV promoter in pcdna3.1 linked to 5 - XMRV sequences (Fig. 1). In addition, PCR for the glyceraldehyde-3-phosphate dehydrogenase gene, GAPDH, was performed to confirm the presence of PBMC DNA in all of the samples. Results and Discussion Gel electrophoresis showed that 6 of 15 CFS patient DNA samples (WPI-1104, WPI- 1106, WPI-1115, WPI-1125, WPI-1178, and WPI-1179) amplified a region of XMRV env (Fig. 2A). In contrast, all 17 of the healthy control samples were negative for XMRV env (Fig. 2B). However, all of the CFS samples that were positive for XMRV env DNA were also positive for neo DNA, a part of XMRV VP62 plasmid (Fig. 1), whereas none of the 1

3 control samples were positive for neo DNA. To verify the presence of XMRV VP62 plasmid, a junction region between the CMV promoter in the plasmid and the 5 -region of XMRV was amplified (Fig. 1). PCR on the same 6 CFS DNA samples that were positive for env and neo DNA also amplified the CMV promoter in the plasmid fused to the 5 - region of the XMRV genome (containing R, U5 and part of the glyco-gag coding sequence), while none of the control samples were positive for the plasmid/5 -XMRV junction DNA (Fig. 2). Therefore, 6 of 15 CFS DNA samples were positive for all three PCR products (XMRV env, neo, and plasmid/5 -XMRV junction), while all of the control samples were negative for all three amplicons. The identity of PCR products for XMRV env, neo, and plasmid/xmrv junction were confirmed by DNA sequencing (Table 2). In addition, we amplified and sequence-verified the junction sequence from a seventh CFS DNA sample, WPI-1124 (Table 2). All seven of the XMRV DNA positive CFS samples from Figure 1 of the original study(1), were positive here for the XMRV VP62 plasmid junction. The sequences of the PCR products of the junction and neo obtained from representative DNA samples, WPI-1178 and WPI-1115, respectively, are shown (Figs. 3 & 4). Sequencing of the band near the size of the neo PCR product from sample WPI showed that it was not neo but rather non-specific amplification. There were no examples of XMRV env DNA in the absence of plasmid sequences (Fig. 2). Two of the sequence-confirmed junction sequences (WPI-1104 and WPI-1178) were from same samples used to generate Table S1 (sequences of XMRV genomes) and Figure S2 (the phylogenetic tree) (1). It appears likely, therefore, that these XMRV sequences originated not from the patients but rather from the XMRV VP62 plasmid. We conclude the results in Figures 1 and S2 and Table S1 of Lombardi et al.(1) were spurious due to contamination with XMRV plasmid DNA. References 1. V. C. Lombardi et al., Science 326, 585 (Oct 23, 2009). 2. S. C. Lo et al., Proc Natl Acad Sci U S A 107, (Sep 7, 2010). 3. K. Knox et al., Science, (Jun 2, 2011). 4. C. H. Shin et al., J Virol, (May 4, 2011). 2

4 Table 1. PCR Primers Used In Single-Round PCR. neo 8F 5'-ACA AGA TGG ATT GCA CGC AGG TTC-3' neo 416R 5'-ATG TTT CGC TTG GTG GTC GAA TGG-3' CMV 385F 5 -XMRV 528R env 5922F env 6273R gapdh F gapdh R 5'-TGA TGC GGT TTT GGC AGT ACA TCA ATG-3' 5'-GCG TAA AAC CGA AAG CAA AAA TTC AGA CG-3' 5'-GCT AAT GCT ACC TCC CTC CTG G-3' 5'-GGA GCC CAC TGA GGA ATC AAA ACA GG-3' 5 -GAA GGT GAA GGT CGG AGT C-3 5 -GAA GAT GGT GAT GGG ATT TC-3 Table 2. PCR Products Sequenced. CFS Patient Code Region sequenced Results WPI 1104 CMV Pr/5 -XMRV Sequence Confirmed WPI 1106 CMV Pr/5 -XMRV Sequence Confirmed WPI 1115 CMV Pr/5 -XMRV Sequence Confirmed WPI 1124* CMV Pr/5 -XMRV Sequence Confirmed WPI 1125* CMV Pr/5 -XMRV Sequence Confirmed WPI 1178 CMV Pr/5 -XMRV Sequence Confirmed WPI 1179 CMV Pr/5 -XMRV Sequence Confirmed WPI 1104 neo Sequence Confirmed WPI 1115 neo Sequence Confirmed WPI-1174 neo Non-specific product WPI 1178 neo Sequence Confirmed WPI 1104 env Sequence Confirmed WPI 1106 env Sequence Confirmed WPI 1178 env Sequence Confirmed *DNA from cultured PBMC were used. 3

5 Figure 1. Map of plasmid XMRV VP62/pcDNA3.1 aligned to positions of PCR primers and products. PCR products were: CMV Pr/5 -XMRV (CMV 385F-XMRV 528R, 874 nt); env 5922F-6373R, and neo 8F-416R. Regions of the XMRV genome shown include: R, repeat; U5 and U3 regions of the long terminal repeat, gag-pro-pol gene, and the env gene. Plasmid pcdna3.1(-) regions shown include: CMV Pr, CMV promoter; BGH pa, BGH polyadenylation sequence; f1 ori, f1 origin; SV40 ori, SV40 early promoter and origin; neomycin resistance gene; SV40 pa, SV40 early polyadenylation signal; puc ori, puc origin; and the ampicillin resistance gene. 4

6 Figure 2. XMRV and plasmid sequences in PBMC DNA from CFS patients. Singleround PCR results for XMRV env, neo, plasmid CMV promoter (Pr) joined to 5 -XMRV DNA (CMV Pr/5 -XMRV), and gapdh sequences in PBMCs of (A) CFS patients and (B) healthy controls. The positions of the amplicons are indicated and DNA markers (ladder) are shown. The positive control was plasmid XMRV VP62/pcDNA3.1 (pxmrv). The DNA from sample WPI-1125 only was from cultured PBMC. *Positive/Total: number of PCR products obtained for env, neo, and CMV Pr/5 -XMRV divided by three. 5

7 WPI-1178 CMV 385F 1 TGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTC CMV CAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACT TTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGT GGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTA TCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACGGGCCCT > MCS > 301 CTAGACTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCGCCCTTAGTCATCCGA > XMRV R > 361 TAGACTGAGTCGCCCGGGTACCCGTGTTCCCAATAAAGCCTTTTGCTGTTTGCATCCGAA > U GCGTGGCCTCGCTGTTCCTTGGGAGGGTCTCCTCAGAGTGATTGACTACCCAGCTCGGGG GTCTTTCATTTGGGGGCTCGTCCGGGATTCGGAGACCCCCGCCCAGGGACCACCGACCCA > trna-pro PBS > 541 CCGTCGGGAGGTAAGCCGGCCGGCGATCGTTTTGTCTTTGTCTCTGTCTTTGTGCGTGTG splice donor------> 601 TGTGTGTGCCGGCATCTAATCCTCGCGCCTGCGTCTGAATCTGTACTAGTTAGCTAACTA 661 GATCTGTATCTGGCGGTTCCGCGGAAGAACTGACGAGTTCGTATTCCCGGCCGCAGCCCT glyco-gag start --> 721 GGGAGACGTCCCAGCGGCCTCGGGGGCCCGTTTTGTGGCCCATTCTGTATCAGTTAACCT 781 ACCCGAGTCGGACTTTTTGGAGTGGCTTTGTTGGGGGACGAGAGACAGAGACACTTCCCG 841 CCCCCGTCTGAATTTTTGCTTTCGGTTTTACGC < XMRV 528R Figure 3. Sequence of the CMV Pr/5 -XMRV PCR product from CFS PBMC DNA sample WPI Oligonucleotide primer or primer binding sites are shown in bold and italic. MCS, multiple cloning site; trna-pro PBS, prolyl trna primer binding site. 6

8 WPI-1115 neo 8F 1 ACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGA 61 CTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGG 121 GCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGA 181 GGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGT 241 TGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCT 301 GTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCT 361 GCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACAT neo 416R Figure 4. Sequence of the neo 8F-416R PCR product from CFS PBMC DNA sample WPI Jaydip Das Gupta and Robert H. Silverman Department of Cancer Biology Cleveland Clinic, Cleveland, OH

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed. Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons

More information

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative

More information

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate

More information

Supplementary Document

Supplementary Document Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.

More information

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control

More information

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for

More information

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in

More information

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;

More information

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts

More information

Picture of cell art Picture of cell under a microscope Daniel L. Peterson, MD Whittemore Peterson Institute

Picture of cell art Picture of cell under a microscope Daniel L. Peterson, MD Whittemore Peterson Institute XMRV, A New Human Pathogenic Retrovirus: Detection In Chronic Diseases Picture of cell art Picture of cell under a microscope Daniel L. Peterson, MD Whittemore Peterson Institute Daniel L. Peterson, MD

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

More information

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification. Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,

More information

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n. University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.

More information

BIOLOGY 621 Identification of the Snorks

BIOLOGY 621 Identification of the Snorks Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on

More information

Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because

Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

More information

Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)

Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB

More information

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36. Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG

More information

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili

More information

Nature Immunology: doi: /ni.3836

Nature Immunology: doi: /ni.3836 Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:

More information

Supplementary Figure 1a

Supplementary Figure 1a Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results

More information

Supplementary Materials and Methods

Supplementary Materials and Methods DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and

More information

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described

More information

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,

More information

Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10

Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By

More information

www.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:

More information

Supplementary Figure 1

Supplementary Figure 1 Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated

More information

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high

More information

TetR repressor-based bioreporters for the detection of doxycycline using Escherichia

TetR repressor-based bioreporters for the detection of doxycycline using Escherichia Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental

More information

Baseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3

Baseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3 Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and

More information

Beta Thalassemia Case Study Introduction to Bioinformatics

Beta Thalassemia Case Study Introduction to Bioinformatics Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha

More information

Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies

Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-

More information

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.

More information

Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code

Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza

More information

CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR

CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect

More information

Supporting Information

Supporting Information Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena

More information

Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.

Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright. Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and

More information

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources

More information

Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015

Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015 Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies

More information

A basic helix loop helix transcription factor controls cell growth

A basic helix loop helix transcription factor controls cell growth A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability

More information

Supporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in

Supporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in Supporting Information for Mutational analysis of a phenazine biosynthetic gene cluster in Streptomyces anulatus 9663 Orwah Saleh 1, Katrin Flinspach 1, Lucia Westrich 1, Andreas Kulik 2, Bertolt Gust

More information

Supplementary information

Supplementary information Supplementary information Unique polypharmacology nuclear receptor modulator blocks inflammatory signaling pathways Mi Ra Chang 1, Anthony Ciesla 1, Timothy S. Strutzenberg 1, Scott J. Novick 1, Yuanjun

More information

Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany

Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.

More information

Malignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report. a a*

Malignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report. a a* 2009 63 6 379 384 Malignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report a b a a a* a b 380 63 6 Chest x ray and computed tomography (CT). A, Chest x ray on admission

More information

Nucleotide diversity of the TNF gene region in an African village

Nucleotide diversity of the TNF gene region in an African village (2001) 2, 343 348 2001 Nature Publishing Group All rights reserved 1466-4879/01 $15.00 www.nature.com/gene Nucleotide diversity of the TNF gene region in an African village A Richardson 1, F Sisay-Joof

More information

Mutation analysis of a Chinese family with oculocutaneous albinism

Mutation analysis of a Chinese family with oculocutaneous albinism /, 2016, Vol. 7, (No. 51), pp: 84981-84988 Mutation analysis of a Chinese family with oculocutaneous albinism Xiong Wang 1, Yaowu Zhu 1, Na Shen 1, Jing Peng 1, Chunyu Wang 1, Haiyi Liu 2, Yanjun Lu 1

More information

Isolation and Genetic Characterization of New Reassortant H3N1 Swine Influenza Virus from Pigs in the Midwestern United States

Isolation and Genetic Characterization of New Reassortant H3N1 Swine Influenza Virus from Pigs in the Midwestern United States JOURNAL OF VIROLOGY, May 2006, p. 5092 5096 Vol. 80, No. 10 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.10.5092 5096.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Isolation

More information

SUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM)

SUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM) SUPPLEMENTAL METHODS Cell culture Human peripheral blood mononuclear cells were isolated from healthy donors by Ficoll density gradient centrifugation. Monocyte differentiation to resting macrophages ()

More information

Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients

Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,

More information

Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION

Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis Pooja Arora 1, Aneesh Goyal 2, Vivek T atarajan 1, Eerappa Rajakumara 2, Priyanka Verma 1, Radhika Gupta 3,

More information

Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia

Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The

More information

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS. Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed

More information

Situation of XMRV and Blood Transfusion. Celso Bianco, MD ISBT Working Party on TTID Lisbon, June 19, 2011

Situation of XMRV and Blood Transfusion. Celso Bianco, MD ISBT Working Party on TTID Lisbon, June 19, 2011 Situation of XMRV and Blood Transfusion Celso Bianco, MD ISBT Working Party on TTID Lisbon, June 19, 2011 Lombardi et al. Science 326, 585 (2009) Conclusions: CFS and XMRV XMRV found in 67% of CFS patients

More information

HCV Persistence and Immune Evasion in the Absence of Memory T Cell Help.

HCV Persistence and Immune Evasion in the Absence of Memory T Cell Help. SOM Text HCV Persistence and Immune Evasion in the Absence of Memory T Cell Help. Arash Grakoui 1, Naglaa H. Shoukry 2, David J. Woollard 2, Jin-Hwan Han 1, Holly L. Hanson 1, John Ghrayeb 3, Krishna K.

More information

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models

More information

The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital

The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital Jung-Woo Choi MD, PhD; Younghye Kim MD, PhD; Ju-Han Lee

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Autonomous Multistep Organic Synthesis in a Single Isothermal Solution Mediated by a DNA Walker Yu He and David R. Liu* Supplementary Methods General Methods. DNA oligonucleotides

More information

HIV-1 Selectively Integrates Into Host DNA In Vitro

HIV-1 Selectively Integrates Into Host DNA In Vitro 12 HIV-1 Selectively Integrates Into Host DNA In Vitro Tatsuaki Tsuruyama Department of Molecular Pathology, Graduate School of Medicine, Kyoto University Kyoto, Kyoto Prefecture Japan 1. Introduction

More information

Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction Original article http://dx.doi.org/10.3345/kjp.2012.55.11.424 Korean J Pediatr 2012;55(11):424-429 eissn 1738-1061 pissn 2092-7258 Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION BASELINE ISCHAEMIA a b Phd2 +/- c d Collateral growth and maintenance SMC recruitment SMC proliferation Phd2 +/- NF- B off NF- B on NF- B on NF- B on Endothelial cell Smooth muscle cell Pro-arteriogenic

More information

Isolate Sexual Idiomorph Species

Isolate Sexual Idiomorph Species SUPLEMENTARY TABLE 1. Isolate identification, sexual idiomorph and species of each isolate used for MAT locus distribution in Paracoccidioides species. Isolate Sexual Idiomorph Species Pb01 MAT1-1 P. lutzii

More information

Cancer Genetics 204 (2011) 45e52

Cancer Genetics 204 (2011) 45e52 Cancer Genetics 204 (2011) 45e52 Exon scanning by reverse transcriptaseepolymerase chain reaction for detection of known and novel EML4eALK fusion variants in nonesmall cell lung cancer Heather R. Sanders

More information

mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Supplementary Information

mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Supplementary Information Title: mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Authors: Juan Pablo Lopez 1, Raymond Lim 3, Cristiana Cruceanu 1, Liam Crapper 1,

More information

Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast

Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

Analysis of Human Cytomegalovirus orilyt Sequence Requirements in the Context of the Viral Genome

Analysis of Human Cytomegalovirus orilyt Sequence Requirements in the Context of the Viral Genome JOURNAL OF VIROLOGY, Mar. 2005, p. 3615 3626 Vol. 79, No. 6 0022-538X/05/$08.00 0 doi:10.1128/jvi.79.6.3615 3626.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Analysis of

More information

Supplementary Information

Supplementary Information Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,

More information

Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature

Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature BA vs. preadipocytes. b, Number of GPCRs with 2-fold

More information

Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System

Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System Supplementary Material and Methods Characterization of isolates by the

More information

University of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick

University of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from

More information

RESEARCH COMMUNICATION. Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer

RESEARCH COMMUNICATION. Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer COX2 Rare Polymorphisms and Colorectal Cancer RESEARCH COMMUNICATION Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer Nobuyuki Hamajima

More information

TITLE: Examination of a Newly Discovered Human Retrovirus, XMRV, in Breast Cancer

TITLE: Examination of a Newly Discovered Human Retrovirus, XMRV, in Breast Cancer AWARD NUMBER: W81XWH-10-1-0464 TITLE: Examination of a Newly Discovered Human Retrovirus, XMRV, in Breast Cancer PRINCIPAL INVESTIGATOR: Fayth K. Yoshimura, Ph.D. CONTRACTING ORGANIZATION: Wayne State

More information

Bacterial Gene Finding CMSC 423

Bacterial Gene Finding CMSC 423 Bacterial Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would

More information

PATIENTS AND METHODS. Subjects

PATIENTS AND METHODS. Subjects PATIENTS AND METHODS Subjects Twenty-nine morbidly obese subjects involved in a gastric surgery program were enrolled in the study between October 25 and March 21. Bariatric surgery was performed in patients

More information

Received 29 December 1998/Accepted 9 March 1999

Received 29 December 1998/Accepted 9 March 1999 JOURNAL OF VIROLOGY, June 1999, p. 4794 4805 Vol. 73, No. 6 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Molecular Requirements for Human Immunodeficiency

More information

3) Table_S1: Clinical Characteristics of Breast Cancer Patients. 5) Table_S3: Primer sequences used for qt-pcr of ChIP samples

3) Table_S1: Clinical Characteristics of Breast Cancer Patients. 5) Table_S3: Primer sequences used for qt-pcr of ChIP samples Supplemental Section: 1) Eight supplemental figures and legends 2) Supplemental Materials and Methods 3) Table_S1: Clinical Characteristics of Breast Cancer Patients 4) Table_S2: Oligonucleotide sequences

More information

Influenza viruses are classified as members of the family

Influenza viruses are classified as members of the family Rewiring the RNAs of influenza virus to prevent reassortment Qinshan Gao a and Peter Palese a,b,1 Departments of a Microbiology and b Medicine, Mount Sinai School of Medicine, New York, NY 10029 Contributed

More information

Characterizing intra-host influenza virus populations to predict emergence

Characterizing intra-host influenza virus populations to predict emergence Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems

More information

Integration Solutions

Integration Solutions Integration Solutions (1) a) With no active glycosyltransferase of either type, an ii individual would not be able to add any sugars to the O form of the lipopolysaccharide. Thus, the only lipopolysaccharide

More information

Nomenclature What is in a name? My name Joseˊ Jimenez = Bill Dana John L.C. Savony = Frank Fontaine

Nomenclature What is in a name? My name Joseˊ Jimenez = Bill Dana John L.C. Savony = Frank Fontaine Nomenclature What is in a name? My name Joseˊ Jimenez = Bill Dana John L.C. Savony = Frank Fontaine Three categories of Amyloid Terms 1. Amyloidologists, Amyloid Centers, Researchers official nomenclature

More information

Supporting Online Material for

Supporting Online Material for A Partial Retraction was published on 22 September 2011. See last page. www.sciencemag.org/cgi/content/full/1179052/dc1 Supporting Online Material for Detection of an Infectious Retrovirus, XMRV, in Blood

More information

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott

More information

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were

More information

Received 1 April 2008/Returned for modification 5 June 2008/Accepted 16 July 2008

Received 1 April 2008/Returned for modification 5 June 2008/Accepted 16 July 2008 JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2008, p. 3063 3072 Vol. 46, No. 9 0095-1137/08/$08.00 0 doi:10.1128/jcm.00625-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Detection

More information

Supporting Information

Supporting Information Supporting Information Molecular Recognition Based DNA Nanoassemblies on the Surfaces of Nanosized Exosomes Shuo Wan,, Liqin Zhang,,, Sai Wang, Yuan Liu,, Cuichen Wu, Cheng Cui, Hao Sun, Muling Shi, Ying

More information

What do you think of when you here the word genome?

What do you think of when you here the word genome? What do you think of when you here the word genome? What do you think of when you here the word genome? Personal Genomics Outline Review of pre-lab work Genomics and Medicine Case Overview & Assignment

More information

Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health

Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health Write your name here Surname Other names Edexcel GCE Centre Number Candidate Number Biology Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health Thursday 8 January 2009 Morning Time: 1 hour

More information