Detection and differentiation of Newcastle disease virus (avian paramyxovirus type 1)

Transcription

1 Avian Pathology ISSN: (Print) (Online) Journal homepage: Detection and differentiation of Newcastle disease virus (avian paramyxovirus type 1) E. W. Aldous & D. J. Alexander To cite this article: E. W. Aldous & D. J. Alexander (2001) Detection and differentiation of Newcastle disease virus (avian paramyxovirus type 1), Avian Pathology, 30:2, , DOI: / To link to this article: Published online: 17 Jun Submit your article to this journal Article views: 3238 View related articles Citing articles: 82 View citing articles Full Terms & Conditions of access and use can be found at

2 Avian Pathology (2001) 30, TECHNICAL REVIEW Detection and differentiation of Newcastle disease virus (avian paramyxovirus type 1) E. W. Aldous & D. J. Alexander* Avian Virology, VLA Weybridge, Addlestone, Surrey KT15 3NB, UK Substantial variation in the virulence of Newcastle disease virus (NDV) isolates means that the detection of NDV or evidence of infection is insufficient for an adequate diagnosis, as control measures for avirulent viruses are very different to those for virulent viruses. Diagnosis therefore requires further characterization, at least as to whether an isolate is virulent or avirulent. Conventional detection and differentiation of ND viruses is perceived as slow, laborious and requiring an undesirable use of in vivo techniques. In addition, further characterization is needed to give greater information on origin and spread. This review concentrates on the application of monoclonal antibody and molecular biological approaches. Panels of monoclonal antibodies were a major advance for the characterization of NDV isolates, although confirmation of virulence for poultry still required in vivo testing. As molecular-based techniques become easier and more reliable, they are likely to supersede the use of monoclonal antibodies, especially for characterizing viruses for epidemiological purposes. The attraction of molecular-based techniques is that they may be able to cover all three aspects of Newcastle disease diagnosis (detection of virus, characterization, including inference of virulence, and epidemiology) quickly, accurately and definitively in a single test. A number of approaches based on the reverse transcriptase polymerase chain reaction have been developed, with subsequent analysis of the product by restriction enzyme analysis, probe hybridization and nucleotide. Although extensive variation among NDVs still poses technical problems, the real and potential advantages of a molecular biological approach to Newcastle disease diagnosis appear to be overwhelming. Introduction Newcastle disease (ND) is regarded throughout the World as one of the two most important diseases of poultry and other birds, the other disease being highly pathogenic avian influenza. This is not only due to the devastation ND virus (NDV) infections may have on the birds infected, with flock mortality rates up to 100%, but also the economic impact that may ensue due to trading restrictions and embargoes placed on areas and countries where outbreaks have occurred. Because of the severe nature of the disease and the associated consequences, ND is included as an Office Internationale des Epizooties (OIE) list A disease (Office Internationale des Epizooties, 2001) and most countries, including all European Union countries, enforce statutory control measures in the event of outbreaks of disease (Council of the Economic Community, 1992). Nevertheless, ND is enzootic in some areas of the world and remains a constant threat to most birds reared domestically. Aetiology The three virus families Rhabdoviridae, Filoviridae and Paramyxoviridae form the order Mononegavirales, i.e. viruses with negative-sense, single-stranded, non-segmented, RNA genomes. ND is caused by avian paramyxovirus serotype 1 (APMV 1) viruses, which, with viruses of the other eight APMV serotypes (APMV 2 to APMV 9), have been placed in the genus Rubulavirus, sub-family Paramyxovirinae, family Paramyxoviridae, in the * To whom correspondence should be addressed. dalexander.vla@gtnet.go v.uk ISSN (print)/issn (online)/01/ Crown Copyright DOI: /

3 118 E. W. Aldous & D. J. Alexander current taxonomy (Rima et al., 1995). Recent work involving the of the whole NDV genome has suggested that avian paramyxoviruses are sufficiently different from other rubulaviruses to warrant placing them in a separate genus (de Leeuw & Peeters, 1999). The ND virus has a 15 kb RNA genome that codes for six viral proteins: an RNAdirected RNA polymerase (L), haemagglutininneuraminidase protein (HN), fusion protein (F), matrix protein (M), phosphoprotein (P) and nucleoprotein (NP). They are arranged in the order 39 -NP- P-M-F-HN-L 59 (Rima et al., 1995; Oberdörfer & Werner, 1998; de Leeuw & Peeters, 1999). The envelopes of rubulaviruses contain two functional surface glycoproteins, which appear as surface spikes by negative contrast electron microscopy. The HN glycoprotein is responsible for virus attachment to the cell surface receptors, which are ubiquitous sialic acid-containing macromolecules (Nagai, 1993). The F glycoprotein is responsible for fusion between the cellular and viral membranes, and subsequent virus genome penetration (Glickman et al., 1988). Epidemiology Over 250 species of birds have been reported to be susceptible to NDV as a result of natural or experimental infections, and it is likely that many more susceptible species exist but have not yet been identified (Alexander, 1997). It is generally accepted that the first outbreaks of ND occurred in 1926, in Indonesia and England, but since that time isolations of NDV have been made from all over the world from both wild and domestic species. An accurate assessment of the distribution of NDV throughout the world is difficult to achieve due to the widespread used of live vaccines. However, studies have concluded that ND remains present in many countries of Asia, Africa and the Americas, and only countries of Oceania have maintained relative free of the disease, although serious outbreaks occurred in Australia during (Kirkland, 2000; Westbury, 2001). Clinical signs Infections with ND viruses can lead to a broad range of clinical signs, varying from asymptomatic enteric infections to systemic infections causing 100% mortality. Using the clinical signs seen in experimental NDV infections of chickens, NDV strains have been divided into five groups (Beard & Hanson, 1984): 1. viscerotropic velogenic: highly virulent disease in which haemorrhagic lesions are characteristically present in the intestinal tract 2. neurotopic velogenic: high mortality following respiratory and nervous signs 3. mesogenic: respiratory and nervous signs, but usually with low mortality 4. lentogenic: a mild or inapparent infection of the respiratory tract 5. asymptomatic enteric: an inapparent intestinal infection. The capacity of the virus to cause such a wide variation in severity of disease has been attributed to a number of factors, including the host, age, health status, environmental conditions and other concurrent infections. Most importantly, variation in virulence means that the detection of NDV or evidence of infection is insufficient for an adequate diagnosis, as control measures for avirulent viruses are very different to those for virulent viruses. Diagnosis therefore requires further characterization of the virus, including differentiation at least into virulent or avirulent. The lack of pathognomonic clinical signs, even for infections with the most virulent viruses, means that some form of virulence assessment is necessary for any NDV isolated during any investigation. Conventional ND Diagnosis As a result of the variations in virulence and the lack of characteristic clinical signs, it is usually necessary for confirmed diagnosis to involve two steps: (i) isolation of the virus from affected birds and identification of the virus as NDV; and (ii) establishment of the virus as fulfilling a predetermined definition of ND that would distinguis h it from vaccine viruses or avirulent enzootic ND viruses. This latter step usually involves an in vivo estimation of pathogenicity for chickens such as the intracerebral pathogenicity index in 1-day-old chicks, the intravenous pathogenicity index in 6-week-old chickens or the mean death time in eggs (Alexander, 1988). Although conventional diagnosis has proven adequate for the control of ND in the past, it does present some problems. A source of eggs and chickens, which should preferably be from a specific pathogen free flock, is needed. Confirmed diagnosis may be slow, taking several days to isolate the virus and carry out the pathogenicity test. It assumes viruses always show their potential pathogenicity for chickens, which does not always appear to be the case (Collins et al., 1994). Identification of the virus as NDV and an estimate of its pathogenicity also give no information that would enable assessment of the source of the virus and its spread. In addition, the use of animals in this way is becoming increasingly unacceptable with the development of actual or potential alternatives. Molecular Basis for Pathogenicity When ND viruses replicate in an infected cell, particles are produced with an inactive precursor

4 Table 1. Amino acid sequences at the F0 cleavage site Detection and differentiation of NDV 119 Virus strain Virulence for chickens Cleavage site amino acids 111 to 119 Reference Herts 33 High -G-R-R-Q-R-R*F-I-G- Toyoda et al. (1989) Essex 70 High -G-R-R-Q-K-R*F-V-G- Collins et al. (1993) 135/93 High -V-R-R-K-K-R*F-I-G- Oberdörfer & Werner (1998) 617/83 High -G-G-R-Q-K-R*F-I-G- Collins et al. (1994) 34/90 High -G-K-R-Q-K-R*F-V-G- Collins et al. (1993) Beaudette C High -G-R-R-Q-K-R*F-I-G- Collins et al. (1993) La Sota Low -G-G-R-Q-G-R*L-I-G- Collins et al. (1993) D26 Low -G-G-K-Q-G-R*L-I-G- Toyoda et al. (1989) MC110 Low -G-E-R-Q-E-R*L-I-G- Collins et al. (1993) 1154/98 Low -G-R-R-Q-G-R*L-I-G- Alexander (2001) * Represents cleavage point. Basic amino acids are shown in bold. Note that all virulent viruses have phenylalanine (F) at position 117, the F1 N-terminus. fusion glycoprotein, F0. For this protein to be functional and virus particles to be infectious, the precursor has to be cleaved to two peptides, F1 and F2, which remain linked by a disulphide bond (Rott & Klenk, 1988). This post-translation cleavage is mediated by host cell proteases (Nagai et al., 1976a). Trypsin is capable of cleaving F0 for all NDV strains, and in vitro treatment of noninfectiou s virus will restore infectivity (Nagai et al., 1976b). Studies comparing the deduced amino acid sequences of the F0 precursor of ND viruses varying in virulence for chickens showed that viruses that are virulent for chickens had the amino acid sequence 112 R/K-R-Q-K/R-R 116 at the C-terminus of the F2 protein and F (phenylalanine) at residue 117, the N-terminus of the F1 protein, whereas the viruses of low virulence had sequences in the same region of 112 G/E-K/R-Q-G/E-R 116 and L (leucine) at residue 117 (Collins et al., 1993). Some of the pigeon variant viruses (PPMV 1) examined had the sequence 112 G-R-Q-K-R-F 117 but gave high intracerebral pathogenicity index (ICPI) values (Collins et al., 1993, 1994; Jestin & Cherbonnel, 1992). Thus, there appears to be the requirement of at least a pair of basic amino acids (arginine, R, or lysine, K) at residues 116 and 115, a phenylalanine at residue 117 and a basic amino acid (R) at 113 for the virus to show high virulence for chickens. Further studies have confirmed these findings, and the different amino acid sequences at the F0 cleavage site reported to date are summarized in Table 1. The major influence on the pathogenicit y of NDV is, therefore, the amino acid motif at the F0 cleavage site. The presence of additional basic amino acids in virulent strains means that cleavage can be affected by host enzyme(s) present in a wide range of host tissues and organs, i.e. the putative ubiquitous protease(s), which is almost certainly one or more proprotein-processing, subtilisinrelated endoprotease of which furin is the leading candidate. In contrast, for lentogenic viruses, F0 cleavage can occur only with proteases recognizing a single arginine, i.e. trypsin-like enzymes. Lentogenic viruses are therefore restricted to areas in the host where trypsin-like enzymes are present, such as the respiratory and intestinal tracts, whereas virulent viruses can replicate in a range of tissues and organs, resulting in a systemic infection (Rott, 1979). Definition of ND The variability in virulence of ND viruses for chickens and the almost universal use of live vaccines means that, if strict control measures and trade embargoes are to be applied when outbreaks occur, careful definition of what constitutes virus to which such control measures apply is needed. The definition of the Office International des Epizooties (2001) reflects the current understanding of the molecular basis for virulence: Newcastle disease is defined as an infection of birds caused by a virus of avian paramyxovirus serotype 1 (APMV 1) that meets one of the following criteria for virulence: (a) The virus has an intracerebral pathogenicity index (ICPI) in day-old chicks (Gallus gallus) of 0.7 or greater. or (b) Multiple basic amino acids have been demonstrated in the virus (either directly or by deduction) at the C-terminus of the F2 protein and phenylalanine at residue 117, which is the N-terminus of the F1 protein. The term multiple basic amino acids refers to at least three arginine or lysine residues between residues 113 to 116. Failure to demonstrate the characteristic pattern of amino acid

5 120 E. W. Aldous & D. J. Alexander residues as described above would require characterisation of the isolated virus by an ICPI test. In this definition, amino acid residues are numbered from the N-terminus of the amino acid sequence deduced from the nucleotide sequence of the F0 gene, corresponds to residues 4 to 1 from the cleavage site. Application of New Technologies in the Diagnosis of ND Use of monoclonal antibodies in the diagnosis of ND One of the first attempts to improve diagnosis and differentiation of ND viruses was the use of monoclonal antibodies (mabs) to aid identificatio n and the epidemiology of the virus. Using conventional serological techniques, NDV strains had been considered to form an antigenically homogeneous group. This meant that diagnosis usually resulted in little information relating to the source or the spread of the virus involved. In an effort to group, differentiate and trace strains of NDV, many different approaches had been used based on various biological and chemical properties of different viruses, but such approaches had produced only limited success. mabs may detect slight variations in antigenicity, such as single amino acid changes at the epitope to which the antibody is directed. The use of mab technology provided a new approach to antigenic differentiation of NDV strains and isolates, and several groups developed mabs against NDV strains, primarily for diagnostic purposes (Hoshi et al., 1983; Nishikawa et al., 1983; Russell & Alexander, 1983; Alexander et al., 1985a, 1987; Ishida et al., 1985; Abenes et al., 1986; Srinivasappa et al., 1986; Erdei et al., 1987; Meulemans et al., 1987; Lana et al., 1988; Jestin et al., 1989). mabs to NDV have been effective in the following areas. Differentiation of APMV 1 viruses from other paramyxovirus serotypes Polyclonal antisera may detect quite high crossreactivity between different paramyxovirus serotypes and NDV in serological tests, and this may sometimes interfere with identification of the virus. Specific mabs have been used to overcome this problem. Most mabs that react in serological tests such as the haemagglutination inhibitio n tests are not directed to epitopes that are conserved in all NDV isolates. Meulemans et al. (1987) used mixtures of mabs with different specificities for ND viruses to overcome this problem. Identification of specific viruses Some workers have used mabs to distinguis h between specific viruses. For example, two groups have described mabs that distinguish between the common vaccine strains, Hitchner B1 and La Sota (Erdei et al., 1987; Meulemans et al., 1987), while other mabs can separate vaccine viruses from epizootic virus in a given area (Srinivasappa et al., 1986). mab typing was also used to establish the uniqueness of the variant NDV (PPMV 1) responsible for the pigeon panzootic and has proven particularly useful in identifying the spread of this virus around the world (Alexander et al., 1985a, 1987; Pearson et al., 1987). During the epizootic of NDV in Great Britain in 1984, rapid identificatio n of the virus as PPMV 1 enabled early tracing of the source of disease to contaminated feed ingredients, and subsequent control (Alexander et al., 1985b). Similarly, use of mabs allowed outbreaks recorded on the island of Ireland in 1991 and 1992 to be rapidly identified as being caused by PPMV 1 infections, as a result of food stores contaminated by infected feral pigeons (O Reilly et al., 1994). mabs were also used to produce strong evidence that the single outbreak in pheasants in Great Britain in 1996 was the result of spread from infected pigeons and doves (Alexander et al., 1997a). Use in epidemiological studies In a large study of over 1500 viruses, Alexander et al. (1997b) used the ability of viruses to react with panels of mabs, consisting initially of nine mabs and later extended to 26 mabs, to place strains and isolates of NDV into groups on the basis of their ability to react with the different mabs. Viruses in the same mab group shared biological and epizootiological properties. Use of such panels, particularly the extended panel, has indicated that viruses tend to remain fairly well conserved during outbreaks or epizootics, and this often allows valuable assumptions to be made concerning the source and the spread of ND. Molecular-Based Techniques As already discussed, there are three main areas in ND diagnosis: (a) detection of virus; (b) characterization of the virus; and (c) epidemiology. The first two of these are required in the definition of disease, but an understanding of the origins of the virus and the probable method by which it was introduced and spread are invaluable tools for the control of the disease. If this can be assessed with precision by relatively simple characterization of the virus and grouping it with or differentiating it from other ND viruses, this would represent a major advancement of conventional diagnostic techni-

6 d d Detection and differentiation of NDV 121 ques. As already indicated, the use of mabs has been a practical advance in this latter aspect of diagnosis, as well as confirming the identity of ND isolates and giving a guide to virulence. The attraction of molecular-based techniques is that they may be able to cover all three aspects of ND diagnosis quickly, accurately and definitively in a single test. Since ND viruses have an RNA genome, reverse transcription polymerase chain reaction (RT-PCR) is the starting point for most of the techniques used to detect and differentiate viruses. Using a reverse transcriptase, the RNA genome is transcribed into a DNA copy, which can be used as the template in PCR. Amplification of a specific gene region has been achieved using: (i) universal primers (Jestin & Jestin, 1991; Jestin & Cherbonnel, 1992; Gohm et al., 2000); (ii) pathotype specific primers (Kant et al., 1997); or (iii) nested PCR (Jestin et al., 1994; Kant et al., 1997; Kou et al., 1999; Kho et al., 2000). Further studies have been carried out using the generated PCR product, including: restriction enzyme analysis (Wehmann et al., 1997; Ballagi Pordany et al., 1996; Kou et al., 1999; Nanthakumar et al., 2000) d probe hybridization (Jarecki Black et al., 1992; Jarecki Black & King, 1993; Radhavan et al., 1998; Oberdörfer & Werner, 1998; Aldous et al., 2001) nucleotide for cleavage site analysis and epidemiological studies (Toyoda et al., 1989; Collins et al., 1993, 1994; Stauber et al., 1995; Seal et al., 1995, 1998; Marin et al., 1996; Heckert et al., 1996; King & Seal, 1997). Thus, RT-PCR has been used for the detection, identification and characterization of NDV either alone or followed by further molecular evaluation to give additional information on the characterization of the virus. The primers used in many of the published studies are listed in Table 2. RT-PCR for the detection and identification of virus Jestin & Jestin (1991) developed the first RT-PCR for the identification of NDV. The authors used universal primers to amplify a 238 base pair (bp) section of the F gene and reported positive results for 30 different isolates tested, which were confirmed by restriction enzyme digestion. The viruses were grown in fowl eggs and the viral RNA was extracted from the infective allantoic fluid. The reaction was considered to be highly specific since there was no reaction with other avian viruses. More recently, the possibility of detecting NDV in tissues and faeces samples using RT-PCR has been investigated by Gohm et al. (2000). These authors addressed a point that seems lacking from many of the other methods discussed in this paper, i.e. the direct use of virus-infected tissues rather than egg-grown virus samples. This is an important consideration since, as long as molecular techniques still require egg-grown virus as template, the benefits of the speed and in vitro requirements of molecular techniques are being abrogated. The authors reported the development of a RT-PCR system for the detection of NDV in infected tissues and faeces, and described a time-course study to determine the sensitivity of their technique. A 182 bp region of the F gene including the cleavage activation site was amplified using universal primers. Gohm et al. concluded that the system could be used to detect NDV in tissue and faecal samples of experimentally and in-contact infected chickens. Despite the success of the system, it is worth noting that, due to the tissue tropisms of the different virus strains, tissue samples need to be taken from a range of organs since no one organ was always positive. It has been documented (Wilde et al., 1990) that many tissue and swab samples contain inhibitors of PCR, particularly blood and faeces, so it is essential to ensure that the method of RNA extraction deactivates these. The potential for false negatives due to random mutation in the area of the genome under study, resulting in loss of primer compatibility, is also a problem, but can be overcome in part by the use of more than one set of primers. The authors mention the potential of this system to be used for epidemiological purposes in the sampling of wild bird populations. Gohm et al. (2000) also recorded provisional results of endonuclease digestion of the product with Alu 1 that indicated this may facilitate the differentiation of field strains from vaccine strains. While the goal of the development of molecular based tests is to achieve a simpler, more reliable, rapid test, it is essential that this is combined with maximum operator safety. In many of the techniques reviewed in this paper, separation and visualization of the PCR products is carried out by agarose gel electrophoresis stained with ethidium bromide. Not only is this technique not well suited to routine analysis of many samples, but it also uses a mutagenic compound. Kho et al. (2000) reported a RT-nested PCR enzyme-linked immunosorbent assay technique for rapid and sensitive NDV detection that used a colorimetric detection system of the product rather than electrophoretic techniques, thus avoiding the more hazardous aspects of post-pcr analysis. The technique has been developed to work directly on tissue samples, amplifying 532 and 280 bp sections of the F gene. The authors calculated their method of PCR product detection to be 10-fold more sensitive than electrophoresis, and they claimed the nested PCR to be 100-fold more sensitive than the standard PCR. The detection threshold of this system was found to be 10 to 100 fg viral RNA. The system utilizes universal primers to detect all strains, but cannot differentiate

7 122 E. W. Aldous & D. J. Alexander Table 2. Primers and probes used in Newcastle disease virus detection and differentiation Used in Gene Product size (bp) Sequence (59 to 39 ) a Reference RT-PCR Fusion (F) 238 CTT TGC TCA CCC CCC TTG G Jestin & Jestin (1991) CTT CCC AAC TGC CAC TGC Probe Fusion (F) ACG GGT AGA AGA TTC TGG ATC CCG GTT GGC Jarecki Black et al. (1992) Probe Fusion (F) Not given in paper Jarecki Black & King (1993) RT-PCR and RT-PCR and Fusion (F) 304 TAC ACC TCA TCC CAG ACA GG AGT CGG AGG ATG TTG GCA GC Fusion (F) ~300 ATG CCC AAA GAC AAA GAG CAA TAC TGC TGT CGC TAC ACC TAA Collins et al. (1993) RT-nPCR and RT-nPCR and Fusion (F) 175 ACA CCT CAT CCC AGA CAG TCT TCC CAA CTG CCA CTG Fusion (F) CTT TGC TCA CCC CCC TTG G GCA TTT TGT TTG GCT TGT A Jestin et al. (1994) Sequencing Fusion (F) AAA GCC CCA TTG GAA GCA T Collins et al. (1994) RT-PCR HN ATA TCC CGC AGT CGC ATA AC TTT TTC TTA ATC AAG (TAG) GAC T Sequencing HN GCA TTG CAG AAA TAT CCA ATA RT-PCR Fusion (F) 310 GGA GGA TGT TGG CAG CAT T GTC AAC ATA TAC ACC TCA TC Stäuber et al. (1995) RT-PCR and Fusion (F) CCT TGG TGA ITC TAT CCG IAG CTG CCA CTG CTA GTT GIG ATA ATC C Seal et al. (1995) RT-PCR and Matrix (M) TCG AGI CTG TAC AAT CTT GC GTC CGA GCA CAT CAC TGA GC RT-PCR Fusion (F) 254 CCT TGG TGA ITC TAT CCG IAG G CTG CCA CTG CTA GTT GIG ATA TAC C Marin et al. (1996) RT-PCR and RT-PCR and Fusion (F) 507 TTA GAA AAA ACA CGG GTA GAA AGT CGG AGG ATG TTG GCA GC Fusion (F) GCT TTA TCT CCT GTT ACC ACA AT CAG AAC ACT GAC CAC TTT ACT CAC Heckert et al. (1996) RT-PCR Fusion (F) 1349 TGA CTC TAT CCG TAG GAT ACA AGA GTC TG GAT CTA GGG TAT TAT TCC CAA GCC A RT-PCR Matrix (M) 1097 TCT AGG ACA ATT GGG CTG TAC TTT GAT T AGA GAC GCA GCT TAT TTC TTA AAA GGA TTG Ballagi Pordány et al. (1996) Wehmann et al. (1997) RT-hnPCR Fusion (F) 362 (AB) TTG ATG GCA GGC CTC TTG C Kant et al. (1997) 362 (AB) GGA GGA TGT TGG CAG CAT T RT-hnPCR Fusion (F) 254 (AC) AGC GT C / T TCT GTC TCC T 254 (AD) G A / G C G A / T C CCT GT C / T TCC C Probe Fusion (F) Probe TAC AAC AGG ACA C / T TG AC C / T ACT TTG CTC ACC CCC CTT GGT GA Probe Fusion (F) Probe TAT AAC AGA ACA CTG ACT ACC TTG CTC ACT CCC CTT GGC GA

8 Detection and differentiation of NDV 123 Table 2. (continued) Used in Gene Product size (bp) Sequence (59 to 39 ) a Reference RT-PCR Fusion (F) 362 TTG ATG GCA GGC CTC TTG C GGA GGA TGT TGG CAG CAT T Oberdörfer & Werner (1998) Probe Fusion (F) Probe TCC ACG CCT GGG GGA AGG AGA CAG AAA Probe Fusion (F) Probe TCC ACA TCA GGA GTA AGG AGG AAG AAG Probe Fusion (F) Probe ACT ACA TCT GGA GGG GGG AGA CAG GGG RT-PCR Fusion (F) 1349 CGA TTC CAT CCG CAA GAT CCA AGG GTC TG GAT CTA GGG TAT TAT TCC CAA GCC A Kou et al. (1999) RT-nPCR Fusion (F) GCC TTA ACT CAG TTG ACT ATC CAG GC CAA GCA ATA AAT GCC CGG Sequencing Fusion (F) ATA TGG GCT CCG AAC CTT CTA CCA GGG Sequencing Fusion (F) TTT ATA CAG TCC AAT TCT CGC GCC G Sequencing Fusion (F) TAA TAC AAG CCA ACC AGA ATG CCG CC Sequencing Fusion (F) GCT CAA GCA GGA ATA AAT GCC CGG Sequencing Fusion (F) GGG CAC CTA AAT AAT ATG CGT GCC Sequencing Fusion (F) TCG CTC TTT GGT TGC TTG TAC CC RT-PCR Fusion (F) 356 GCA GCT GCA GGG ATT GTG GT TCT TTG AGC AGG AGG ATG TTG Nanthakumar et al. (2000) RT-PCR Fusion (F) 216 CCC CGT TGG AGG CAT AC TGT TGG CAG CAT TTT GAT TG RT-nPCR PCR ELISA RT-nPCR PCR ELISA Fusion (F) 532 TAC ACC TCA TCC CAG ACA GGG TC AGG CAG GGG AAG TGA TTT GTG GC Fusion (F) 280 B a -TAC TTT GCT CAC CCC CCT T D a -CAT CTT CCC AAC TGC CAC T Kho et al. (2000) RT-PCR Fusion (F) 182 CGI AGG ATA-CAA GRG TCT G GCR GCA ATG CTC TYT TTA AG Gohm et al. (2000) RT-PCR Fusion (F) ~700 GACCGCTGACCACGAGGT TA Aldous et al. (2001) Fusion (F) GCAGCATTCTGGTTGGCTTG TATCA Fusion (F) GGCAGCATTTTGTTTGGCTTG TATC Probe Fusion (F) AA GCG TTT CTG TCT CCT TCC TCC G Probe Fusion (F) AG ACG TCC CTG TTT CCC TCC TCC Probe Fusion (F) AA ACG TTT CTG TCT CCT TCC TCC GG Probe Fusion (F) AA ACG TCT CTG TCT CCT TCC TCC GG Probe Fusion (F) AA GCG TTT CTG CCT CCC TCC TCC Probe Fusion (F) CC TAT AAG GCG CCC CTG TCT CCC RT-PCR, Reverse transcription polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; n, nested; hn, hemi-nested; HN, haemagglutinin-neuraminidase protein. a B, Biotin label; D, digoxigenin label.

9 124 E. W. Aldous & D. J. Alexander them. A benefit of this system is the potential for it to be automated and the possibility of it being semiquantitative. Use of probes to detect and identify ND virus Jarecki Black et al. (1992) reported a universal radiolabelled oligonucleotide probe for the detection of NDV. A 30 bp oligonucleotide DNA probe was tested against 14 isolates of NDV in a slotblot hybridization assay, to differentiate NDV from other common poultry viral pathogens. The probe was derived from the 59 non-coding region of the NDV F gene, and the test carried out directly on purified viral RNA. The sensitivity of the reaction was determined, and ND virus could be detected down to a concentration of 0.25 to 0.5 m g viral RNA. No hybridization occurred with other common avian viruses. Two sources of viral RNA were used: direct from infected tissue, and egg-grown virus. The authors mention that a limitation of this technique is its inability to differentiate between vaccinated flocks and those infected naturally. RT-PCR for the identification and characterization of ND virus The first report of a molecular technique capable of identifying and characterizing NDV was by Jestin et al. (1994). They described a nested RT-PCR technique that could be used to amplify a section of the F0 gene, including the region coding for the cleavage activation site, directly from infected tissues of experimentally and field infected birds. The authors highlighted the sensitivity of nested PCR, but also its increased potential for contamination. They determined the nucleotide sequence of the product, and used this information to assess virus virulence. They considered the minimum time taken to acquire the nucleotide sequence was 5 days. Kant et al. (1997) used a hemi-nested RT-PCR for the detection and subsequent differentiation of NDV isolates. The system was based on two universal primers in the first PCR, and then the same forward primer and two pathotype-specifi c reverse primers in the second PCR. Detection was achieved in the first PCR with the universal primers, and the pathotype determined in the second PCR by identifying which of the reverse primers bound. The universal primers amplified a 362 bp region of the F gene including the F-gene cleavage site the region against which the two pathotype-specific primers were designed to hybridize. The PCR products were separated and visualized in ethidium bromide stained agarose gels. The test could be carried out directly on tissue homogenates and could be completed within 1 day. The test did not detect some of the avirulent virus infections and the authors attributed this to the level of virus in the tissues being below the test detection threshold. The authors also reported that the test did not work with the PPMV 1 virus responsible for the continuing pigeon panzootic and some viruses isolated from waterfowl. Use of probes that identify and characterize ND viruses Following their initial investigation using probes for the detection of NDV, Jarecki Black & King (1993) reported a radiolabelled oligonucleotid e probe for distinguishing virulent viruses from avirulent. The probe was designed to complement the cleavage activation site of the fusion protein gene of the Texas GB strain of NDV. The RNA was extracted from allantoic fluid and purified. In the study, the authors examined 36 isolates; the probe hybridized with all virulent isolates tested, and did not react with any of low virulence. No crossreactivity was seen between the probe and other common avian viruses. Oberdörfer & Werner (1998) also reported a technique for the detection and differentiation of NDV using probes. The aim of their study was to develop a fast screening method for a large number of NDV samples. The RNA was extracted from infective allantoic fluid, and amplified by RT-PCR. The primers were used to amplify a 362 bp region of the F gene including the cleavage activation site. This PCR product was then used as template for pathotype-specific probes to bind to. The probes were labelled with digoxygenin (DIG) and the labelled products were detected using an anti-digalkaline phosphatase conjugate in an immunoassay. Although they used universal primers resulting in an amplification product from all isolates tested, the authors recognized the potential problems associated with false negatives due to genome variability preventing primers binding, but discussed the possibility of designing new primers to hybridize with new subtypes as they arise In the study by Aldous et al. (2001), a panel of six TaqMan fluorogenic probes designed to hybridize to a number of different F-gene cleavage site nucleotide sequences was used. In this system, RNA is extracted from infective allantoic fluids and used as the template for the RT-PCR. The probes are included in the RT-PCR reaction and there is no post-pcr manipulation, minimizing the risk of contamination. The authors reported that the panel of probes could differentiate avirulent and virulent viruses rapidly and accurately. In addition, an important finding was that the test could identify both components in mixtures of virulent and avirulent ND viruses. They too recognized the limitations with regard to compensating for genome variations, but also concluded that this could be overcome by the addition of new probes to the existing panel.

10 Detection and differentiation of NDV 125 Restriction enzyme analysis Restriction enzyme analysis of various parts of the NDV genome has been completed by a number of groups. The aim of these analyses can be for differentiation (Wehmann et al., 1997; Nanthakumar et al., 2000), but they have been used more commonly for epidemiological purposes (Ballagi Pordany et al., 1996; Kou et al., 1999). Wehmann et al. (1997) reported the rapid identification of La Sota and B1 by restriction analysis of the matrix gene. Using nine B1 and 13 La Sota vaccines from different sources, the authors created a characteristic cleavage map for both strains. They concluded that using the enzymes, Mbo1 and Hinf1, restriction analysis of the matrix gene allowed rapid and reliable differentiation of the two closely related lentogenic vaccine strains. Nanthakumar et al. (2000) reported a system for pathotyping eight Indian NDV isolates into low, moderately high, and high virulence using restriction enzymes Bgl1 and Hha1 on a 356 bp region of the F gene, which included the cleavage site coding sequence. These authors used nested PCR and electrophoresis to confirm the result of the initial PCR. They reported that this system could be used to detect NDV directly from infected tissues Nucleotide In recent years, developments in the enzymes and equipment available for nucleotide have transformed it from a laborious and complex technique to one that is almost fully automated. In addition, the use of the deduced amino acids at the F0 cleavage site as a prediction of virulence has been accepted and incorporated into ND definitions. These facts have led to both an increasing number of groups using nucleotide as their research tool and, following the early work by Collins et al. (1993), others have used nucleotide as a tool for pathotyping viruses (Jestin et al., 1994; Collins et al., 1994; Seal et al., 1995; Marin et al., 1996; King & Seal, 1997). Stauber et al. (1995) reported direct of NDV cdna for NDV detection. In this study, the authors used RT-PCR and to screen vaccine preparations for the presence of NDV. The system could detect median embryo infective dose (EID 50 ) in live vaccine preparations and 10 5 EID 50 or 0.56 haemagglutinating units of NDV in inactivated virus preparations. The RT- PCR amplified a 310 bp region of the F0 gene including the cleavage site. The authors concluded that this system could be used to screen poultry vaccines and remove the requirement for the current methods of indirect in vivo assays. They further discussed the limitation of the test due to its inability to detect virus if there were variations in the relevant area of the viral genome, and the fact that the technique is not quantitative and the amount of virus present could not be identified. Seal et al. (1995) used degenerate oligonucleotide primers for the amplification of sections of the matrix gene and the fusion gene, including the cleavage site encoding region. Following phylogenetic analysis of the aligned sequences, it was possible to group the viruses for epidemiologica l studies and predict the pathotype of each virus reliably. Marin et al. (1996) used both traditional and molecular systems for the identification of nine NDV field isolates from the US. Results of the traditional methods corresponded well with the molecular techniques and they concluded that all the isolates were B1 type although not 100% identical in sequence. This highlights the point that using traditional methods they would all be classed as the same, but using RT-PCR and they were able to identify minor genetic heterogeneity in the lentogenic field strains. This may well be of considerable significance as the recent problems in Australia have suggested that virulent viruses emerged from pools of endemic viruses of low virulence (Kirkland, 2000; Westbury, 2001). Some viruses of low virulence may therefore represent a much greater risk than others, as they require fewer point mutations for this to occur (Alexander, 2001). King & Seal (1997) used biological and molecular characterization for NDV surveillance. They amplified the nuclear localization signal region of the F gene. Using this sequence data, phylogeneti c studies of these and published sequences revealed that the lentogenic strains separated from the virulent strains into different lineages. The phylogenetic characterization corresponded well with the biological one. Phylogenetics and epidemiology Development of improved techniques for nucleotide, the availability of sequence data of more ND viruses placed in computer databases, and the demonstration that even relatively short sequence lengths could give meaningful results in phylogenetic analyses have led to a marked increase in such studies in recent years. Considerable genetic diversity has been detected but viruses sharing temporal, geographical, antigenic or epidemiological parameters tend to fall into specific lineages or clades, and this has proven valuable in assessing both the global epidemiology and local spread of ND (Seal et al., 1995, 1998; Heckert et al., 1996; King & Seal, 1997, 1998; Lomniczi et al., 1997; Yang et al., 1997; Collins et al., 1998; Seal et al., 1998; Takakuwa et al., 1998; Alexander, et al., 1999; Herczeg et al., 1999). As sequence databanks increase in size and and phylogeneti c analyses become easier, it seems highly likely that primary diagnosis will include some epidemiological assessment of the infecting virus based on its genetic relationships to other viruses.

11 126 E. W. Aldous & D. J. Alexander Conclusions Conventional detection and differentiation of ND viruses is perceived as slow, laborious and requiring an undesirable use of in vivo techniques. In addition, there has long been a need to further characterize ND viruses isolated during diagnosis to give greater information on their origins and spread. mabs are capable of detecting minute antigenic differences in viruses and, for some years, use of individual or panels of mabs has proven valuable in confirming the identity of viruses and allowing distinction and grouping of NDV isolates. However, such techniques could only give a guide to virulence and, although strong predictions could be made (Alexander et al., 1997b), confirmation of virulence for poultry still required in vivo testing. As molecular-based techniques become easier and more reliable, they are likely to supersede the use of mabs, especially for characterizing viruses for epidemiological purposes. Nevertheless, where used to confirm NDV and to distinguish specific viruses, such as PPMV 1 or certain vaccine viruses, it seems likely that mabs will continue to have a use as a quick and simple method of making these differentiations. The identification and understanding of the molecular basis of pathogenicity of ND indicated a way forward in fulfilling the requirements of new methods for detection and characterization of ND viruses. With the adoption of the new OIE definition (Office International des Epizooties, 2001), molecular-based techniques for the assessment of virulence became fully integrated into the diagnosis of ND. The common aims of all of the studies reviewed in the present paper were to improve the speed, reliability and sensitivity of the diagnosis of ND, some with the added value of additional information useful for epidemiology. All the techniques reviewed in this paper require nucleic acid hybridization in some form for the reaction to proceed. RNA viruses like NDV are well known for their genome variability, and the spontaneous occurrence of random mutations. These two facts highlight a major weakness/ limitation in this technology; if a variation or mutation occurred in the primer or probe hybridization region, the reaction could fail and a false negative would be recorded. Attempts to overcome this problem have usually involved using more than one primer combination or degenerate primers. For example, Aldous et al. (2001) used six probes, but were still unable to identify 2/45 of the viruses examined, which had been selected for nucleotide heterogeneity in the relevant region. It is also possible to alter reaction conditions so that less specific binding occurs, but obviously this may compromise the specificity of the reaction. The genomic variation of ND viruses is also important in the case of mixed infections. Birds are frequently infected with more than one strain of ND, primarily due to the use of live vaccines, and these may even be isolated and cultivated together in eggs. Again, preferential binding of probes or primers to the vaccine virus could give a falsenegative result. Despite these drawbacks, the real and potential advantages of a molecular biological approach to ND diagnosis appear to be overwhelming. Techniques applied directly to infected tissues could result in the identification of NDV and some assessment of virulence within hours of sample receipt. In addition, those methods that employ may, through phylogenetic studies, give invaluable data for tracing the origins and spread of ND viruses or recognize a greater potential to mutate to virulence, within relatively few hours more. At present, it seems likely that virus isolation will remain desirable so that the virus may be archived and returned to at a later date but, in a widespread epidemic, only a limited number of virus isolations may be necessary for these purposes. Nevertheless, as molecular techniques are refined and techniques that enable further automation are developed, it seems inevitable that in the very near future these will become the dominant method for NDV detection, differentiation and characterization, with the conventional diagnosis used only as a back-up. References Abenes, G.B., Kida, H. & Yanagawa. R. (1986). Biological activities of monoclonal antibodies to the hemagglutinin-neuraminidase (HN) protein of Newcastle disease virus. Japanese Journal of Veterinary Science, 48, Aldous, E.W., Collins, M.S., McGoldrick, A. & Alexander, D.J. (2001). Rapid pathotyping of Newcastle disease virus (NDV) using fluorogenic probes in a PCR assay. Veterinary Microbiology (in press). Alexander, D.J. (1988). Newcastle disease diagnosis. In D.J. Alexander (Ed.), Newcastle Disease (pp ). Boston: Kluwer Academic Publishers. Alexander, D.J. (1997). Newcastle disease and other avian Paramyxoviridae infections. In B.W. Calnek, H.J. Barnes, C.W. Beard, L.R. McDougald & Y.M. Saif (Eds.), Diseases of Poultry 10th edn (pp ). Ames: Iowa State University Press. Alexander, D.J. (2001). Newcastle disease The Gordon Memorial Lecture. British Poultry Science (in press). Alexander, D.J., Russell, P.H., Parsons, G., Abu Elzein, E.M.E., Ballough, A., Cernik, K., Engstrom, B., Fevereiro, M., Fleury, H.J.A., Guittet, M., Kaleta, E.F., Kihm, U., Kosters, J., Lomniczi, B., Meister, J., Meulemans, G., Nerome, K., Petek, M., Pokomunski, S., Polten, B., Prip, M., Richter, R., Saghy, E., Samberg, Y., Spanoghe, L. & Tumova, B. (1985a). Antigenic and biological characterisation of avian paramyxovirus type 1 isolates from pigeons an international collaborative study. Avian Pathology, 14, Alexander, D.J., Wilson, G.W.C., Russell, P.H., Lister, S.A. & Parsons, G. (1985b). Newcastle disease outbreaks in fowl in Great Britain during Veterinary Record, 117, Alexander, D.J., Manvell, R.J., Kemp, P.A., Parsons, G., Collins, M.S., Brockman, S., Russell, P.H. & Lister, S.A. (1987). Use of monoclonal antibodies in the characterisation of avian paramyxovirus type 1 (Newcastle disease virus) isolates submitted to an international reference laboratory. Avian Pathology, 16, Alexander, D.J., Manvell, R.J., Frost, K.M., Pollitt, W.J., Welchman, D. & Perry, K. (1997a). An outbreak of Newcastle disease in pheasants in Great Britain in May Veterinary Record, 140,

12 Detection and differentiation of NDV 127 Alexander, D.J., Manvell, R.J., Lowings, J.P., Frost, K.M., Collins, M.S., Russell, P.H. & Smith, J.E. (1997b). Antigenic diversity and similarities detected in avian paramyxovirus type 1 (Newcastle disease virus) isolates using monoclonal antibodies. Avian Pathology, 26, Alexander, D.J., Banks, J., Collins, M.S., Manvell, R.J., Frost, K.M., Speidel, E.C. & Aldous, E.W. (1999). Antigenic and genetic characterisation of Newcastle disease viruses isolated from outbreaks in domestic fowl and turkeys in Great Britain during Veterinary Record, 145, Ballagi Pordany, A., Wehmann, E., Herczeg, J., Belak, S. & Lomniczi, B. (1996). Identification and grouping of Newcastle disease virus strains by restriction site analysis of a region from the F gene. Archives of Virology, 141, Beard, C.W. & Hanson, R.P. (1984). Newcastle disease. In M.S. Hofstad, H.J. Barnes, B.W. Calnek, W.M. Reid & H.W. Yoder (Eds.), Diseases of Poultry 8th edn (pp ). Ames: Iowa State University Press. Council of the Economic Community (1992). Council Directive 92/66/EEC of 14 July 1992 introducing Community measures for the control of Newcastle disease. Official Journal of the European Communities, L260, Collins, M.S., Bashiruddin, J.B. & Alexander, D.J. (1993). Deduced amino acid sequences at the fusion protein cleavage site of Newcastle disease viruses showing variation in antigenicity and pathogenicity. Archives of Virology, 128, Collins, M.S., Strong, I. & Alexander, D.J. (1994). Evaluation of the molecular basis of pathogenicity of the variant Newcastle disease viruses termed pigeon PMV 1 viruses. Archives of Virology, 134, Collins, M.S., Franklin, S., Strong, I, Meulemans, G. & Alexander, D.J. (1998). Antigenic and phylogenetic studies on a variant Newcastle disease virus using anti-fusion protein monoclonal antibodies and partial of the fusion protein gene. Avian Pathology, 27, de Leeuw, O. & Peeters, B. (1999). Complete nucleotide sequence of Newcastle disease virus: evidence for the existence of a new genus within the subfamily Paramyxovirinae. Journal of General Virology, 80, Erdei, J., Erdei, J., Bachir, K., Kaleta, E.F., Shortridge, K.F. & Lomniczi, B. (1987). Newcastle disease vaccine (La Sota) strain specific monoclonal antibody. Archives of Virology, 96, Glickman, R.L., Syddall, R.J., Iorio, R.M., Sheehan, J.P. & Bratt, M.A. (1988). Quantitative basic residue requirements in the cleavageactivation site of the fusion glycoprotein as a determinant of virulence for Newcastle disease virus. Journal of Virology, 62, Gohm, D.S., Thur, B. & Hofmann, M.A. (2000). Detection of Newcastle disease virus in organs and faeces of experimentally infected chickens using RT-PCR. Avian Pathology, 29, Heckert, R.A., Collins, M.S., Manvell, R.J., Strong, I., Pearson, J.E. & Alexander, D.J. (1996). Comparison of Newcastle disease viruses isolated from cormorants in Canada and the USA in 1975, 1990 and Canadian Journal of Veterinary Research, 60, Herczeg, J., Wehmann, E., Bragg, R.R., Travassos Dias, P.M., Hadjiev, G., Werner, O. & Lomniczi, B. (1999). Two novel genetic groups (VIIb and VIII) responisble for recent Newcastle disease outbreaks in South Africa, one (VIIb) of which reached Southern Europe. Archives of Virology, 144, Hoshi, S., Mikami, T., Nagata, K., Onuma, M. & IzawA, H. (1983). Monoclonal antibodies against a paramyxovirus isolated from Japanese sparrow-hawks (Accipter virugatus gularis). Archives of Virology, 76, Ishida, M., Nerome, K., Matsumoto, M., Mikami, T. & Oye, A. (1985). Characterisation of reference strains of Newcastle disease virus (NDV) and NDV-like isolates by monoclonal antibodies to HN subunits. Archives of Virology, 85, Jarecki Black, J.C. & King, D.J. (1993). An oligonucleotide probe that distinguishes isolates of low virulence from the more pathogenic strains of Newcastle disease virus. Avian Diseases, 37, Jarecki Black, J.C., Bennett, J.D. & Palmieri, S. (1992). A novel oligonucleotide probe for the detection of Newcastle disease virus. Avian Diseases, 36, Jestin, V. & Cherbonnel, M. (1992). Use of monoclonal antibodies and gene amplification (PCR) for characterisation of a-pmv 1 strains. Proceedings CEC Workshop on Avian Paramyxoviruses, Rauischholhausen, 1992 (pp ). Institut Geflugelkrankheiten, Giessen. Jestin, V. & Jestin, A. (1991). Detection of Newcastle disease virus RNA in infected allantoic fluids by in vitro enzymatic amplification (PCR). Archives of Virology, 118, Jestin, V., Cherbonnel, M., Morin, M., Guittet, M. & Bennejean, G. (1989). Characterisation of French avian paramyxovirus type 1 (PMV 1) isolates with a panel of monoclonal antibodies to the Ploufragan strain of Newcastle disease virus. Archives of Virology, 105, Jestin, V., Cherbonnel, M. & Arnauld, C. (1994). Direct identification and characterization of A-PMV1 from suspicious organs by nested PCR and automated. Proceedings of the Joint First Annual Meetings of the National Newcastle Disease and Avian Influenza Laboratories of the European Communities, 1993 (pp ). Brussels, Belgium. Kant, A., Koch, G., Van Roozelaar, D., Balk, F. & Ter Huurne, A. (1997). Differentiation of virulent and non-virulent strains of Newcastle disease virus within 24 hours by polymerase chain reaction. Avian Pathology, 26, Kho, C.L., Mohd Azmi, M.L., Arshad, S.S. & Yusoff, K. (2000). Performance of an RT-nested PCR ELISA for detection of Newcastle disease virus. Journal of Virological Methods, 86, King, D.J. & Seal, B.S. (1997). Biological and molecular characterization of Newcastle disease virus isolates from surveillance of live bird markets in the northeastern United States. Avian Diseases, 41, King, D.J. & Seal, B.S. (1998). Biological and molecular characterization of Newcastle disease virus field isolates with comparisons to reference NDV strains. Avian Diseases, 42, Kirkland, P.D. (2000). Virulent Newcastle disease virus in Australia: in through the back door. Australian Veterinary Journal, 78, Kou, Y.T., Chueh, L.L. & Wang, C.H. (1999). Restriction fragment length polymorphism analysis of the F gene of Newcastle disease viruses isolated from chickens and an owl in Taiwan. Journal of Veterinary Medical Science, 61, Lana, D.P., Snyder, D.B., King, D.J. & Marquardt, W.W. (1988). Characterization of a battery of monoclonal antibodies for differentiation of Newcastle disease virus and pigeon paramyxovirus 1 strains. Avian Diseases, 32, Lomniczi, B., Wehmann, E., Herczeg, J., Ballagi-Pordany, A., Kaleta, E.F., Werner, O., Meulemans, G., Jorgensen, P.H., Mante, A.P., Gielkens, A.L.J., Capua, I. & Damoser, J. (1997). Newcastle disease outbreaks in recent years in Western Europe were caused by an old (VI) and a novel genotype (VII). Archives of Virology, 143, Marin, M.C., Villegas, P., Bennett, J.D. & Seal, B.S. (1996). Virus characterization and sequence of the fusion protein gene cleavage site of recent Newcastle disease virus field isolates from the southeastern United States and Puerto Rico. Avian Diseases, 40, Meulemans, G., Gonze, M., Carlier, M.C., Petit, P., Burny, A. & Le Long. (1987). Evaluation of the use of monoclonal antibodies to hemagglutination and fusion glycoproteins of Newcastle disease virus for virus identification and strain differentiation purposes. Archives of Virology, 92, Nagai, Y. (1993). Protease-dependent virus tropism and pathogenicity. Trends in Microbiology, 1, Nagai, Y., Klenk, H-D. & Rott, R. (1976a). Proteolytic cleavage of the viral glycoproteins and its significance for the virulence of Newcastle disease virus. Virology, 72, Nagai, Y., Ogura, H. & Klenk, H-D. (1976b). Studies on the assembly of the envelope of Newcastle disease virus. Virology, 69, Nanthakumar, T., Kataria, R.S., Tiwari, A.K., Butchaiah, G. & Kataria, J.M. (2000). Pathotyping of Newcastle disease viruses by RT-PCR and restriction enzyme analysis. Veterinary Research Communications, 24, Nishikawa, K., Isomura, S., Suzuki, S., Wanatabe, E., Hamaguchi, M., Yoshida, T. & Nagai, Y. (1983). Monoclonal antibodies to the HN