Table S1. X-ray data collection and refinement statistics
|
|
|
- Osborne Burke
- 6 years ago
- Views:
Transcription
1 Table S1. X-ray data collection and refinement statistics Data collection H7.167 Fab-Sh2/H7 complex Beamline SSRL 12-2 Wavelength (Å) Space group I2 1 3 Unit cell parameters (Å, º) a = b = c=207.3, α =β =γ = 90.0 Resolution (Å) ( ) a Unique reflections 8,097 (393) a R merge (%) b 7.6 (97.2) a R pim (%) b 1.9 (28.3) a I/sigma 46.7 (2.2) a Completeness (%) (100.0) a Redundancy c Z a 18.4 (12.5) a 1 Refinement statistics Resolution Reflections used in refinement 8,095 R cryst (%) d 32.6 R free (%) e 35.4 Protein atoms 5,599 Waters 0 Other 0 Average B-value (Å 2 ) Overall 194 Wilson 295 RMSD from ideal geometry Bond length (Å) Bond angles ( ) Ramachandran statistics (%) f Favored 90.1 Outliers 1.2 PDB ID 5F45 a Numbers in parenthesis refer to the highest resolution shell. b R merge = Σ hkl Σ i I hkl,i - <I hkl > / Σ hkl Σ i I hkl,i and R pim = Σ hkl [1/(n-1)] 1/2 Σ i I hkl,i - <I hkl > / Σ hkl Σ i I hkl,i, where I hkl,i is the scaled intensity of the i th measurement of reflection h, k, l, < I hkl > is the average intensity for that reflection, and n is the redundancy. c Z a is the number of HA monomer-fab complexes per crystallographic asymmetric unit. d R cryst = Σ F o - F c / Σ F o x 100, where F o and F c are the observed and calculated structure factors, respectively. e R free was calculated as for R cryst, but on a random test set comprising 5% of the data excluded from refinement. f Calculated using MolProbity (43). 1
2 Figure S1. Representative electron density at the H7.167 Fab-Sh2/H7 complex interface. The H7.167 variable heavy and light chains are colored magenta and yellow and the HA1 is colored green. The 2F o -F c electron density map (blue mesh) is contoured at 1σ. 2
3 Table S2. Conservation of H7.167 epitope residues in H7 HAs and comparison with representative HAs from H1, H2, H3 and H5 (H3 numbering). Subtype Isolate Contacting residues at position in HAs A 158B H7N9 A/Shanghai/02/2013 R N D N A A F S K N H7N9 A/Shanghai/01/2013 R N D N A A F S K N H7N7 A/Netherlands/219/2003 R N D N A A F S K N H7N2 A/New York/107/2003 R N D N A A F S K N H1N1 A/Texas/36/1991 T K S S Y N D T H2N2 A/Japan/305/1957 T K S N Y N G T H3N2 A/Victoria/361/2011 T L F K Y Q S T H5N1 A/Vietnam/1203/2004 A K S T Y N T N No residue inserts at this position. 3
4 Figure S2. Sequence and structure comparison of the 150-loop from different HA subtypes. (A) Sequence alignment of the 150-loop in H7 HAs with those from H1/H2/H3/H5. The inserted residues 158A and 158B are labeled with red box. (B) Superposition of the 150-loop from H7N9 (A/Shanghai/02/2013) (green, PDB 4N5J), H1N1 (A/BrevigMission/1/1918) (cyan, PDB 3GBN), H2N2 (A/Singapore/1/1957) (wheat, PDB 4HFU), H3N2 (A/Victoria/261/2011) (blue, PDB 4O5N) and H5N1 (A/Vietnam/CL12/2004) (lavender, PDB 4BGX) HAs. The 158A and 158B side chains in H7 HA are shown in green sticks. The unique conformation of the 150-loop of H7 HA and insertion of 158A and 158B in this loop are likely associated with the particular specificity of this H7.167 HA. 4
5 Figure S3. Surface representation analysis of the escape mutants N157D and N158BD of Sh2/H7 HA to antibody H (A) Electrostatic potential surfaces (red, negative, 5.4 kt; blue, positive, +5.4 kt; white, neutral) around wild-type Sh2/H7 HA with N157 and N158B (green sticks). (B) Electrostatic potential surfaces around Sh2/H7 HA mutants model with N157D and N158BD (green sticks), in the same orientation as A. The N157D and N158BD mutations alter the electrostatic potential from near neutral (A) to weakly acidic (B) around HA1 position N157 and N158B, rendering it unfavorable for binding to H7.167, which is also weakly acidic around the paratope site of interaction with HA1 N157 and N158B (B). 5
6 Table S3. Primer sets used for RT-PCR amplification of antibody gene cdnas Name Heavy-chain primers Forward primers IgExp-A_5ʹL-VH1 IgExp-A_5ʹL-VH2 IgExp-A_5ʹL-VH3 IgExp-A_5ʹL-VH4 IgExp-A_5'L-VH5 IgExp-A_5ʹL-VH6 IgExp-A_5ʹL-VH7 Reverse primer IgExp-B_3ʹCH1 Light-chain primers Forward κ-chain primers IgExp-A_5ʹL-VK1 IgExp-A_5ʹL-VK2 IgExp-A_5ʹL-VK3 IgExp-A_5ʹL-VK4 IgExp-A_5ʹL-VK5 IgExp-A_5ʹL-VK6 Reverse κ-chain primer IgExp-B_3ʹCK1 Forward λ-chain primers IgExp-A_5ʹL-VL1 IgExp-A_5ʹL-VL2 IgExp-A_5ʹL-VL3 IgExp-A_5ʹL-VL4 IgExp-A_5ʹL-VL5 IgExp-A_5ʹL-VL6 IgExp-A_5ʹL-VL7 IgExp-A_5ʹL-VL8 IgExp-A_5ʹL-VL9 IgExp-A_5ʹL-VL10 IgExp-A_5ʹL-VL11 Reverse λ-chain primer IgExp-B_3ʹCL1 Primer Sequence (5ʹ 3ʹ) GTTTTAAAAGGTGTCCTGTGTCARRTNCAGCTGGTRCAGTC GTTTTAAAAGGTGTCCTGTGTCAGRTCACCTTGARGGAGTC GTTTTAAAAGGTGTCCTGTGTSARGTGCAGCTGGTGGAGTC GTTTTAAAAGGTGTCCTGTGTCAGSTGCAGCTRSAGGAGTC GTTTTAAAAGGTGTCCTGTGTGARGTGCAGCTGGTGCAGTC GTTTTAAAAGGTGTCCTGTGTCAGGTACAGCTGCAGCAGTC GTTTTAAAAGGTGTCCTGTGTCAGGTGCAGCTGGTGCAGTC GATGGGCCCTTGAAGCTTGCTGAGGAGACGGTGACCAGGGT GAATCCCAGGCATGAGATCTGMCATCCRGWTGACCCAG GAATCCCAGGCATGAGATCTGAKRTTGTGATGACYCAG GAATCCCAGGCATGAGATCTGAAATWGTRWTGACRCAG GAATCCCAGGCATGAGATCTGACATCGTGATGACCCAG GAATCCCAGGCATGAGATCTGAAACGACACTCACGCAG GAATCCCAGGCATGAGATCTGAWRTTGTGMTGACWCAG GATGGCGGGAAGATGAAGACAGATGGTGCGGCCGCAGT GAATCCCAGGCATGAGATCTCAGTCTGTSBTGACKCAG GAATCCCAGGCATGAGATCTCARTCTGCCCTGACTCAG GAATCCCAGGCATGAGATCTTCCTMTGDGCYRAYWCAG GAATCCCAGGCATGAGATCTCWGCYTGTGCTGACTCAA GAATCCCAGGCATGAGATCTCAGSCTGTGCTGACTCAG GAATCCCAGGCATGAGATCTAATTTTATGCTGACTCAG GAATCCCAGGCATGAGATCTCAGRCTGTGGTGACTCAG GAATCCCAGGCATGAGATCTCAGWCTGTGGTGACCCAG GAATCCCAGGCATGAGATCTCAGCCTGTGCTGACTCAG GAATCCCAGGCATGAGATCTCAGGCAGGGCTGACTCAG GAATCCCAGGCATGAGATCTCGGCCCGTGCTGACTCAG AGGGGGGAACAGAGTGACASTTGGAGCGGCCTTAGGCTG 6
Supplementary Table 1. Data collection and refinement statistics (molecular replacement).
Supplementary Table 1. Data collection and refinement statistics (molecular replacement). Data set statistics HLA A*0201- ALWGPDPAAA PPI TCR PPI TCR/A2- ALWGPDPAAA PPI TCR/A2- ALWGPDPAAA Space Group P2
Supporting Information
Supporting Information Guan et al. 10.1073/pnas.1217609110 Fig. S1. Three patterns of reactivity for CD4-induced (CD4i) mabs. The following representative ELISAs show three patterns of reactivity for CD4i
SUPPLEMENTARY INFORMATION
Supplementary discussion of the role of C05 HCDR1 in antigen binding. Deletion of the 5 amino-acid insertion in HCDR1 del(fgest) and scanning mutagenesis of the tip of the loop had differing effects on
FCC2 5CY7 FCC1 5CY8. Actinonin 5CVQ
Table S1. Data collection and refinement statistics Data collection Apo 5E5D MA 5CPD MAS 5CP0 Actinonin 5CVQ FCC1 5CY8 FCC2 5CY7 FCC 5CWY FCC4 5CVK FCC5 5CWX FCC6 5CVP X-ray source 17A-KEK PAL4A PAL4A
172R 172K TAM-2/172R TAM-2/172K. AZT concentration [nm] AZT concentration [nm] MgCl 2 2.5K 2.5K 5K 2.5K 5K 2.5K K 5K 2.5K 5K 2.5K 50 2.
![172R 172K TAM-2/172R TAM-2/172K. AZT concentration [nm] AZT concentration [nm] MgCl 2 2.5K 2.5K 5K 2.5K 5K 2.5K K 5K 2.5K 5K 2.5K 50 2.](/thumbs/82/85138523.jpg "172R 172K TAM-2/172R TAM-2/172K. AZT concentration [nm] AZT concentration [nm] MgCl 2 2.5K 2.5K 5K 2.5K 5K 2.5K K 5K 2.5K 5K 2.5K 50 2.")
5 5 5 5 A MgCl 2 172R 172K TAM-2/172R TAM-2/172K AZT concentration [nm] B 172R 172K TAM-2/172R TAM-2/172K AZT concentration [nm] ATP + ATP - Supplemental Figure 1. Primer extension of HIV-1 RT polymorphisms
Supplementary Information Janssen et al.
Supplementary Information Janssen et al. Insights into complement convertase formation based on the structure of the factor B CVF complex Bert J.C. Janssen 1, Lucio Gomes 1, Roman I. Koning 2, Dmitri I.
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10913 Supplementary Figure 1 2F o -F c electron density maps of cognate and near-cognate trna Leu 2 in the A site of the 70S ribosome. The maps are contoured at 1.2 sigma and some of
Atypical Natural Killer T-cell receptor recognition of CD1d-lipid antigens supplementary Information.
Atypical Natural Killer T-cell receptor recognition of CD1d-lipid antigens supplementary Information. Supplementary Figure 1. Phenotypic analysis of TRBV25-1 + and TRBV25-1 - CD1d-α-GalCerreactive cells.
(B D) Three views of the final refined 2Fo-Fc electron density map of the Vpr (red)-ung2 (green) interacting region, contoured at 1.4σ.
Supplementary Figure 1 Overall structure of the DDB1 DCAF1 Vpr UNG2 complex. (A) The final refined 2Fo-Fc electron density map, contoured at 1.4σ of Vpr, illustrating well-defined side chains. (B D) Three
Supporting Information
Supporting Information Mechanism of inactivation of -aminobutyric acid aminotransferase by (1S,3S)-3-amino-4-difluoromethylenyl-1- cyclopentanoic acid (CPP-115) Hyunbeom Lee, 1, Emma H. Doud, 1,2 Rui Wu,
Supplementary Figure 1. Heavy chain sequences of 2G1 and 8M2 aligned with V H 1-69
Supplementary Figure 1. Heavy chain sequences of 2G1 and 8M2 aligned with V H 1-69 germline gene sequence. 2G1 and 8M2 acquired 14 and 18 mutations from the germline gene sequence, respectively. In 2G1,
Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site.
Supplementary Figure 1 Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site. (a) Gel filtration profiles of purified 5 TMD samples at 100 nm, heated beforehand for
Chapter 6. X-ray structure analysis of D30N tethered HIV-1 protease. dimer/saquinavir complex
Chapter 6 X-ray structure analysis of D30N tethered HIV-1 protease dimer/saquinavir complex 6.1 Introduction: The arrival of HIV protease inhibitors (PIs) in late 1995 marked the beginning of an important
Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
SUPPLEMENTARY INFORMATION. Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity
SUPPLEMENTARY INFORMATION Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity Christopher Woods 1, Maturos Malaisree 1, Ben Long 2, Simon McIntosh-Smith
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature07422 SUPPLEMENTARY INFRMATIN K S(P) R S I M Q(L4) R M 7 6 Sp Q I K R 5 4 3 2 1 L(L0) L L S E 0 +1 +2 +3 Figure S1a Difference electron density (mfo DFc) for the peptide (Qpeptide),
Supplementary Materials for
www.sciencemag.org/cgi/content/full/science.aal4326/dc1 Supplementary Materials for Structure of a eukaryotic voltage-gated sodium channel at near-atomic resolution Huaizong Shen, Qiang Zhou, Xiaojing
SUPPLEMENTARY INFORMATION FOR. (R)-Profens Are Substrate-Selective Inhibitors of Endocannabinoid Oxygenation. by COX-2
SUPPLEMENTARY INFORMATION FOR (R)-Profens Are Substrate-Selective Inhibitors of Endocannabinoid Oxygenation by COX-2 Kelsey C. Duggan, Daniel J. Hermanson, Joel Musee, Jeffery J. Prusakiewicz, Jami L.
Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation
Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation Hang Yu, 1, 2, a) Wei Han, 1, 3, b) Wen Ma, 1, 2 1, 2, 3, c) and Klaus Schulten 1) Beckman
Supporting Information
Supporting Information McCullough et al. 10.1073/pnas.0801567105 A α10 α8 α9 N α7 α6 α5 C β2 β1 α4 α3 α2 α1 C B N C Fig. S1. ALIX Bro1 in complex with the C-terminal CHMP4A helix. (A) Ribbon diagram showing
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/2/4/e1500980/dc1 Supplementary Materials for The crystal structure of human dopamine -hydroxylase at 2.9 Å resolution Trine V. Vendelboe, Pernille Harris, Yuguang
SUPPLEMENTAL MATERIAL. UNC119 is required for G protein trafficking in sensory neurons
1 SUPPLEMENTAL MATERIAL UNC119 is required for G protein trafficking in sensory neurons Houbin Zhang, Ryan N. Constantine, Sergey Vorobiev, Yang Chen, Jayaraman Seetharaman, Yuanpeng Janet Huang, Rong
Supplemental Information. An Atlas of b-glucuronidases. in the Human Intestinal Microbiome
Structure, Volume 2 Supplemental Information An Atlas of b-glucuronidases in the Human Intestinal Microbiome Rebecca M. Pollet, Emma H. D'Agostino, William G. Walton, Yongmei Xu, Michael S. Little, Kristen
Structure of the measles virus hemagglutinin bound to the CD46 receptor. César Santiago, María L. Celma, Thilo Stehle and José M.
Supporting Figures and Table for Structure of the measles virus hemagglutinin bound to the CD46 receptor César Santiago, María L. Celma, Thilo Stehle and José M. Casasnovas This PDF file includes: Supplementary
Supplementary Figure 1 Overall structure of the transmembrane pore of FraC. a, Crystal packing of the pore along the y-z, b, the z-x, and c, the y-x
Supplementary Figure 1 Overall structure of the transmembrane pore of FraC. a, Crystal packing of the pore along the y-z, b, the z-x, and c, the y-x planes. The N-terminal and the β-core regions are depicted
Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa
SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell
SUPPLEMENTARY INFORMATION (SI) FIGURES AND TABLES
SUPPLEMENTARY INFORMATION (SI) FIGURES AND TABLES 1 Title: Discovery of a junctional epitope antibody that stabilizes IL-6 and gp80 protein:protein interaction and modulates its downstream signaling Authors:
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.5 % SDS-PAGE gel under reducing and non-reducing conditions.
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 The UBL and RING1 interface remains associated in the complex structures of Parkin and pub. a) Asymmetric Unit of crystal structure of UBLR0RBR and pub complex showing UBL (green),
Table S1: Kinetic parameters of drug and substrate binding to wild type and HIV-1 protease variants. Data adapted from Ref. 6 in main text.
Dynamical Network of HIV-1 Protease Mutants Reveals the Mechanism of Drug Resistance and Unhindered Activity Rajeswari Appadurai and Sanjib Senapati* BJM School of Biosciences and Department of Biotechnology,
List of Figures. List of Tables
Supporting Information for: Signaling Domain of Sonic Hedgehog as Cannibalistic Calcium-Regulated Zinc-Peptidase Rocio Rebollido-Rios 1, Shyam Bandari 3, Christoph Wilms 1, Stanislav Jakuschev 1, Andrea
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/2/9/e1600292/dc1 Supplementary Materials for Native phasing of x-ray free-electron laser data for a G protein coupled receptor Alexander Batyuk, Lorenzo Galli,
An esterase from anaerobic Clostridium hathewayi can hydrolyze aliphatic-aromatic polyesters
Supporting Information An esterase from anaerobic Clostridium hathewayi can hydrolyze aliphatic-aromatic polyesters Veronika Perz a, Altijana Hromic b,c, Armin Baumschlager b, Georg Steinkellner b, Tea
Nature Immunology: doi: /ni Supplementary Figure 1. Infection strategy.
Supplementary Figure 1 Infection strategy. To test the antibody responses against influenza viruses, animals were sequentially infected with two divergent strains of the same subtype. For H1N1 infections,
Supplementary Information for Structural basis for the inhibition of Polo-like kinase 1
Supplementary Information for Structural basis for inhibition of Polo-like kinase 1 Jun Xu, Chen Shen, Tao Wang & Junmin Quan Correspondence authors: Tao Wang, taowang@pkusz.edu.cn; Junmin Quan, quanjm@szpku.edu.cn
Supplementary Material
Supplementary Material Materials and methods Enzyme assay The enzymatic activity of -glucosidase toward salicin was measured with the Miller method (Miller, 1959) using glucose as the standard. A total
Supplementary Information
Supplementary Information Two common structural motifs for TCR recognition by staphylococcal enterotoxins Karin Erica Johanna Rödström 1, Paulina Regenthal 1, Christopher Bahl 2, Alex Ford 2, David Baker
KDM2A. Reactions. containing. Reactions
Supplementary Figure 1 KDM2A catalyses only lysine demethylation.. MALDI-TOF MS of demethylation of the shown variant histone peptides as catalysed by recombinant KDM2A. Reactions containing enzyme are
Constructs expressing recombinant proteins were generated by PCR; mutant variants were
Cell, Volume 136 Supplemental Data The Ste5 Scaffold Directs Mating Signaling by Catalytically Unlocking the Fus3 MAP Kinase for Activation Matthew Good, Grace Tang, Julie Singleton, Attila Remenyi, and
Supplementary Figure S1. Supplementary Figure S1. Chemical structure of CH
Supplementary Figure S1 Supplementary Figure S1. Chemical structure of CH7057288. Supplementary Figure S2 Kinase % competition TRKA 99 TRKC 95 TRKB 92 MEK5 87 AXL 84 CLK1 82 MERTK 82 GCN2 (Kin.Dom.2,S808G)
Supplementary Information
Supplementary Information Structural Basis of Sialidase in Complex with Geranylated Flavonoids as Potent Natural Inhibitors Youngjin Lee, a,b Young Bae Ryu, d Hyung-Seop Youn, a,b Jung Keun Cho, e Young
SUPPORTING INFORMATION FOR. A Computational Approach to Enzyme Design: Using Docking and MM- GBSA Scoring
SUPPRTING INFRMATIN FR A Computational Approach to Enzyme Design: Predicting ω- Aminotransferase Catalytic Activity Using Docking and MM- GBSA Scoring Sarah Sirin, 1 Rajesh Kumar, 2 Carlos Martinez, 2
Data collection. Refinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections 326 parameters 2 restraints
![Data collection. Refinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections 326 parameters 2 restraints](/thumbs/93/111285625.jpg "Data collection. Refinement. R[F 2 >2(F 2 )] = wr(f 2 ) = S = reflections 326 parameters 2 restraints")
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 2-Chloro-N-(2,3-dichlorophenyl)- benzamide B. Thimme Gowda, a * Sabine Foro, b B. P. Sowmya a and Hartmut Fuess
Nature Structural & Molecular Biology: doi: /nsmb.1933
The structural basis of open channel block in a prokaryotic pentameric ligand-gated ion channel Ricarda J. C. Hilf, Carlo Bertozzi, Iwan Zimmermann, Alwin Reiter, Dirk Trauner and Raimund Dutzler a GLIC
obtained for the simulations of the E2 conformation of SERCA in a pure POPC lipid bilayer (blue) and in a
Supplementary Figure S1. Distribution of atoms along the bilayer normal. Normalized density profiles obtained for the simulations of the E2 conformation of SERCA in a pure POPC lipid bilayer (blue) and
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature22394 Supplementary Table 1 Observed intermolecular interactions within the GLP-1:GLP-1R TMD interface. Superscripts refer to the Wootten residue numbering system
The Binding Mode of by Electron Crystallography
The Binding Mode of Epothilone A on α,β-tubulin by Electron Crystallography James H. Nettles, Huilin Li, Ben Cornett, Joseph M. Krahn, James P. Snyder, Kenneth H. Downing Science, Volume 305, August 6,
Supporting Information
Supporting Information Bauer et al. 10.1073/pnas.1610421113 SI Materials and Methods Immunofluorescence experiments were performed as described (8). Briefly, NUGC-3 cells were treated with 25 μm PK11007
Crystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen
Crystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen David Lutje Hulsik Unit for Virus Host Cell Interaction UMI 3265 University Joseph Fourier-EMBL-CNRS, Grenoble Env catalyzed
The mechanism of patellamide macrocyclization revealed by study of the Prochloron sp PatG macrocyclase domain
The mechanism of patellamide macrocyclization revealed by study of the Prochloron sp PatG macrocyclase domain Jesko Koehnke 1,2, Andrew Bent 1,2, Wael E. Houssen 2,3,4, David Zollman 1, Falk Morawitz 1,
HOMEWORK II and Swiss-PDB Viewer Tutorial DUE 9/26/03 62 points total. The ph at which a peptide has no net charge is its isoelectric point.
BIOCHEMISTRY I HOMEWORK II and Swiss-PDB Viewer Tutorial DUE 9/26/03 62 points total 1). 8 points total T or F (2 points each; if false, briefly state why it is false) The ph at which a peptide has no
data reports Bis[S-hexyl 3-(thiophen-2-ylmethylidene)dithiocarbazato-j 2 N 3,S]palladium(II) Structure description
![data reports Bis[S-hexyl 3-(thiophen-2-ylmethylidene)dithiocarbazato-j 2 N 3,S]palladium(II) Structure description](/thumbs/95/123526978.jpg "data reports Bis[S-hexyl 3-(thiophen-2-ylmethylidene)dithiocarbazato-j 2 N 3,S]palladium(II) Structure description")
Bis[S-hexyl 3-(thiophen-2-ylmethylidene)dithiocarbazato-j 2 N 3,S]palladium(II) ISSN 2414-3146 K. Begum, a * M. C. Sheikh, b R. Miyatake, c E. Zangrando d and M. S. Begum e Received 15 June 2016 Accepted
SUPPLEMENTARY INFORMATION
Supplementary Discussion The HGGG sequence motif forms an oxyanion hole in HLSs. In the case of GID1, the third Gly residue of the sequence motif is replaced with Ser (Ser123 in OsGID1), i.e., the sequence
Experimental. Crystal data. C 22 H 26 N 2 O 3 M r = Triclinic, P1 a = (3) Å b = (4) Å c = (4) Å = (6) = 100.
Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 15-Methoxy-14,15-dihydroandranginine Dian-Lei Wang, a Xiang-Hai Cai, b Peng Huang a * and He-Ping Huang a * a School of Pharmacy,
Rene Peschar Jan B. van Mechelen, Henk Schenk
Laboratory for Crystallography, van t Hoff Institute for Molecular Sciences, Faculty of Science, Universiteit van Amsterdam, The Netherlands Structure and polymorphism of trans mono-unsaturated triacylglycerols
ATP-independent reversal of a membrane protein aggregate by a chloroplast SRP
ATP-independent reversal of a membrane protein aggregate by a chloroplast SRP Peera Jaru-Ampornpan 1, Kuang Shen 1,3, Vinh Q. Lam 1,3, Mona Ali 2, Sebastian Doniach 2, Tony Z. Jia 1, Shu-ou Shan 1 Supplementary
Insights into the Giardia intestinalis Enolase and Human Plasminogen interaction
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Supplementary Information Insights into the Giardia intestinalis Enolase and Human
Biochemical and Biophysical Research Communications 346 (2006) Crystal structure of rat carnitine palmitoyltransferase II (CPT-II)
Biochemical and Biophysical Research Communications 346 (2006) 974 980 BBRC www.elsevier.com/locate/ybbrc Crystal structure of rat carnitine palmitoyltransferase II (CPT-II) Yu-Shan Hsiao a, Gerwald Jogl
Robyn L Malby', William R Tulip 2 t, Vincent R Harley 2 *, Jennifer L McKimm-Breschkin, W Graeme Laver 3, Robert G Webster 4 and Peter M Colman 1 *
The structure of a complex between the NC10 antibody and influenza virus neuraminidase and comparison with the overlapping binding site of the NC41 antibody Robyn L Malby', William R Tulip 2 t, Vincent
metal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 (Benzoato-j 2 O,O 0 )(5,5,7,12,12,14-hexamethyl-1,4,8,11-tetraazacyclotetradecane-j 4 N,N 0,N 00,N 000 )nickel(ii)
Supplementary information: Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
Supplementary information: Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors Jan Jakubík, Alena Randáková, Pavel Zimčík, Esam E. El-Fakahany, and Vladimír
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Characterizing the mesophase behavior of hydrated 9.9 MAG at 20 C and at increasing concentrations of DDM by SAXS.
Supplementary Figure 1 Characterizing the mesophase behavior of hydrated 9.9 MAG at 20 C and at increasing concentrations of DDM by SAXS. Individual panels show I/2 SAXS profiles at the specified concentration
Amino Acids. Review I: Protein Structure. Amino Acids: Structures. Amino Acids (contd.) Rajan Munshi
Review I: Protein Structure Rajan Munshi BBSI @ Pitt 2005 Department of Computational Biology University of Pittsburgh School of Medicine May 24, 2005 Amino Acids Building blocks of proteins 20 amino acids
Experimental. Crystal data. C 19 H 19 N 3 O 3 M r = Monoclinic, C2=c a = (3) Å b = (2) Å c = (3) Å = 110.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 A second monoclinic polymorph of 4-(2- hydroxy-4-methoxybenzylideneamino)- 1,5-dimethyl-2-phenyl-1H-pyrazol- 3(2H)-one
In Silico Vaccine Design Based on Molecular Simulations of Rhinovirus Chimeras Presenting HIV-1 gp41 Epitopes
doi:10.1016/j.jmb.2008.10.089 J. Mol. Biol. (2009) 385, 675 691 Available online at www.sciencedirect.com In Silico Vaccine Design Based on Molecular Simulations of Rhinovirus Chimeras Presenting HIV-1
This PDF file includes: Supplementary Figures 1 to 6 Supplementary Tables 1 to 2 Supplementary Methods Supplementary References
Structure of the catalytic core of p300 and implications for chromatin targeting and HAT regulation Manuela Delvecchio, Jonathan Gaucher, Carmen Aguilar-Gurrieri, Esther Ortega, Daniel Panne This PDF file
Crystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s)
Ligand Type Name 6 Crystallization-grade After 447-52D After V3 cocktail Receptor CD4 Resonance Units 5 1 5 1 5 1 Broadly neutralizing antibodies 2G12 VRC26.9 Resonance Units Resonance Units 3 1 15 1 5
Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein
Supplementary Methods Thermal shift assays Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein unfolding was examined by monitoring the fluorescence of ANS (1-anilinonaphthalene-8-
The structural organization of substrate loading in iterative polyketide synthases
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41589-018-0026-3 In the format provided by the authors and unedited. The structural organization of substrate loading in iterative polyketide
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/3/eaaq0762/dc1 Supplementary Materials for Structures of monomeric and oligomeric forms of the Toxoplasma gondii perforin-like protein 1 Tao Ni, Sophie I. Williams,
Rapid Characterization of Allosteric Networks. with Ensemble Normal Mode Analysis
Supporting Information Rapid Characterization of Allosteric Networks with Ensemble Normal Mode Analysis Xin-Qiu Yao 1, Lars Skjærven 2, and Barry J. Grant 1* 1 Department of Computational Medicine and
Introduction to proteins and protein structure
Introduction to proteins and protein structure The questions and answers below constitute an introduction to the fundamental principles of protein structure. They are all available at [link]. What are
Bioinformatics for molecular biology
Bioinformatics for molecular biology Structural bioinformatics tools, predictors, and 3D modeling Structural Biology Review Dr Research Scientist Department of Microbiology, Oslo University Hospital -
The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
metal-organic compounds
metal-organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 Chlorido(2-chloronicotinato)triphenylantimony(V) Li Quan, Handong Yin* and Daqi Wang College of Chemistry
Cheiron School BL Practice of BL38B1 (Protein Crystallography)
Cheiron School BL Practice of BL38B1 (Protein Crystallography) Title: Data Collection and S-SAD Phasing of Protein Crystals Staff: Kazuya Hasegawa, Nobuhiro Mizuno (Structural Biology Group, SPring-8/JASRI)
Experimental. Crystal data. C 12 H 20 N 4 O M r = Orthorhombic, P a = (3) Å b = (4) Å c = 14.
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 5-[(1R,2R,4R)-2-Methoxy-1,7,7-trimethylbicyclo[2.2.1]hept-2-yl]-1H-tetrazole Jan W. Bats,* Peter Schell and Joachim
organic compounds (E)-Ethyl N 0 -(3-hydroxybenzylidene)- hydrazinecarboxylate dihydrate
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 (E)-Ethyl N 0 -(3-hydroxybenzylidene)- hydrazinecarboxylate dihydrate Xian-Chao Hu, a,b * Jie Zhang, a Da-Yong
The Structure of Holo and Metal-deficient Wild-type Human Cu, Zn Superoxide Dismutase and its Relevance to Familial Amyotrophic Lateral Sclerosis
doi:10.1016/s0022-2836(03)00355-3 J. Mol. Biol. (2003) 328, 877 891 The Structure of Holo and Metal-deficient Wild-type Human Cu, Zn Superoxide Dismutase and its Relevance to Familial Amyotrophic Lateral
data reports cis-cyclohexane-1,3-dicarboxylic acid N,N 0 -(pentane-1,5-diyl)bis(pyridine-4-carboxamide) water (1/1/2) Structure description
ISSN 2414-3146 cis-cyclohexane-1,3-dicarboxylic acid N,N 0 -(pentane-1,5-diyl)bis(pyridine-4-carboxamide) water (1/1/2) Brianna L. Martinez and Robert L. LaDuca* Received 23 September 2017 Accepted 12
Supplementary Information for. Heavy chain-only IgG2b-llama antibody effects near-pan HIV-1 neutralization by
Supplementary Information for Heavy chain-only IgG2b-llama antibody effects near-pan HIV-1 neutralization by recognizing a CD4-induced epitope that includes elements of co-receptor- and CD4-binding sites
Carmen Berthet-Colominas, Stéphanie Monaco, Armelle Novelli 1, Geneviève Sibaï 2, François Mallet 1 and Stephen Cusack 3.
The EMBO Journal Vol.18 No.5 pp.1124 1136, 1999 Head-to-tail dimers and interdomain flexibility revealed by the crystal structure of HIV-1 capsid protein (p24) complexed with a monoclonal antibody Fab
TEMA 5. ANTICUERPOS Y SUS RECEPTORES
TEMA 5. ANTICUERPOS Y SUS RECEPTORES The B-cell antigen receptor (left) consists of two identical heavy (H) chains and two identical light (L) chains. In addition, secondary components (Ig-α and Ig-β)
SDS-Assisted Protein Transport Through Solid-State Nanopores
Supplementary Information for: SDS-Assisted Protein Transport Through Solid-State Nanopores Laura Restrepo-Pérez 1, Shalini John 2, Aleksei Aksimentiev 2 *, Chirlmin Joo 1 *, Cees Dekker 1 * 1 Department
Project Manual Bio3055. Cholesterol Homeostasis: HMG-CoA Reductase
Project Manual Bio3055 Cholesterol Homeostasis: HMG-CoA Reductase Bednarski 2003 Funded by HHMI Cholesterol Homeostasis: HMG-CoA Reductase Introduction: HMG-CoA Reductase is an enzyme in the cholesterol
Supplementary information. macrophages in foam cells
Supplementary information The Helicobacter cinaedi antigen CAIP participates in atherosclerotic inflammation by promoting the differentiation of macrophages in foam cells Mario Milco D Elios, Francesca
BMC Biology. Open Access. Abstract. BioMed Central
BMC Biology BioMed Central Research article A modular interface of IL-4 allows for scalable affinity without affecting specificity for the IL-4 receptor Michael Kraich 1, Markus Klein 1, Edwin Patiño 1,
Structural basis for dual inhibitory role of tamarind Kunitz inhibitor (TKI) against factor Xa and trypsin
Structural basis for dual inhibitory role of tamarind Kunitz inhibitor (TKI) against factor Xa and trypsin Dipak N. Patil, Anshul Chaudhary, Ashwani K. Sharma, Shailly Tomar and Pravindra Kumar Department
Final Report. Identification of Residue Mutations that Increase the Binding Affinity of LSTc to HA RBD. Wendy Fong ( 方美珍 ) CNIC; Beijing, China
Final Report Identification of Residue Mutations that Increase the Binding Affinity of LSTc to HA RBD Wendy Fong ( 方美珍 ) CNIC; Beijing, China Influenza s Viral Life Cycle 1. HA on virus binds to sialic
Structural Analysis of TCRpMHC Complexes Using Computational Tools. Feroze Mohideen Briarcliff High School
Structural Analysis of TCRpMHC Complexes Using Computational Tools Feroze Mohideen Briarcliff High School TCR-pMHC Complexes Peptide Structure of TCR-pMHC complex PDB AO7 Crossreactivity is the ability
STRUCTURE OF A UBIQUITIN-LOADED HECT LIGASE REVEALS THE MOLECULAR BASIS FOR CATALYTIC PRIMING SUPPLEMENTARY INFORMATION
STRUCTURE OF A UBIQUITINLOADED ECT LIGASE REVEALS TE MOLECULAR BASIS FOR CATALYTIC PRIMING Elena Maspero 1, Eleonora Valentini 1, Sara Mari 1, Valentina Cecatiello 2, Paolo Soffientini 1, Sebastiano Pasqualato
Amprenavir complexes with HIV-1 protease and its drug-resistant mutants altering hydrophobic clusters
Amprenavir complexes with HIV-1 protease and its drug-resistant mutants altering hydrophobic clusters Chen-Hsiang Shen 1, Yuan-Fang Wang 1, Andrey Y. Kovalevsky 1, *, Robert W. Harrison 1,2 and Irene T.
Crystal Structure of the Subtilisin Carlsberg: OMTKY3 Complex
John Clizer & Greg Ralph Crystal Structure of the Subtilisin Carlsberg: OMTKY3 Complex The turkey ovomucoid third domain (OMTKY3) is considered to be one of the most studied protein inhibitors. 1 Ovomucin
= (3) = (3) = (4) V = (4) Å 3 Z =2. Data collection. Refinement
organic compounds Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 = 95.181 (3) = 112.830 (3) = 106.243 (4) V = 948.7 (4) Å 3 Z =2 Mo K radiation = 0.07 mm 1 T = 298 (2) K 0.41
Copyright Mark Brandt, Ph.D. 46
Examples of tein Structures tein types teins fall into three general classes, based on their overall three-dimensional structure and on their functional role: fibrous, membrane, and globular. Fibrous proteins
1. Arresting cancer by energy starvation
1. Arresting cancer by energy starvation Cancer, a top killer, may be stopped from its deadly progression with the latest discovery by NUS researchers. They have found how a compound that is undergoing
Full wwpdb NMR Structure Validation Report
Full wwpdb NMR Structure Validation Report io Apr 14, 2018 10:51 PM EDT PDB ID : 2J0Z Title : p53 tetramerization domain wild type Authors : Carbajo, R.J.; Mora, P.; Sanchez del Pino, M.M.; Perez-Paya,
Protein Refinement in Discovery Studio 1.7. Presented by: Francisco Hernandez-Guzman, PhD
Protein Refinement in Discovery Studio 1.7 Presented by: Francisco Hernandez-Guzman, PhD February 2007 Agenda Part I: Protein Refinement in Discovery Studio 1.7 (20mins) The problem Novel Algorithms at
Bioinformation Volume 5
Identification of sequence mutations affecting hemagglutinin specificity to sialic acid receptor in influenza A virus subtypes Usman Sumo Friend Tambunan*, Ramdhan Department of Chemistry, Faculty of Mathematics