*To whom correspondence should be addressed. This PDF file includes:
|
|
- Brian Chase
- 5 years ago
- Views:
Transcription
1 Supporting Online Material for Partial Retraction to Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue Syndrome Vincent C. Lombardi, Francis W. Ruscetti, Jaydip Das Gupta, Max A. Pfost, Kathryn S. Hagen, Daniel L. Peterson, Sandra K. Ruscetti, Rachel K. Bagni, Cari Petrow-Sadowski, Bert Gold, Michael Dean, Robert H. Silverman,* Judy A. Mikovits *To whom correspondence should be addressed. This PDF file includes: Materials and Methods SOM Text Figs. S1 to S4 Tables S1 and S2 References Posted 22 September 2011 DOI: /science
2 Presence of XMRV Plasmid in Samples of Chronic Fatigue Syndrome Patient DNA Background In 2009, Lombardi et al.(1) reported an association between the retrovirus xenotropic murine leukemia virus-related virus (XMRV) and chronic fatigue syndrome (CFS), a debilitating disease of unknown etiology. The evidence included detection of XMRV DNA by PCR, culturing infectious XMRV from plasma and blood cells, electron microscopy of viral particles, and presence of circulating antibody reactive against a murine leukemia virus (MLV) envelope protein. However, with the exception of a single report of different polytropic and modified-polytropic MLV sequences in CFS blood (2), no other research team has published a confirmatory report. Instead, there have been at least 16 failed attempts to detect XMRV in CFS patients [e.g. (3, 4)]. To arrive at the truth about the association, or lack thereof, between XMRV and CFS, it is important to investigate the reasons for these discrepancies. Materials and Methods In early 2009 we received PBMC DNA samples from CFS patients and healthy controls from the Whittemore Peterson Institute (WPI), Reno, Nevada. The PBMC DNA samples were taken directly to a clean room upon arrival and stored in a -20 o C freezer in the same room. Precautions were taken to minimize the possibility of crosscontamination of the human samples with laboratory sources of XMRV DNA. In particular, neither plasmid XMRV VP62/pcDNA3.1(-) nor XMRV PCR products were ever taken into the clean room. Also, new pipetmans (Gilson) were purchased for exclusive use in the clean room and were never used elsewhere. At the entrance to the clean room there is a sticky pad on the floor and lab personnel must change lab coats upon entering and exiting the clean room. The clean room is locked when not in use. The PCR reaction mixtures that contained PBMC DNA were pipetted in an AirClean 600 PCR Work Station (ISC Bio Express) in the clean room. The PCR Work Station was purchased for use in the clean room and never used elsewhere. The single-round PCR on human DNA samples was performed in a BioRad PCR thermocycler, used exclusively for that purpose, in a separate room from the clean room. The PCR on the plasmid XMRV VP62/pcDNA3.1(-) was performed in yet another room in a different PCR thermocycler from the one used on patient DNA samples. The samples that were re-examined in this report were previously used to produce Figures 1 and S2 and Table S1 of Lombardi et al. (1). The CFS and healthy control PBMC DNA samples were treated identically. To detect DNA sequences of the XMRV genome and of the parent cloning vector, pcdna3.1(-) (Invitrogen), specific PCR primers were designed (Table 1). Single-round PCR and sequencing of the PCR products from PBMC DNA and from plasmid DNA were performed as described previously(1). PCR products were obtained from the XMRV env gene, the neomycin (neo) gene in pcdna3.1(-), and a junction consisting of the CMV promoter in pcdna3.1 linked to 5 - XMRV sequences (Fig. 1). In addition, PCR for the glyceraldehyde-3-phosphate dehydrogenase gene, GAPDH, was performed to confirm the presence of PBMC DNA in all of the samples. Results and Discussion Gel electrophoresis showed that 6 of 15 CFS patient DNA samples (WPI-1104, WPI- 1106, WPI-1115, WPI-1125, WPI-1178, and WPI-1179) amplified a region of XMRV env (Fig. 2A). In contrast, all 17 of the healthy control samples were negative for XMRV env (Fig. 2B). However, all of the CFS samples that were positive for XMRV env DNA were also positive for neo DNA, a part of XMRV VP62 plasmid (Fig. 1), whereas none of the 1
3 control samples were positive for neo DNA. To verify the presence of XMRV VP62 plasmid, a junction region between the CMV promoter in the plasmid and the 5 -region of XMRV was amplified (Fig. 1). PCR on the same 6 CFS DNA samples that were positive for env and neo DNA also amplified the CMV promoter in the plasmid fused to the 5 - region of the XMRV genome (containing R, U5 and part of the glyco-gag coding sequence), while none of the control samples were positive for the plasmid/5 -XMRV junction DNA (Fig. 2). Therefore, 6 of 15 CFS DNA samples were positive for all three PCR products (XMRV env, neo, and plasmid/5 -XMRV junction), while all of the control samples were negative for all three amplicons. The identity of PCR products for XMRV env, neo, and plasmid/xmrv junction were confirmed by DNA sequencing (Table 2). In addition, we amplified and sequence-verified the junction sequence from a seventh CFS DNA sample, WPI-1124 (Table 2). All seven of the XMRV DNA positive CFS samples from Figure 1 of the original study(1), were positive here for the XMRV VP62 plasmid junction. The sequences of the PCR products of the junction and neo obtained from representative DNA samples, WPI-1178 and WPI-1115, respectively, are shown (Figs. 3 & 4). Sequencing of the band near the size of the neo PCR product from sample WPI showed that it was not neo but rather non-specific amplification. There were no examples of XMRV env DNA in the absence of plasmid sequences (Fig. 2). Two of the sequence-confirmed junction sequences (WPI-1104 and WPI-1178) were from same samples used to generate Table S1 (sequences of XMRV genomes) and Figure S2 (the phylogenetic tree) (1). It appears likely, therefore, that these XMRV sequences originated not from the patients but rather from the XMRV VP62 plasmid. We conclude the results in Figures 1 and S2 and Table S1 of Lombardi et al.(1) were spurious due to contamination with XMRV plasmid DNA. References 1. V. C. Lombardi et al., Science 326, 585 (Oct 23, 2009). 2. S. C. Lo et al., Proc Natl Acad Sci U S A 107, (Sep 7, 2010). 3. K. Knox et al., Science, (Jun 2, 2011). 4. C. H. Shin et al., J Virol, (May 4, 2011). 2
4 Table 1. PCR Primers Used In Single-Round PCR. neo 8F 5'-ACA AGA TGG ATT GCA CGC AGG TTC-3' neo 416R 5'-ATG TTT CGC TTG GTG GTC GAA TGG-3' CMV 385F 5 -XMRV 528R env 5922F env 6273R gapdh F gapdh R 5'-TGA TGC GGT TTT GGC AGT ACA TCA ATG-3' 5'-GCG TAA AAC CGA AAG CAA AAA TTC AGA CG-3' 5'-GCT AAT GCT ACC TCC CTC CTG G-3' 5'-GGA GCC CAC TGA GGA ATC AAA ACA GG-3' 5 -GAA GGT GAA GGT CGG AGT C-3 5 -GAA GAT GGT GAT GGG ATT TC-3 Table 2. PCR Products Sequenced. CFS Patient Code Region sequenced Results WPI 1104 CMV Pr/5 -XMRV Sequence Confirmed WPI 1106 CMV Pr/5 -XMRV Sequence Confirmed WPI 1115 CMV Pr/5 -XMRV Sequence Confirmed WPI 1124* CMV Pr/5 -XMRV Sequence Confirmed WPI 1125* CMV Pr/5 -XMRV Sequence Confirmed WPI 1178 CMV Pr/5 -XMRV Sequence Confirmed WPI 1179 CMV Pr/5 -XMRV Sequence Confirmed WPI 1104 neo Sequence Confirmed WPI 1115 neo Sequence Confirmed WPI-1174 neo Non-specific product WPI 1178 neo Sequence Confirmed WPI 1104 env Sequence Confirmed WPI 1106 env Sequence Confirmed WPI 1178 env Sequence Confirmed *DNA from cultured PBMC were used. 3
5 Figure 1. Map of plasmid XMRV VP62/pcDNA3.1 aligned to positions of PCR primers and products. PCR products were: CMV Pr/5 -XMRV (CMV 385F-XMRV 528R, 874 nt); env 5922F-6373R, and neo 8F-416R. Regions of the XMRV genome shown include: R, repeat; U5 and U3 regions of the long terminal repeat, gag-pro-pol gene, and the env gene. Plasmid pcdna3.1(-) regions shown include: CMV Pr, CMV promoter; BGH pa, BGH polyadenylation sequence; f1 ori, f1 origin; SV40 ori, SV40 early promoter and origin; neomycin resistance gene; SV40 pa, SV40 early polyadenylation signal; puc ori, puc origin; and the ampicillin resistance gene. 4
6 Figure 2. XMRV and plasmid sequences in PBMC DNA from CFS patients. Singleround PCR results for XMRV env, neo, plasmid CMV promoter (Pr) joined to 5 -XMRV DNA (CMV Pr/5 -XMRV), and gapdh sequences in PBMCs of (A) CFS patients and (B) healthy controls. The positions of the amplicons are indicated and DNA markers (ladder) are shown. The positive control was plasmid XMRV VP62/pcDNA3.1 (pxmrv). The DNA from sample WPI-1125 only was from cultured PBMC. *Positive/Total: number of PCR products obtained for env, neo, and CMV Pr/5 -XMRV divided by three. 5
7 WPI-1178 CMV 385F 1 TGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTC CMV CAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACT TTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGT GGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTA TCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACGGGCCCT > MCS > 301 CTAGACTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCGCCCTTAGTCATCCGA > XMRV R > 361 TAGACTGAGTCGCCCGGGTACCCGTGTTCCCAATAAAGCCTTTTGCTGTTTGCATCCGAA > U GCGTGGCCTCGCTGTTCCTTGGGAGGGTCTCCTCAGAGTGATTGACTACCCAGCTCGGGG GTCTTTCATTTGGGGGCTCGTCCGGGATTCGGAGACCCCCGCCCAGGGACCACCGACCCA > trna-pro PBS > 541 CCGTCGGGAGGTAAGCCGGCCGGCGATCGTTTTGTCTTTGTCTCTGTCTTTGTGCGTGTG splice donor------> 601 TGTGTGTGCCGGCATCTAATCCTCGCGCCTGCGTCTGAATCTGTACTAGTTAGCTAACTA 661 GATCTGTATCTGGCGGTTCCGCGGAAGAACTGACGAGTTCGTATTCCCGGCCGCAGCCCT glyco-gag start --> 721 GGGAGACGTCCCAGCGGCCTCGGGGGCCCGTTTTGTGGCCCATTCTGTATCAGTTAACCT 781 ACCCGAGTCGGACTTTTTGGAGTGGCTTTGTTGGGGGACGAGAGACAGAGACACTTCCCG 841 CCCCCGTCTGAATTTTTGCTTTCGGTTTTACGC < XMRV 528R Figure 3. Sequence of the CMV Pr/5 -XMRV PCR product from CFS PBMC DNA sample WPI Oligonucleotide primer or primer binding sites are shown in bold and italic. MCS, multiple cloning site; trna-pro PBS, prolyl trna primer binding site. 6
8 WPI-1115 neo 8F 1 ACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGA 61 CTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGG 121 GCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGA 181 GGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGT 241 TGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCT 301 GTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCT 361 GCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACAT neo 416R Figure 4. Sequence of the neo 8F-416R PCR product from CFS PBMC DNA sample WPI Jaydip Das Gupta and Robert H. Silverman Department of Cancer Biology Cleveland Clinic, Cleveland, OH
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationSupplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationSupplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
More informationTable S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationSupplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
More informationToluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
More informationFigure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationSupplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
More informationPicture of cell art Picture of cell under a microscope Daniel L. Peterson, MD Whittemore Peterson Institute
XMRV, A New Human Pathogenic Retrovirus: Detection In Chronic Diseases Picture of cell art Picture of cell under a microscope Daniel L. Peterson, MD Whittemore Peterson Institute Daniel L. Peterson, MD
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationa) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationSupplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease
Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,
More informationCitation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
More informationBIOLOGY 621 Identification of the Snorks
Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on
More informationPhylogenetic analysis of human and chicken importins. Only five of six importins were studied because
Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein
More informationCD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
More informationSupplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
More informationCulture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)
A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationAstaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
More informationNature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
More informationSupplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
More informationSupplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and
More informationSupplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
More informationCross-talk between mineralocorticoid and angiotensin II signaling for cardiac
ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,
More informationNucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10
J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By
More informationwww.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:
More informationSupplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
More informationJournal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
More informationTetR repressor-based bioreporters for the detection of doxycycline using Escherichia
Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental
More informationBaseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3
Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and
More informationBeta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
More informationExpression of Selected Inflammatory Cytokine Genes in Bladder Biopsies
Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-
More informationA smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationBHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL
1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.
More informationLezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza
More informationCIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR
CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect
More informationSupporting Information
Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
More informationResistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.
Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and
More informationSupplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota
Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources
More informationBeta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015
Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies
More informationA basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
More informationSupporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in
Supporting Information for Mutational analysis of a phenazine biosynthetic gene cluster in Streptomyces anulatus 9663 Orwah Saleh 1, Katrin Flinspach 1, Lucia Westrich 1, Andreas Kulik 2, Bertolt Gust
More informationSupplementary information
Supplementary information Unique polypharmacology nuclear receptor modulator blocks inflammatory signaling pathways Mi Ra Chang 1, Anthony Ciesla 1, Timothy S. Strutzenberg 1, Scott J. Novick 1, Yuanjun
More informationDetection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany
HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.
More informationMalignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report. a a*
2009 63 6 379 384 Malignant Amelanotic Melanoma of the Pleura without Primary Skin Lesion: An Autopsy Case Report a b a a a* a b 380 63 6 Chest x ray and computed tomography (CT). A, Chest x ray on admission
More informationNucleotide diversity of the TNF gene region in an African village
(2001) 2, 343 348 2001 Nature Publishing Group All rights reserved 1466-4879/01 $15.00 www.nature.com/gene Nucleotide diversity of the TNF gene region in an African village A Richardson 1, F Sisay-Joof
More informationMutation analysis of a Chinese family with oculocutaneous albinism
/, 2016, Vol. 7, (No. 51), pp: 84981-84988 Mutation analysis of a Chinese family with oculocutaneous albinism Xiong Wang 1, Yaowu Zhu 1, Na Shen 1, Jing Peng 1, Chunyu Wang 1, Haiyi Liu 2, Yanjun Lu 1
More informationIsolation and Genetic Characterization of New Reassortant H3N1 Swine Influenza Virus from Pigs in the Midwestern United States
JOURNAL OF VIROLOGY, May 2006, p. 5092 5096 Vol. 80, No. 10 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.10.5092 5096.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Isolation
More informationSUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM)
SUPPLEMENTAL METHODS Cell culture Human peripheral blood mononuclear cells were isolated from healthy donors by Ficoll density gradient centrifugation. Monocyte differentiation to resting macrophages ()
More informationMutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,
More informationMechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION
Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis Pooja Arora 1, Aneesh Goyal 2, Vivek T atarajan 1, Eerappa Rajakumara 2, Priyanka Verma 1, Radhika Gupta 3,
More informationRelationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
More informationice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.
Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed
More informationSituation of XMRV and Blood Transfusion. Celso Bianco, MD ISBT Working Party on TTID Lisbon, June 19, 2011
Situation of XMRV and Blood Transfusion Celso Bianco, MD ISBT Working Party on TTID Lisbon, June 19, 2011 Lombardi et al. Science 326, 585 (2009) Conclusions: CFS and XMRV XMRV found in 67% of CFS patients
More informationHCV Persistence and Immune Evasion in the Absence of Memory T Cell Help.
SOM Text HCV Persistence and Immune Evasion in the Absence of Memory T Cell Help. Arash Grakoui 1, Naglaa H. Shoukry 2, David J. Woollard 2, Jin-Hwan Han 1, Holly L. Hanson 1, John Ghrayeb 3, Krishna K.
More informationLoyer, et al. microrna-21 contributes to NASH Suppl 1/15
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models
More informationThe Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital
The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital Jung-Woo Choi MD, PhD; Younghye Kim MD, PhD; Ju-Han Lee
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Autonomous Multistep Organic Synthesis in a Single Isothermal Solution Mediated by a DNA Walker Yu He and David R. Liu* Supplementary Methods General Methods. DNA oligonucleotides
More informationHIV-1 Selectively Integrates Into Host DNA In Vitro
12 HIV-1 Selectively Integrates Into Host DNA In Vitro Tatsuaki Tsuruyama Department of Molecular Pathology, Graduate School of Medicine, Kyoto University Kyoto, Kyoto Prefecture Japan 1. Introduction
More informationEnhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction
Original article http://dx.doi.org/10.3345/kjp.2012.55.11.424 Korean J Pediatr 2012;55(11):424-429 eissn 1738-1061 pissn 2092-7258 Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex
More informationSUPPLEMENTARY INFORMATION
BASELINE ISCHAEMIA a b Phd2 +/- c d Collateral growth and maintenance SMC recruitment SMC proliferation Phd2 +/- NF- B off NF- B on NF- B on NF- B on Endothelial cell Smooth muscle cell Pro-arteriogenic
More informationIsolate Sexual Idiomorph Species
SUPLEMENTARY TABLE 1. Isolate identification, sexual idiomorph and species of each isolate used for MAT locus distribution in Paracoccidioides species. Isolate Sexual Idiomorph Species Pb01 MAT1-1 P. lutzii
More informationCancer Genetics 204 (2011) 45e52
Cancer Genetics 204 (2011) 45e52 Exon scanning by reverse transcriptaseepolymerase chain reaction for detection of known and novel EML4eALK fusion variants in nonesmall cell lung cancer Heather R. Sanders
More informationmir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Supplementary Information
Title: mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Authors: Juan Pablo Lopez 1, Raymond Lim 3, Cristiana Cruceanu 1, Liam Crapper 1,
More informationSingle-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast
Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationAnalysis of Human Cytomegalovirus orilyt Sequence Requirements in the Context of the Viral Genome
JOURNAL OF VIROLOGY, Mar. 2005, p. 3615 3626 Vol. 79, No. 6 0022-538X/05/$08.00 0 doi:10.1128/jvi.79.6.3615 3626.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Analysis of
More informationSupplementary Information
Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,
More informationSupplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature
Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature BA vs. preadipocytes. b, Number of GPCRs with 2-fold
More informationSupplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System
Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System Supplementary Material and Methods Characterization of isolates by the
More informationUniversity of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick
University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationRESEARCH COMMUNICATION. Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer
COX2 Rare Polymorphisms and Colorectal Cancer RESEARCH COMMUNICATION Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer Nobuyuki Hamajima
More informationTITLE: Examination of a Newly Discovered Human Retrovirus, XMRV, in Breast Cancer
AWARD NUMBER: W81XWH-10-1-0464 TITLE: Examination of a Newly Discovered Human Retrovirus, XMRV, in Breast Cancer PRINCIPAL INVESTIGATOR: Fayth K. Yoshimura, Ph.D. CONTRACTING ORGANIZATION: Wayne State
More informationBacterial Gene Finding CMSC 423
Bacterial Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would
More informationPATIENTS AND METHODS. Subjects
PATIENTS AND METHODS Subjects Twenty-nine morbidly obese subjects involved in a gastric surgery program were enrolled in the study between October 25 and March 21. Bariatric surgery was performed in patients
More informationReceived 29 December 1998/Accepted 9 March 1999
JOURNAL OF VIROLOGY, June 1999, p. 4794 4805 Vol. 73, No. 6 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Molecular Requirements for Human Immunodeficiency
More information3) Table_S1: Clinical Characteristics of Breast Cancer Patients. 5) Table_S3: Primer sequences used for qt-pcr of ChIP samples
Supplemental Section: 1) Eight supplemental figures and legends 2) Supplemental Materials and Methods 3) Table_S1: Clinical Characteristics of Breast Cancer Patients 4) Table_S2: Oligonucleotide sequences
More informationInfluenza viruses are classified as members of the family
Rewiring the RNAs of influenza virus to prevent reassortment Qinshan Gao a and Peter Palese a,b,1 Departments of a Microbiology and b Medicine, Mount Sinai School of Medicine, New York, NY 10029 Contributed
More informationCharacterizing intra-host influenza virus populations to predict emergence
Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems
More informationIntegration Solutions
Integration Solutions (1) a) With no active glycosyltransferase of either type, an ii individual would not be able to add any sugars to the O form of the lipopolysaccharide. Thus, the only lipopolysaccharide
More informationNomenclature What is in a name? My name Joseˊ Jimenez = Bill Dana John L.C. Savony = Frank Fontaine
Nomenclature What is in a name? My name Joseˊ Jimenez = Bill Dana John L.C. Savony = Frank Fontaine Three categories of Amyloid Terms 1. Amyloidologists, Amyloid Centers, Researchers official nomenclature
More informationSupporting Online Material for
A Partial Retraction was published on 22 September 2011. See last page. www.sciencemag.org/cgi/content/full/1179052/dc1 Supporting Online Material for Detection of an Infectious Retrovirus, XMRV, in Blood
More informationFormylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis
Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott
More informationDescription of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
More informationReceived 1 April 2008/Returned for modification 5 June 2008/Accepted 16 July 2008
JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2008, p. 3063 3072 Vol. 46, No. 9 0095-1137/08/$08.00 0 doi:10.1128/jcm.00625-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Detection
More informationSupporting Information
Supporting Information Molecular Recognition Based DNA Nanoassemblies on the Surfaces of Nanosized Exosomes Shuo Wan,, Liqin Zhang,,, Sai Wang, Yuan Liu,, Cuichen Wu, Cheng Cui, Hao Sun, Muling Shi, Ying
More informationWhat do you think of when you here the word genome?
What do you think of when you here the word genome? What do you think of when you here the word genome? Personal Genomics Outline Review of pre-lab work Genomics and Medicine Case Overview & Assignment
More informationAdvanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health
Write your name here Surname Other names Edexcel GCE Centre Number Candidate Number Biology Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health Thursday 8 January 2009 Morning Time: 1 hour
More information