Cos7 (3TP) (K): TGFβ1(h): (K)

Size: px

Start display at page:

Download "Cos7 (3TP) (K): TGFβ1(h): (K)"

Baldric Owen
6 years ago
Views:

IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse

signlling. () interts with Sm3-Sm4 heteromeri omplexes.

1 IP#2: IP#1: Totl Lystes luiferse tivity (K): (K): luiferse tivity luiferse tivity (K): 2 1 RL-: Sm4-3F: MYC-Sm3: TβRI-HA(T204D): α-ha Luiferse Ativity 4 - TGFβ1: (K) Cos7 (3TP) si TGFβ1(h): (K): 45 Luiferse Ativity (K) NIH3T3 (3TP) α- α-atin si α- Figure S1 ins to Sm heteromeri omplexes to regulte TGFβepenent signlling. () interts with Sm3-Sm4 heteromeri omplexes. Lystes from HEK293T ells expressing RL-tgge, Sm4-3F, MYC-Sm3 n onstitutively tive TβRI-HA[T204D] were immunopreipitte with nti-flag ntioy n Sm4 oun protein omplexes were then elute uner ntive onitions with 3xFLAG peptie. Sm3-Sm4 omplexes were susequently purifie y seon IP using n nti-myc ntioy. Totl protein expression ws onfirme y IB with the inite ntioies. Luiferse tivity in the IP n in n liquot of the totl ell lystes ws mesure to etermine the mount of oun to the omplex. Results re shown s men ± s.. (n=3). () is require for TGFβ-meite trnsription in COS7 n NIH3T3 ells. Reltive luiferse tivity from the 3TP-lux reporter ws mesure in COS7 or NIH3T3 ells tht were trnsfete with or si n trete with or without TGFβ1. Results re shown s men ± s.. (n=3). () protein levels re stilize in response to TGFβ. HepG2 ells were trete with TGFβ for the inite time n totl ell extrts were exmine y immunoloting for protein levels. 1

TGFβ1: Frtion: (K): 250 130 si - - + + - - + + C N C N C N C N α-sm2 α-sm4 α- α-eea1 α-ar105 COS7 NIH3T3 No tretment + TGFβ1 No tretment si + TGFβ1 No tretment + BMP2 α-sm4 DAPI α-sm4 DAPI si Vrels

2 TGFβ1: Frtion: (K): si C N C N C N C N α-sm2 α-sm4 α- α-eea1 α-ar105 COS7 NIH3T3 No tretment + TGFβ1 No tretment si + TGFβ1 No tretment + BMP2 α-sm4 DAPI α-sm4 DAPI si Vrels et l. FIG. S2 Figure S2 is require for the TGFβ-inue nuler umultion of Sms. () Nuleo-ytoplsmi frtiontion nlysis following knokown. Nuler n ytoplsmi extrts were prepre from HepG2 ells trnsfete with or si n trete with or without TGFβ1. The reltive levels of ytoplsmi [C] n nuler [N] proteins were nlyze y immunolotting. EEA1 ws use s ytoplsmi loing ontrol, n Ar105 ws use s nuler loing ontrol. () TGFβ-epenent nuler umultion of Sm2 is reue following knokown in COS7 n NIH3T3 ells. COS7 or NIH3T3 ells were trnsfete with or si n the loliztion of Sm2 ws etermine y immunofluoresene nlysis following tretment with or without TGFβ1. The sle r represents 10 µm. () is not require for BMP-epenent Sm nuler umultion. HepG2 ells were trnsfete with or si n the loliztion of Sm4 ws etermine y immunofluoresene nlysis following tretment with or without BMP2. The sle r represents 10 µm. 2

si TGFβ1: 0 30 120 0 30 120 α-phospho-sm2 (K): α-phospho-sm3 α-sm2/3 α-/yap 3F-: TGFβ1(min): (K): - - - + + + 0 30 60 0 30 60 α-phospho-sm2 α-sm2 α-flg 3F-Sm2: Sm4-HA: : TβRI(T204D): (K): - - - + + +

3 si TGFβ1: α-phospho-sm2 (K): α-phospho-sm3 α-sm2/3 α-/yap 3F-: TGFβ1(min): (K): α-phospho-sm2 α-sm2 α-flg 3F-Sm2: Sm4-HA: : TβRI(T204D): (K): IP: Totl Lystes α-ha α- α-ha IP: Totl Lystes (K): 30 luiferse tivity luiferse tivity RL-: TBR1(T204D): 3F-Sm2 mutnts: MH1 linker MH CTL MH1 MH2 MH1 MH2 linker MH1 MH2 MH1 MH2 linker Figure S3 oes not regulte Sm phosphoryltion or heteromeri omplex formtion. () Sm2/3 phosphoryltion is not ffete following knokown. Lystes from HepG2 ells trete with TGFβ1 for the inite mount of time were immunolotte for the phosphoryltion of enogenous Sm2 n Sm3 using the ntioies shown. () Phospho-Sm2 levels re not ffete y expression. COS7 ells were trnsfete with either empty ontrol plsmi or plsmi expressing 3F- n were then trete with TGFβ1 for the inite mount of time. Lystes from these ells were immunolotte [IB] with nti-phospho- Sm2 ntioy, nti-sm2 ntioy n nti-flag M2 ntioy s inite. () Sm2-Sm4 omplex formtion is not ffete y expression. Lystes from HEK293T ells expressing 3F-Sm2, Sm4-HA n together with onstitutively tive TβRI[T204D] were sujete to immunopreipittion with nti-flag M2 ntioy n then immunolotte with nti-ha ntioy to etet Sm4 oun to Sm2. () The MH1 omin of Sm2 ins. Lystes from HEK293T ells expressing RLtgge together with 3F-tgge Sm2 or Sm2 mutnts were sjete to IP using n nti-flag ntioy n ssoite ws etermine y mesuring the reltive luiferse tivity. Results re shown s men ± s.. (n=3). A shemti representtion of the Sm2 mutnts use is shown. 3

4 Cell line: (K): HepG2 Cos7 293T Mv1LU α- HepG2 DAPI 3F-Sm2 DAPI Cos7 no tretment HEK293T +TGFβ1 Mv1LU Expression Vetor nuler loliztion nuler Sm2 loliztion e - 6 3TP GFP (Control) Wil-type [S89A] [106 ] [ WW] [ 393] [ ] n/ 1% 27% % 0% 1% 0% 85% 22% % 66% % 31% 33% Luiferse Ativity vetor: CTL S89A 106 WW Figure S4 Anlysis of n Sm nuler umultion. () levels in ifferent ell lines. 10 µg of totl ell extrts from the inite ell lines ws exmine for protein levels y immunolotting. () loliztion in ifferent ell lines. The inite ell lines were exmine for the enogenous loliztion of y immunofluoresene. () Sm2 expression oes not ffet loliztion. HepG2 ells trnsiently expressing 3F-Sm2 were trete with or without TGFβ1 n the loliztion of enogenous ws exmine. The sle r represents 10 µm. () Quntittion of Sm loliztion in the presene of mutnt expression. The perentge of ells tht isply preomintely nuler lolize n the TGFβ-epenent nuler umultion of enogenous Sm2 ws quntitte. The perentge shown is the verge of three experiments ± s.. with minimum of 50 ells ounte for eh. (e) Reltive luiferse tivity from the 3TP-lux reporter ws mesure from HepG2 ells expressing high levels of the inite mutnts from the CMV promoter. The empty vetor ws trnsfete s ontrol [CTL]. Results re shown s men ± s.. (n=3). 4

TGFβ1: - + L - + L - + (K): IgH α-arc105 IgG Totls α-/yap α-arc105 8-6 5 4 3 2 1 TGFβ1: 3F- mutnts: Luiferse Ativity CTL 3TP -+ -+ -+ -+ CC 222 ARC105 Overlp oeffiient (R) = 0.46 +/- 0.

5 TGFβ1: - + L - + L - + (K): IgH α-arc105 IgG Totls α-/yap α-arc TGFβ1: 3F- mutnts: Luiferse Ativity CTL 3TP CC 222 ARC105 Overlp oeffiient (R) = / ARC105 Trnsfetion (+TGFβ1) + ARC105 e Trnsfetion (+TGFβ1) + ARC105 Me6 TriMeth (K4)H3 Sm2/3 IF IF Me6 TriMeth (K4)H3 Sm2/3 Ar105 Ar105 Ar105 f (K): siarc105 α-arc105 α-atin siarc105 g ARC105 DAPI Sm2 DAPI siarc105 Figure S5 Assoition of n Ar105. () n Ar105 intert enogenously. Lystes from Mv1Lu ells trete with or without TGFβ1 were sujete to immunopreipittion n susequent immunolotting with the inite ntioies. As ontrol the ntioies were inute in lysis uffer [L] lone. The hevy hin of the ntioies is inite [IgH]. () mutnts tht in ARC105, ut not Sms, ffet Sm signlling. Reltive luiferse tivity from the 3TP-lux reporter ws mesure from HepG2 ells expressing high levels of, [ CC] or [ 222] from the CMV promoter. The empty vetor ws trnsfete s ontrol [CTL]. Results re shown s men ± s.. (n=3). () Cololiztion of enogenous n ARC105. HepG2 ells were o-stine for n ARC105 s inite n imge y spinning isk onfol mirosopy. A representtive nuleus is shown with re n green stining reveling the sunuler istriution of n ARC105, respetively. The overlp oeffiient (R) ws etermine to quntitte the ololiztion etween n ARC105 (see mteril n methos). Results re shown s the men ± s.. from ell nulei otine from 15 rnomly otine fiels from two ifferent experiments. A higher mgnifition imge from eh onition is shown. The sle r represents 5 µm. () Expresse n ARC105 ololize with trnsriptionl mhinery. COS7 ells were Vrels et l. FIG. S5 trnsfete with 3F-tgge n 3HA-ARC105 n the loliztion of, ARC105 n enogenous Me6 or trimethylte-k4 histone H3 ws etermine y IF following TGFβ tretment. A higher mgnifition imge from eh onition is shown with rrows initing sunuler toroil strutures tht isply o-loliztion. The sle r represents 10 µm. (e) Sunuler ololiztion of, ARC105 n Sm2 in HepG2 ells. HepG2 ells were trnsfete with 3F-tgge n 3HA-ARC105 n the loliztion of, ARC105 n enogenous Sm2 ws etermine y IF following TGFβ tretment. A higher mgnifition imge from eh onition is shown with rrows pointing to sunuler toroil strutures tht isply o-loliztion. The sle r represents 10 µm. (f) siarc105 potently knoks own enogenous ARC105. HepG2 ells were trnsfete with either ontrol or ARC105 sirna ( or siarc105, respetively) n ells either lyse for western lot nlysis of ARC105 levels or tin (left pnels) or trete for nlysis y IF (right pnels). (g) Anlysis of Sm2 n loliztion following ARC105 knokown. HepG2 ells were trnsfete s inite, trete with TGFβ1, n the loliztion of enogenous Sm2 (green) n (re) ws nlyze y IF. The ells were ounterstine with DAPI to visulize the nuleus. The sle r represents 10 µm. 5

6 Figure 1 α-sm2/3 IgG TGFβ1: + - L + - L α-/yap IgH Totls α-sm4 IgG TGFβ1: L - + L (K): 130 Figure 1 α-/yap relot Sm4 α-sm4 Sm4 α-sm4 (light exposure) Sm2 α-sm2/3 Sm4 130 α-sm4 (rk exposure) Figure 4 Figure 7 IgH Totls Vrels et l. FIG. S6 Figure S6 Full-size immunolots of key enogenous intertions shown in the regulr figures. (,) Immunolots from Figure 1. () Immunolots from Figure 3. () Immunolots from Figure

7 Supplementry Tle 1. Primers use in this stuy Gene Forwr Primer Reverse Primer For qpcr: Gph AATCCCATCACCATCTTCCA TGGACTCCACGACGTACTCA Hprt AAACAATGCAGACTTTGCTTTCC GGTCCTTTTCACCAGCAAGCT Tz GTATCCCAGCCAAATCTCGTGATG CAGCGCATTGGGCATACTCATG I2 CCTCAACACGGATATCAGCATCCT ACACCGCTTATTCAGCCACACA Sm7 CCCCATCACCTTAGCCGACTCTGC CCCAGGGGCCAGATAATTCGTTCC PAI-1 ATTCAAGCAGCTATGGGATTCAA CTGGACGAAGATCGCGTCTG For ChIP-qPCR: Sm7 TAGAAACCCGATCTGTTGTTTGCG CCTCTGCTCGGCTGGTTCCACTGC PAI-1 GCAGGACATCCGGGAGAGA CCAATAGCCTTGGCCTGAGA

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION % ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -