Documentation Dissection
|
|
- Melvin Bishop
- 5 years ago
- Views:
Transcription
1 History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3 weeks, has had pain in middle of R side back radiates around rib cage 3, has also had stomach gurgling, with massive pain 4. Will eat and then have massive stomach cramping and diarrhea an hour later 5. Denies pain radiating to groin or into shoulder, but has had some dysuria and darker colored urine. Duration lasting 3 week(s). The course is episodic. The quality is 8 on a scale of The exacerbating factor is eating. Associated Symptoms: Constitutional Symptoms: No fever or no chills. ENT: No Sore throat. Cardiovascular Symptoms: No chest pain. Orthostatic Symptoms: No lightheadedness. Respiratory Symptoms: No shortness of breath. Oral Intake: No decreased appetite. Nausea: Yes 6. Vomiting Episodes: Few 6. Bowel Movements: Loose 6. Genitourinary Symptoms: Dysuria. Review of Systems 7 : Musculoskeletal Symptoms: Joint pain. Bilateral knees and L ankle 7. Other Significant Review of Systems: All other systems reviewed and otherwise negative 7. Past Medical/Family/Social History 8 : Medical History: Additional significant medical history: Depression, Rheumatoid arthritis, HTN. Surgical History: denies. Family History: CAD. Social History: Alcohol: Denies alcohol use, Tobacco: Denies tobacco use, Drugs: Denies drug use, Family/social situation: Works in construction in Grantsville, drinks alcohol 36 beers in a week, denies smoking, no drugs. Physical Examination 9 : General Appearance: No acute distress 9. Skin: Warm. No pallor 9. Eye: Pupils equal, round, and reactive to light. Extraocular movements intact. No Icterus 9. Ears, nose, mouth and throat: Oral mucosa moist 9. Neck: Supple 9. Heart: Regular rate and rhythm, no extra heart sounds, no murmurs 9. Respiratory: Lungs clear to auscultation bilaterally. Respirations nonlabored 9. 1
2 Abdominal: Soft. Nontender. Non distended. Normal bowel sounds. No organomegaly. negative Murphys Back: Nontender 9. Neurological: Alert and oriented times 3 9. Medical Decision Making 11 : Differential Diagnosis: Cholecystitis Nephrolithiasis Pancreatitis Hepatitis Clinical work-up/interpretation: Electrocardiogram 12 : Time 04/06/10 15:02. No ST-T changes. Normal PR & QRS intervals. Results: Results. 4/6/ :20 WBC k/ul High 13 Red Blood Cell Count 3.50 M/uL Low 13 Hemoglobin g/dl 12.0 gm/dl Low 13 Hematocrit 34.4 % Low 13 Mean Corpuscular Volume (MCV) 98.2 fl High 13 Mean Corpuscular Hemoglobin (MCH) 34.2 pg High 13 Mean Corpuscular Hgb Conc (MCHC) 34.8 gm/dl Normal 13 Red Cell Distribution Width 12.6 % Normal 13 Platelets 600 k/ul High 13 Mean Platelet Volume (MPV) 8.4 fl Normal 13 Granulocytes % 77.8 % High 13 Lymphocyte % 12.0 % Low 13 Monocyte % 6.8 % Normal 13 Basophil % 0.2 % Normal 13 Eosinophil % 3.3 % Normal 13 Granulocyte # 9.6 k/ul High 13 Lymphocyte # 1.5 k/ul Normal 13 Monocyte # 0.8 k/ul High 13 Basophil # 0.0 k/ul Normal 13 Eosinophil # 0.4 k/ul Normal 13 Sodium 139 mmol/l Normal 13 2
3 Potassium 4.9 mmol/l Normal 13 Chloride 103 mmol/l Normal 13 CO 2 27 mmol/l Normal 13 Anion Gap 9 mmol/l Normal 13 Urea Nitrogen 27 mg/dl High 13 Creatinine, Serum or Plasma 1.10 mg/dl Normal 13 Glucose Level 89 mg/dl Normal 13 Alkaline Phosphatase 153 U/L High 13 AST 29 U/L Normal 13 ALT 47 U/L Normal 13 Calcium, Serum or Plasma 9.2 mg/dl Normal 13 Total Protein 7.6 gm/dl Normal 13 Albumin 3.5 gm/dl Normal 13 Bilirubin, Total 0.3 mg/dl Normal 13 Amylase 60 U/L Normal 13 Lipase 129 U/L Normal 13 Ultrasound 14 : Abdominal, The liver is normal in size. There is no evidence of intrahepatic biliary dilatation. No hepatic masses are seen. The gallbladder is normal with no evidence of gallstones. Normal gallbladder wall thickness. There is no evidence of pericholecystic fluid. No sonographic Murphy s sign]. The proximal part of the pancreas is normal. The distal pancreas could not be adequately evaluated because of bowel gas. Normal appearance of the spleen with no evidence of splenomegaly or focal splenic masses. The kidneys are normal in size. There is no evidence of hydronephrosis. No renal masses or renal stones are seen. There is no evidence of ascites. The proximal aorta and IVC are normal in caliber. Time reported 04/06/10 13:17. Impression and Plan 15 : Diagnosis 15 : Abdominal pain R Diagnosis 15 : Irritable Bowel Syndrome 15. Discharge Plan 15 : Condition: Improved 15. Dispositioned: Time 04/06/10 15:03, To home 15. 3
4 Patient was given the following educational materials: IRRITABLE BOWEL SYNDROME 15. Counseled: Patient, Family, Regarding diagnosis, Regarding treatment plan 15. Addendum: Notes: 50 yo with hx of intermittent abd cramping with exacerbation by po intake symptoms have been more recent in last 3 weeks. Cramping resolved after admission to ED and PE here now abd soft + bs nontender w/o mass hsmegaly. Labs wnl except for alk phos. US normal patient to f/u with GI. 1 Duration. 2 Severity. 3 Location. 4 Associated sign and symptoms. 5 Context. 6 Associated symptoms supports History of Present Illness with confirmation of nausea, few vomiting episodes, and loose bowels. 7 Complete Review of Systems. 8 All Past Medical/Family/Social History components have been completed. 9 Comprehensive exam 95 guidelines. 10 Physical Examination indicates abdomen is soft, nontender, non distended, confirms normal bowel sounds, and documents no organomegaly. 11 Medical Decision Making includes multiple differential diagnoses. New problem with additional work-up. 12 Electrocardiogram is performed 1 data point. 13 Lab 1 data point. 14 Ultrasound is performed 1 data point. 15 Impression and Plan document confirmed diagnoses of Irritable Bowel Syndrome and Abdominal Pain. What CPT and ICD-10-CM codes are reported? CPT Codes: 99285, ICD-10-CM Code: K58.0 Rationales: CPT : The note documents patient admission to the Emergency Department (ED) for evaluation of severe abdominal pain. The note documents a comprehensive Past Medical, Family, and Social history and outlines significant past medical history conditions and social history habits. A comprehensive physical examination (95 Guidelines) was performed documenting at least eight organ systems. The medical decision making included multiple differential diagnoses and included orders for an electrocardiogram, lab and ultrasound to rule out certain conditions. (3 data points) The nature of the presenting problem is high, a chronic illness with severe exacerbation. This supports high complexity of medical decision making. 4
5 To locate the appropriate code selection, in the Alphabetic Index look up Evaluation and Management/Emergency Department code range directs you to Reviewing the key components in the code descriptions, CPT Emergency department visit for the evaluation and management of a patient which requires a comprehensive history, a comprehensive examination; and medical decision making of high complexity is the appropriate cod selection. Included in this service is counseling and/or coordination or care with other physicians, other qualified health care professionals, or agencies are provided consistent with the nature of the problem(s) and the patient s and/or family s needs. Typically, the presenting problem(s) are of high severity, and require urgent evaluation by the physician but do not pose an immediate significant threat to life or physiologic function. It is important to note that time is not a descriptive component for the emergency department levels of E/M services because emergency department services are typically provided on a variable intensity basis, often involving multiple encounters with several patients over an extended period of time. Verify code selection in the Tabular List. An electrocardiogram was also performed in the ED to rule out any cardiovascular disease due to the rib pain. To locate the appropriate code selection in the CPT Alphabetic Index look up Electrocardiography/Evaluation it directs you to code range 0178T 0180T, 93000, 93010, and The electrocardiogram procedure was not detailed and only included interpretation and report. The appropriate code selection is CPT Verify code selection in the Tabular List. ICD-10-CM: The final diagnoses document irritable bowel syndrome and abdominal pain. In the ICD-10-CM Alphabetic Index look for Irritable/bowel (syndrome). ICD-10 provides two additional code selections for IBS including with diarrhea and psychogenic. Diarrhea is mentioned in the history and review of systems. K58.0, Irritable bowel syndrome with diarrhea is the most appropriate code to report. Abdominal pain is a symptom of irritable bowel and would not be separately reported. Verify code in the Tabular List. 5
* Final Report * ED Triage Entered On: 01/16/2014 8:45 EST Performed On: 01/16/2014 8:42 EST by
Result date: Result status: 16 January 2014 8:42 EST Auth (Verified) * Final Report * ED Triage Entered On: 01/16/2014 8:45 EST Performed On: 01/16/2014 8:42 EST by Assessment I Chief Complaint : Diarrhea
More informationSMALL GROUP DISCUSSION
MHD II, Session 1 Student Copy Page 1 SMALL GROUP DISCUSSION MHD II Session 1 Gastroinestinal Monday, January 9, 2017 STUDENT COPY MHD II, Session 1 Student Copy Page 2 CASE 1 CHIEF CONCERN: "I'm passing
More informationCASE-BASED SMALL GROUP DISCUSSION MHD II
MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby
More informationMHD I SESSION X. Renal Disease
MHD I, Session X, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION X Renal Disease Monday, November 11, 2013 MHD I, Session X, Student Copy Page 2 Case #1 Cc: I have had weeks of diarrhea
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationSMALL GROUP DISCUSSION
MHD II, Seesion II Student Copy - Page 1 SMALL GROUP DISCUSSION MHD II Session II JANUARY 15, 2014 Recent Review highlighting disease process in Case 2: Fasano A, Catassi, C. NEJM 2012; 367: 2419-26 STUDENT
More informationLOKUN! I got stomach ache!
LOKUN! I got stomach ache! Mr L is a 67year old Chinese gentleman who is a non smoker, social drinker. He has a medical history significant for Hypertension, Hyperlipidemia, Type 2 Diabetes Mellitus, Chronic
More informationDischarge Summary-Page 1
Discharge Summary-Page 1 Admission diagnosis: 1. Gastritis. 2. Alcoholic cirrhosis, ascites, grade 1 esophageal varices. 3. Recent left knee arthroplasty. 4. Osteoporosis naqmq : 1. Three chest X-rays
More informationCARDIOVASCULAR CASE-BASED SMALL GROUP DISCUSSION
MHD I Session VIII Student Copy Page 1 CARDIOVASCULAR CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION VIII OCTOBER 22, 2014 STUDENT COPY MHD I Session VIII Student Copy Page 2 Case 1 Chief Complaint I
More informationCASE-BASED SMALL GROUP DISCUSSION SESSION 6 MHD I. October 14, 2015
Session 6, MHD I, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 6 MHD I October 14, 2015 Helpful Resources McPhee, SJ, Hammer GD. Pathophysiology of Disease: An Introduction to Clinical
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD I Friday, November 15, 2013 STUDENT COPY MHD I, Session XII, Student Copy Page 2 Case 1 CHIEF COMPLAINT: I am very
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I November 12, 2015 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am very tired and
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XIII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION XIII MHD I November 13, 2014 STUDENT COPY MHD I, Session XIII, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am very tired
More informationCase Scenario 1. Discharge Summary
Case Scenario 1 Discharge Summary A 69-year-old woman was on vacation and noted that she was becoming jaundiced. Two months prior to leaving on that trip, she had had a workup that included an abdominal
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I Autoimmunity November 10, 2016 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am
More informationSMALL GROUP DISCUSSION
MHD II, Session 2 Student Copy - Page 1 SMALL GROUP DISCUSSION MHD II Session 2 Gastroinestinal JANUARY 12, 2017 STUDENT COPY CASE 1 MHD II, Session 2 Student Copy - Page 2 CHIEF COMPLAINT: "My bowels
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationCounty General Hospital 546 That Street. Some Town, YY DISCHARGE SUMMARY
County General Hospital 546 That Street. Some Town, YY 12347 111-222-9998 DISCHARGE SUMMARY PATIENT: Collette Rose UNIT#: 345678 ADMISSION DATE: June 5, 1995 ACCT#: 98734513 DISCHARGE DATE: June 13, 1995
More informationMECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS
MHD I, Session 16, STUDENT Copy, Page 1 MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS CASE-BASED SMALL GROUP DISCUSSION SESSION 16 Pulmonary MHD I December 5, 2016 STUDENT COPY MHD I, Session
More informationMHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY
MHD I, Session VIII, Student Copy Page 1 MHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY MHD I, Session VIII, Student Copy Page 2 Case #1 Chief Complaint: I have been feeling just lousy
More informationCase TWO. Vital Signs: Temperature 36.6degC BP 137/89 HR 110 SpO2 97% on Room Air
Mr N is a 64year old Chinese gentleman who is a heavy drinker, still actively drinking, and chronic smoker of >40pack year history. He has a past medical history significant for Hypertension, Hyperlipidemia,
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION 11 Renal Block Acid- Base Disorders November 7, 2016 MHD I, Session 11, Student Copy Page 2 Case #1 Cc: I have had
More informationOccupation Agency Code Work Location Work Supervisor Duty tel. #
PRIVACY ACT STATEMENT: This information is subject to the Privacy Act of 1974 (5 U.S.C. Section 552a). This information may be provided to appropriate Government agencies when relevant to civil, criminal
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationOccupation Agency Code Work Location Work Supervisor Duty tel. #
PRIVACY ACT STATEMENT: This information is subject to the Privacy Act of 1974 (5 U.S.C. Section 552a). This information may be provided to appropriate Government agencies when relevant to civil, criminal
More informationThe Primary Functional Diagnosis of the G.I. & Biliary System
Functional Physiology, Dysfunctions, and Assessments of the G.I. and Gallbladder a 3-part Webinar Series The Functional Diagnosis Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software
More informationPatient Encounters in the Primary Care Setting
Patient Encounters in the Primary Care Setting Carmine D Amico, D.O. Clinical Cases Overview Learning objectives Clinical case presentations Questions for audience participation 1 Clinical Cases Learning
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD II, Session XII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD II April 21, 2014 STUDENT COPY Helpful Resource: ACP Medicine online available through LUHS Library Infectious
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationSMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationBackground. RUQ Ultrasound Normal, Recommend Clinical Correlation. Sohail R. Shah, MD, MSHA, FACS, FAAP Texas Children s Hosptial
RUQ Ultrasound Normal, Recommend Clinical Correlation Sohail R. Shah, MD, MSHA, FACS, FAAP Texas Children s Hosptial Background Incidence of pediatric gallbladder disease continues to rise U.S. Pediatric
More informationAbdominal Pain. Luke Donnelly, MD Emergency Medicine
Abdominal Pain Luke Donnelly, MD Emergency Medicine Objectives Approach to abdominal pain Evaluation Critical diagnoses and treatments Abdominal Pain Most Common ER Complaint Broad Differential Can often
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationSMALL GROUP DISCUSSION SESSION
MHD I Session 1 Student Copy Page 1 SMALL GROUP DISCUSSION SESSION 1 MHD I Friday, September 4, 2015 STUDENT COPY MHD I Session 1 Student Copy Page 2 Helpful Resources for Session Murray s Medical Microbiology,
More informationMedical Case History and Examination (2) 31 years old Gender. Male Nationality. Bengali Religion. Muslim Marital Status
Medical Case History and Examination (2) - Demographic Data: Patient s name Suman **** CPR 86025**** Age 31 years old Gender Male Nationality Bengali Religion Muslim Marital Status Unmarried Date of Admission
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationSMALL GROUP DISCUSSION SESSION I
MHD I Session I Student Copy Page 1 SMALL GROUP DISCUSSION SESSION I MHD I Monday, September 9, 2013 STUDENT COPY MHD I Session I Student Copy Page 2 Helpful Resources for Session Murray s Medical Microbiology,
More informationBend Surgical Associates. Michael J. Mastrangelo, MD, FACS. Medication Name Dosage Frequency Medication Name Dosage Frequency
Bend Surgical Associates Michael J. Mastrangelo, MD, FACS PATIENT NAME: DATE F BIRTH: MEDICATINS Please list all of your current prescription, non-prescription medications, vitamins, minerals, and supplements.
More informationA walk through a STEMI
A walk through a STEMI M.M. s Story Kim Robison Ashley Corcoran Situation M.M. is an 82 year old male brought in by private vehicle on 10/22/17 to the Emergency Department Pt. c/o left arm numbness, pain
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationPain can produce unstable hemodynamics
Pain can produce unstable hemodynamics 30-year-old male came to emergency department for severe epigastric pain for 6 hours as well as nausea and vomiting. 1)BP: 130/70mmHg 2)HR:
More informationOccupation Agency Code Work Location Work Supervisor Duty tel. #
PRIVACY ACT STATEMENT: This information is subject to the Privacy Act of 1974 (5 U.S.C. Section 552a). This information may be provided to appropriate Government agencies when relevant to civil, criminal
More informationGASTROENTEROLOGY ESSENTIALS
GASTROENTEROLOGY ESSENTIALS Practical Gastroenterology 8/25/2018 Jahnavi Koppala, MBBS Abdullah Abdussalam, MD A 48-year-old male was evaluated for noncardiac chest pain. Treatment with PPI twice daily
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationno concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
More informationCapital Health Medical Center - Hopewell NEUROSURGICAL-ONCOLOGY Patient History
Capital Health Medical Center - Hopewell NEUROSURGICAL-ONCOLOGY Patient History Please take a few minutes and complete the following questions before you see the doctors so that we may learn a bit more
More informationHYPERCALCEMIC GOLDEN RETRIEVER
Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier
More informationGlossary of terms used in College examinations. The Royal College of Emergency Medicine
Glossary of terms used in College examinations The Royal College of Emergency Medicine The CEM uses several terms in examinations that may cause confusion. The following definitions are intended as a guide
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationCase 72 y/o male Past hx : 1. Ampulla of Vater cancer s/p whipple operation 2. Liver abscess with K.P. 3. GI bleeding 4. DM No drug allergy
Presenter : R2 周光緯 Supervisor :VS 連楚明 Case 72 y/o male Past hx : 1. Ampulla of Vater cancer s/p whipple operation 2. Liver abscess with K.P. 3. GI bleeding 4. DM No drug allergy 2012.08.15 2/45 ER visit
More informationGastrointestinal Markers
Gastrointestinal Markers Session 2 Gastrointestinal System Reference Ranges Optimal Range Ttl Total Protein ti 69 6.9 74 7.4 Globulin 2.4 2.8 BUN 10 16 Creatinine 0.8 1.1 Phosphorous 3.0 4.0 Eosinophils
More information& CBC Analysis. Getting the Most from the. Session 3. Foundations of Functional Blood Chemistry Analysis Session 3 Dr.
Functional Blood Chemistry & CBC Analysis Session 3 Li L:iver and Gallbladder Markers SGOT/AST, SGPT/ALT & GGTP Getting the Most from the Liver Panel http://www.fmtown.com 1 Liver Panel Reference Ranges
More informationACEM Fellowship Examination Emergency Medicine Practice Questions VAQ (Part C)
ACEM Fellowship Examination Emergency Medicine 2013-14 Practice Questions VAQ (Part C) Question 1 A 67- year- old lady presents to the Emergency Department (ED) with a history of increasing Shortness of
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationName: Bashair Hashim Ali Age:46 years Residence: Mosul/ Al-Samah Q. Occupation: non-employee. Date of admission: Date of exam:
Name: Bashair Hashim Ali Age:46 years Residence: Mosul/ Al-Samah Q. Occupation: non-employee. Date of admission: 17-8-2013 Date of exam: 17-8-2013 Chief complaint: passing of black coloured stool for few
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationJOHN MICHAEL ROACH, MD
GASTROENTEROLOGY JOHN MICHAEL ROACH, MD 520 N. 4 TH AVE. PASCO, WA 99301 Phone: (509) 546-8383 Name: Date of Birth: First Middle (full) Last m/d/yr Primary care provider: Referring physician: Local Pharmacy:
More informationPatient Interview Form
Page 1 of 6 Patient Interview Form Patient Information First Name: MRN: Age: Last Name: Date Of Birth: Notes: Email Please check one as your preferred email for communications Personal: Work: Race Select
More informationCase Discussion Splenic Abscess
Case Discussion Splenic Abscess Personal Data Gender: male Birth Date: 1928/Mar/06th Allergy: Mefenamic Smoking: 0.5 PPD for 55 years Alcohol: negative (?) 4 Months Ago Abdominal pain: epigastric area
More informationDUKEMedicine. SMITH, JAMES MRN: D DOB: 2/6/1993, Sex: M Adm: 2/15/2016, D/C: 2/15/2016
History Chief Complaint Patient presents with Motor Vehicle Crash HPI James Smith is a 23 y.o. male here today for evaluation of injuries sustained today in a MVA. He was a restrained driver of a car struck
More informationCases from the Clinic Maryland ACP Meeting January 30, 2016
Cases from the Clinic Maryland ACP Meeting January 30, 2016 Bimal Ashar, MD, FACP D. William Schlott, MD Associate Professor of Medicine Johns Hopkins University School of Medicine 1 CASE 1: GK 46-year-old
More informationMy Patient Has Abdominal Pain PoCUS of the Biliary Tract and the Urinary Tract
My Patient Has Abdominal Pain PoCUS of the Biliary Tract and the Urinary Tract Objectives PoCUS for Biliary Disease PoCUS for Renal Colic PoCUS for Urinary Retention Biliary Disease A patient presents
More informationBahl & Bahl Medical Associates PATIENT MEDICAL HISTORY
Bahl & Bahl Medical Associates PATIENT MEDICAL HISTORY NAME: _ DATE: Please complete the following questionnaire as completely as possible. 1. MEDICAL HISTORY Please list all current and prior health problems,
More informationPatient Encounter Skills. Lesson 7: Case Presentation. MED 2016 Clinical English Course. Takayuki OSHIMI MD. MED 2016 Clinical English Course
1. HPI: OPQRST 2. Risk Factors Lesson 7: Case Presentation 1 MED 2016 Clinical English Course Takayuki OSHIMI MD Today s Lesson 2 3. Headache 4. Chest Pain 5. Abdominal Pain 6. Counseling 7. Case Presentation
More informationGASTROENTEROLOGY PATIENT QUESTIONNAIRE - PLEASE PRINT
GASTROENTEROLOGY PATIENT QUESTIONNAIRE - PLEASE PRINT Full name: Date: Telephone Number: Age: Address: Email address: CHIEF COMPLAINTS(List the problems about which you came to see the doctor) 1) 2) 3)
More informationMHD II Session 3 STUDENT COPY
MHD II, Session 3, Student Copy - Page 1 MHD II Session 3 January 15, 2016 STUDENT COPY MHD II, Session 3, Student Copy - Page 2 CASE HISTORY 1 Cc: Terrible diarrhea for 1 ½ days A 66 year-old woman presents
More informationMed 536 Communicating About Prognosis Workshop. Case 2
Med 536 Communicating About Prognosis Workshop Case 2 ID / CC: 33 year-old man with intracranial hemorrhage History of the Presenting Illness 33 year-old man with a prior history of melanoma of the neck
More informationArcana Center for Integrative Medicine
Arcana Center for Integrative Medicine Patient s Name: Date of Birth: Reason for today s visit: Past Medical History Primary care physician: Date of last exam: (sick or well) Physician s Address: Office
More informationCase presentation. Dr Rammohan Reddy 1 st year PG, Dept of DVL, Kamineni Institute of Medical Sciences, Narketpally.
Case presentation Dr Rammohan Reddy 1 st year PG, Dept of DVL, Kamineni Institute of Medical Sciences, Narketpally. Name : XXX Age : 33 years Sex : Female Occupation : Farmer IP no : 201608905 DOA : 15-02-2016
More informationNew Patient History. Name: DOB: Sex: Date: If yes, give the name of the physician who did your evaluation or ordered your tests:
New Patient History Name: DOB: Sex: Date: Chief Complaint: 1. Give a brief description of the problem you are seeking treatment for today: 2. Have you been evaluated for this problem or had any tests for
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationCLINICAL PRESENTATION AND RADIOLOGY QUIZ QUESTION
Donald L. Renfrew, MD Radiology Associates of the Fox Valley, 333 N. Commercial Street, Suite 100, Neenah, WI 54956 8/27/2011 Radiology Quiz of the Week # 35 Page 1 CLINICAL PRESENTATION AND RADIOLOGY
More informationREASON FOR REFERRAL Referred for blisters and rash of mucous membranes and skin.
Report 1 Listen to the audio to fill in the blanks. Name: DERMATOLOGY CONSULTATION REPORT REASON FOR REFERRAL Referred for blisters and rash of mucous membranes and skin. HISTORY OF PRESENT ILLNESS Rash
More informationCASE-BASED SMALL GROUP DISCUSSION. MHD II Session VII. Friday, March 28, 2014 STUDENT COPY
CASE-BASED SMALL GROUP DISCUSSION MHD II Session VII Friday, March 28, 2014 STUDENT COPY Helpful resources ACP Medicine available online through Loyola Health Science Library Endocrinology and Metabolism
More informationPast Medical History. Chief Complaint: Patient Name: Appointment Date: Page 1
Appointment Date: Page 1 Chief Complaint: (Please write reason, symptoms, condition or diagnosis that prompts your appointment) Past Medical History PERSONAL SKIN HISTORY YES NO Yes - Details Melanoma
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationParathyroid Disease Scenarios for the Practicing Clinician. Vijaya Chockalingam MD Faculty Endocrinologist Banner University Medical Center- Phoenix
Parathyroid Disease Scenarios for the Practicing Clinician Vijaya Chockalingam MD Faculty Endocrinologist Banner University Medical Center- Phoenix Clinical Scenario-1 73 year man (BK) with hypercalcemia
More informationAge: 14 Houston TX 77007
Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black
More informationPatient to complete this information
Patient to complete this information Patient s Name Birth date Today s date Referring Physician Primary Care Physician Age Occupation Retired, how long? Prior operations Medications Type Date Name Dose
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationINSTRUCTIONS: 1. Use codetable on page 1 for modifications / termination reasons
Radiation Therapy Oncology Group Phase III Head & Neck Cancer Treatment Summary Form AMENDED DATA YES INSTRUCTIONS: 1 Use codetable on page 1 for modifications / termination reasons SUMMARY OF SYSTEMIC
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationEvaluation and Management (E/M) Training. Module 12
Evaluation and Management (E/M) Training Module 12 AMA Disclaimer CPT copyright 2011 American Medical Association. All rights reserved. Fee schedules, relative value units, conversion factors and/or related
More informationFoamy Urine and Sickled Cells. Margaret Prat Huntwork, MD, MSEd Tulane / Ochsner Residency Program New Orleans, LA
Foamy Urine and Sickled Cells Margaret Prat Huntwork, MD, MSEd Tulane / Ochsner Residency Program New Orleans, LA Foamy Urine and Sickled Cells Margaret Prat Huntwork, MD, MSEd Tulane University Health
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More information