Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University"

Transcription

1 Greenwald 1 Mouse intercellular adhesion molecule 1 (ICAM-1) isoforms demonstrate different binding affinities to mouse macrophage-1 antigen (Mac-1) and preliminary evidence for alternatively-spliced variants of ICAM-1 in humans Senior Thesis Presented to The Faculty of the School of Arts and Sciences Brandeis University Undergraduate Program in Biology Maria Miara, Advisor Koichi Yuki, Principal Investigator In partial fulfillment of the requirements for the degree of Bachelor of Science Emily Greenwald Department of Anesthesiology, Perioperative, and Pain Medicine, Boston Children s Hospital; Department of Biology, Brandeis University Maria Miara, Ph.D Department of Biology, Brandeis University Koichi Yuki, M.D. Department of Anesthesiology, Perioperative, and Pain Medicine, Boston Children s Hospital Copyright by Emily Greenwald Committee members Name: Dr. Koichi Yuki Signature: Name: Dr. Maria Miara Signature: Name: Dr. Neil Simister Signature:

2 Table of Contents Greenwald 2 Figure Legend..3 Abstract 4 Introduction..5 ICAM-1 and neutrophil recruitment 5 Alternative splicing..8 Materials and Methods...13 Mouse ICAM-1 exon deletion...13 Cells...15 Mouse ICAM-1 isoform expression analysis Western Blot of mouse ICAM-1 isoforms. 15 Mouse ICAM-1: mouse Mac-1 binding assay with V-bottom wells. 16 Human ICAM-1 isoform expression analysis with RT-PCR Statistical Significance...19 Results 20 Mouse ICAM-1 exon deletion Mouse ICAM-1 isoform expression analysis Western Blot of mouse ICAM-1 isoforms. 23 Mouse ICAM-1: mouse Mac-1 binding assay with V bottom wells.25 Human ICAM-1 isoform expression analysis with RT-PCR 28 Discussion..33 Western Blot of mouse ICAM-1 isoforms Mouse ICAM-1: mouse Mac-1 binding assay with V bottom wells...33 Human ICAM-1 isoform expression analysis with RT-PCR 37 Limitations. 38 Conclusions and summary.41 Acknowledgments..42 References..43

3 Figure Legend Greenwald 3 Figure 1: Neutrophil Adhesion 6 Figure 2: ICAM-1 Structure (adapted from Yang et al 2004)....7 Figure 3: (A) LFA bind to ICAM-1 (B) Mac-1 bind to ICAM Figure 4: Suggestion of isoforms (Western blot adapted from Dustin et al 1986).. 8 Figure 5: ICAM-1 isoforms...10 Figure 6: pcmv-mouse ICAM-1 plasmid template..14 Figure 7: ICAM-1(2-4) confirmation with specific amplification.20 Figure 8: ICAM-1(2-4) confirmation by length.21 Figure 9: ICAM-1(4-6) confirmation by length.21 Figure 10: ICAM-1(2-4) expression by FACS..22 Figure 11: ICAM-1(4-6) expression by FACS..23 Figure 12: Western blot of mouse ICAM-1 isoforms 25 Figure 13: Graph of ICAM-1 binding percentages 26 Figure 14: ICAM-1 binding percentages and significance 27 Figure 15: Human liver and lung RNA gel 28 Figure 16: cdna production experiment Figure 17: cdna production experiment 1 control with GAPDH 30 Figure 18: cdna production experiment Figure 19: cdna production experiment 2 PCR round

4 Greenwald 4 Mouse intercellular adhesion molecule 1 (ICAM-1) isoforms demonstrate different binding affinities to mouse macrophage-1 antigen (Mac-1) and preliminary evidence for alternatively-spliced variants of ICAM-1 in humans Emily Greenwald, Maria Miara, Ph.D, Koichi Yuki, M.D. Biology Undergraduate Thesis, Spring Semester Report May, 2016 Abstract Full-length intercellular adhesion molecule 1 (ICAM-1) is an immunoglobulin-like expressed in various tissues, including the endothelium. The binding of ICAM-1 on an endothelial cell to lymphocyte function-associated molecule 1 (LFA-1) and macrophage-1 antigen (Mac-1) on neutrophils is important for neutrophil recruitment. ICAM-1 has five extracellular immunoglobulin domains and most investigations have studied neutrophil recruitment with fulllength ICAM-1. Binding between LFA-1: ICAM-1 and Mac-1: ICAM-1 differ slightly in function and binding site; LFA-1 binds domain 1 of ICAM-1 while Mac-1 binds domain 3. Six alternatively-spliced ICAM-1 isoforms were previously discovered in ICAM-1-exon-deletion mice: full-length ICAM-1, ICAM-1(2-4), ICAM-1(2-6), ICAM-1(3-6), ICAM-1(4-6), and ICAM-1(2-5), named for the spliced exons. To better understand the role of ICAM-1 isoforms in Mac-1: ICAM-1-dependent neutrophil recruitment to the liver, we studied the relative binding of five ICAM-1 isoforms to Mac-1. These isoforms were transiently expressed in HEK293T cells using customized plasmids. A V-bottomed adhesion assay assessed the binding of these cells to Mac-1. The ICAM-1(2-4) isoform demonstrated the highest relative binding percentage to Mac-1 (relative binding percentage of 42.3% in the presence of Mg 2+ /EGTA), while ICAM-1(2-6) demonstrated the lowest (relative binding percentage of 9.9% in the presence of Mg 2+ /EGTA). We also began assessment of the existence of ICAM-1 isoforms in human blood, liver, and lung RNA samples using reverse transcription polymerase chain reaction (RT-PCR). Additional experiments are required to evaluate the binding of the six ICAM-1 isoforms to Mac-1 and LFA- 1 using the V-bottomed adhesion assay, and will confirm the presence of ICAM-1 isoforms in humans.

5 Introduction Greenwald 5 ICAM-1 and neutrophil recruitment Intercellular adhesion molecule 1 (ICAM-1) is a cell surface adhesion molecule expressed on endothelial cells and other immune cells, and its major role is to facilitate adhesion between two different cells during immune responses. ICAM-1 is a ligand for lymphocyte function-associated antigen-1 (LFA-1) and macrophage-1 antigen (Mac-1), both of which are adhesion molecules expressed on the surface of neutrophils. During neutrophil recruitment, neutrophils leave the blood stream to go to a site of infection. In this process, shown in Figure 1, neutrophils adhere to the endothelium via binding of ICAM-1 to LFA-1 or to Mac-1 prior to transmigration through the blood vessel 1 5. Neutrophil recruitment is a multistep process mediated by various molecules; this process is categorized into steps of rolling, adhesion, and transmigration, which facilitate migration of the neutrophils to a site of infection in order to fight a causative pathogen 6 9. When the body begins to defend against a potential threat, circulating neutrophils are activated by various proinflammatory mediators, including chemoattractants, which are protein messengers produced by the host during inflammation 10. Figure 1 depicts the process of neutrophil-to-endothelial cell adhesion and accompanies the following explanation. Neutrophils express LFA-1 and/or Mac-1 on the cell surface, and these adhesion molecules are activated by various chemoattractants and cytokines 3,6,10,11. After activation, the neutrophils begin rolling along the endothelium. Neutrophils adhere to the endothelial cell via high-affinity binding between activated LFA-1 and/or Mac-1 expressed on the surface of a neutrophil and ICAM-1 expressed on the surface of an endothelial cell 3,6,11. Then, neutrophils can transmigrate through the endothelium and move to the site of inflammation 2,3,6 8, ICAM-1 thus plays a major role in neutrophil recruitment.

6 Neutrophil Mac-1 LFA-1 LFA-1: ICAM-1 complex Mac-1: ICAM-1 complex Greenwald 6 Bloodstream ICAM-1 Endothelial Cells Tissue Figure 1: The process of neutrophil adhesion to an endothelial cell, which begins with rolling and then arrest via binding of ICAM-1 to LFA-1 or Mac-1. ICAM-1 is a member of the immunoglobulin supergene family, and is also known as CD54. ICAM-1 is a glycoprotein of five homologous immunoglobulin domains (see Figure 2), one transmembrane domain, and a short cytoplasmic tail The ICAM-1 protein is encoded by seven exons of the ICAM-1 gene 18. The immunoglobulin domains of the ICAM-1 protein are each encoded by exons 2 through 6 of the ICAM-1 gene, such that exon 2 encodes domain 1, and exon (X) encodes domain (X-1), until exon 6 encodes domain 5. LFA-1 binds to the immunoglobulin domain 1 of ICAM-1, and Mac-1 binds to the immunoglobulin domain 3 of ICAM-1 4,5,19,20, which are depicted in Figure 3. Exon 1 encodes the components necessary for translation, including the ribosome binding site and start codon. Exon 7 encodes the transmembrane domain and cytoplasmic tail that allow ICAM-1 to remain bound to the cell membrane. Soluble ICAM-1 is a secretion of ICAM-1 that does not contain the transmembrane domain or cytoplasmic tail, and therefore is not bound to the membrane and does not include the region of the protein encoded by exon 7 21,22. Two mechanisms have been proposed for forming soluble ICAM-1: cleavage of the extracellular domain by a metalloproteinase, or alternative splicing that produces an mrna transcript encoding the immunoglobulin domains of soluble ICAM-1 21,22.

7 Greenwald 7 Figure 2: The extracellular immunoglobulin domains of full-length ICAM-1. Adapted from Yang et al 2004, which characterized D3D4D5 of ICAM-1 and used previously characterized figures of D1D2 of ICAM-1 to generate a figure of all five extracellular domains of ICAM Figure 3: A simplified, cartoon version of the binding location for (A) LFA-1 at the extracellular immunoglobulin domain 1 on ICAM-1 and (B) Mac-1 at the extracellular immunoglobulin domain 3 on ICAM-1.

8 Alternative splicing Greenwald 8 Alternative splicing is prevalent in the immune system, and has been noted among cell surface adhesion molecules 23,24. After the cloning of human ICAM-1 in 1986, the research team studied the biosynthesis of ICAM-1 in dermal fibroblasts. Their Western blot, shown below in Figure 4, depicts the molecular weights the mature ICAM-1 glycoprotein and the mature ICAM-1 protein after removal of oligosaccharides. Two distinct molecular weights for ICAM-1 were observed even after oligosaccharides were removed 13. ICAM-1 Control ICAM-1 Control Figure 4: The Western blot result from Dustin et al 1986 of the molecular weight of ICAM-1 after synthesis by dermal fibroblasts. The lanes on the left contain the isolated, mature ICAM-1 glycoprotein. The lanes on the right contain the isolated, mature ICAM-1 protein after removal of oligosaccharides. The proteins in ICAM-1 lanes were immunoprecipitated with monoclonal antibody ICAM-1 and Control lanes were immunoprecipitated with a control 13. Note the two distinct molecular weights for ICAM-1, as indicated by the red arrows. Mature glycoprotein Oligosaccharides removed The researchers attributed the two bands that were observed after removal of oligosaccharides to the potential for residual glycosylation 13. However, these distinct molecular weights indicate of the presence of different ICAM-1 isoforms in humans, for which definitive evidence has not yet been reported.

9 Greenwald 9 In 1995, King and collaborators identified six alternatively-spliced variants of ICAM-1 and the resulting ICAM-1 isoforms that exist in mice (see Figure 5) 25. ICAM-1 isoforms are named based on the exons that are spliced together in the mrna transcript. Therefore, when exon X is deleted, the protein does not contain immunoglobulin domain (X-1) and the isoform is named ICAM-1 (X-1)-(X+1) for the exons that are included. Six isoforms for ICAM-1 were identified in mice: the full-length isoform that contains all exons, and therefore immunoglobulin domains D1D2D3D4D5, the (2-6) isoform that contains D1D5, the (4-6) isoform that contains D1D2D3D5, the (2-4) isoform that contains D1D3D4D5, the (3-6) isoform that contains D1D2D5, and the (2-5) isoform that contains D1D4D5 25,26. Figure 5 depicts the ICAM-1 gene, the mrna splice variants that King and collaborators identified, and the resulting protein isoforms translated from those transcripts 25.

10 Greenwald 10 Figure 5: The mouse ICAM-1 gene, alternatively-spliced variants of mrna, and protein isoforms. The numbers in the boxes indicate exons of the coding regions for the given isoform, and the numbers in the ovals indicate the immunoglobulin domains in the protein isoform.

11 Greenwald 11 The binding of ICAM-1 isoforms in mice to adhesion molecule LFA-1 has been characterized and the different isoforms do bind LFA-1 with different affinities 25. Robledo and collaborators studied neutrophil infiltration to the liver, which is dependent on adhesion between Mac-1 and ICAM Septic shock takes place when cytokines that recruit immune cells during inflammation are released into the bloodstream, leading to inflammation proliferating throughout an organism s body 7. This clinical problem can be modeled in mice using lipopolysaccharide (LPS). In order to study neutrophil infiltration to the liver, Robledo and collaborators used LPS to induce shock in three populations of mice: wild-type mice, transgenic mice that could only express ICAM-1 isoforms without domain 4 (exon 5 deletion mice), and transgenic mice that could only express ICAM-1 isoforms without domain 3 (exon 4 deletion mice). Wild-type mice can express all ICAM-1 isoforms. Exon 5 deletion mice can express ICAM-1 isoforms (2-6), (3-6), and (4-6), but only the (4-6) isoform contains the immunoglobulin domain 3 to which Mac-1 binds. Exon 4 deletion mice can express ICAM-1 isoforms (2-5), (2-6), and (3-6). This study found that wild-type mice showed neutrophil infiltration to the liver with 50% mortality from shock. Exon 5 deletion mice also showed neutrophil infiltration to the liver with 77% mortality from shock and expression of the alternatively-spliced mrna transcripts for the ICAM-1(2-6) and (4-6) isoforms in RNA samples from the liver tissue after LPS-induced shock 26. In contrast, exon 4 deletion mice showed no neutrophil infiltration to the liver and 0% mortality from shock 26. The isoforms that contain the binding site for Mac-1, immunoglobulin domain 3, are ICAM-1(2-4), (4-6), and full-length ICAM-1. The exon 4 deletion mice do not have ICAM-1 immunoglobulin domain 3, which interacts with Mac-1. Because exon 5 deletion mice showed high mortality and expression of the ICAM-1(2-6) and (4-6) isoforms, and exon 4 deletion mice did not show any mortality and cannot express ICAM-1 isoforms that bind Mac-1, we hypothesized that the absence of ICAM-1 isoforms that could bind Mac-1 offered a survival benefit in the LPS-induced shock model. We hypothesized that Mac-1 would demonstrate binding affinities for different ICAM-1 isoforms.

12 Greenwald 12 The functional binding of ICAM-1 isoforms to Mac-1 has not yet been reported in mice. We studied the difference in binding affinity of certain mouse ICAM-1 isoforms to mouse Mac-1. We used DNA cloning techniques to generate customized pcmv3-icam-1 plasmids with exon deletions, in order to make the DNA that encodes the ICAM-1 isoforms (2-4), (4-6), (2-6), and (3-6) 28,29. Human embryonic kidney (HEK293T) cells were transiently transfected with these isoform plasmids in order to express the ICAM-1 isoforms. The V-bottomed adhesion assay was used in order to assess the binding of each isoform. The ICAM-1(2-4) isoform demonstrated the highest binding affinity to Mac-1, and the ICAM-1(2-6) isoform showed the lowest binding affinity to Mac-1. The next steps for this project will be to clone the sixth isoform of ICAM-1, ICAM-1(2-5), and obtain a larger sample size to characterize the binding of all six mouse ICAM- 1 isoforms to mouse Mac-1. We have preliminary evidence for the existence of ICAM-1 isoforms in humans from reverse transcription polymerase chain reaction (RT-PCR) experiments, and further analysis will confirm and characterize these isoforms.

13 Materials and Methods Greenwald 13 Mouse ICAM-1 exon deletion The coding sequences of the mouse ICAM-1 isoforms were generated using primers of sequences from only the relevant exons for each splice variant. Plasmid pcmv3-mouse ICAM-1 (Sino Biological) (Figure 6) was used as a template. Primers were designed with the specific sequence at the end of one exon to the beginning of the exon with which it would be spliced, thus deleting the exon or exons in between and generating the coding sequence for the ICAM-1 isoform. In order to make ICAM-1(2-4) without exon 3, the forward primer was designed to contain the sequence at the end of exon 2 and the beginning of exon 4, 5 -CCGCTACCATCACCGTGTATTATCTTC-3 and the reverse primer was designed to contain the sequence at the beginning of exon 4 and end of exon 2, 5 -GGGATGGTAGCTGGAAGATAATAC-3. Similarly, in order to make ICAM-1(4-6) without exon 5, the forward primer was designed to contain the sequence at the end of exon 4 and the beginning of exon 6, 5 -CGCAGAGGACCTTAACAGTCTACAATGGT-3 and the reverse primer was designed to contain the sequence at the beginning of exon 6 and the end of exon 4, 5 -CGTCCAGCCGAGGACCATTGTAGACTGTTAAG-3. The exon deletion was made using polymerase chain reaction (PCR)-mediated plasma deletion protocol adapted from Hansson et al, This PCR reaction contained 5 μl of 10x Pfu reaction buffer, 1.25 μl of each primer, 1 μl of dntps, 3 μl of dimethyl sulfoxide (DMSO), 20 μg of the pcmv-icam-1 plasmid (4 μg of plasmid at a concentration of 5 μg/μl), and 1 microliter of Pfu polymerase, to a total volume of 50 μl. This reaction was run with an initial denaturation at 95 C for 1 minute, and 18 cycles of denaturation at 95 C for 50 seconds, annealing at 50 C for 50 seconds, and extension at 68 C for 20 minutes, and then a final extension at 68 C for 7 minutes. The ICAM- 1(2-6) and ICAM-1(3-6) samples were designed similarly by K. Yuki.

14 Greenwald 14 Figure 6: Mouse CD54/ICAM-1 mammalian expression plasmid pcmv3- ORF. This plasmid is commercially available from Sino Biological, Inc. and was used as a template from which the DNA that encodes the ICAM-1 isoforms was designed. Exons were deleted by designing primers that would anneal to the ends of the spliced exons and extend around the rest of the plasmid, thus deleting the exon in between the primers. The PCR-mediated plasmid deletion product was transformed into E. coli DH5α competent cells and LB/ampicillin media was used to select for the cells that had taken up the plasmid. The DNA from the transformed colonies was purified with Miniprep and the samples were numbered by the colony from which they were inoculated. The ICAM-1(2-4) isoform DNA was confirmed using PCR with full-length primers and with primers that specifically anneal to the junction between ICAM-1 exons 2 and 4, and the products of these PCR reactions were run on an agarose gel in order to confirm production of the isoform DNA via observation of the band size. The ICAM-1(4-6) isoform DNA was confirmed using PCR with full-length primers and the products of this PCR reaction were run on an agarose gel in order to confirm production of the isoform DNA via observation of the band size. In addition, some of the colonies were subjected to DNA sequencing and confirmed using Genetyx Mac software.

15 Cells Greenwald 15 Human embryonic kidney (HEK) 293T cells were cultured in RPMI1640 containing 10% fetal bovine serum (FBS) at 37 C and 5% CO2. Mouse ICAM-1 isoform expression analysis HEK293T cells were transiently transfected with the designed pcmv-icam-1 isoform plasmids using Lipofectamine 2000 (Thermo Fisher Scientific) in order to express the ICAM-1 protein isoforms. Six wells were prepared for transfection. The cells were then transiently transfected with 4 μg of template plasmid containing full-length ICAM-1 or one of the designed ICAM-1 isoform plasmids: ICAM-1(2-4), ICAM-1(2-6), ICAM-1(3-6), or ICAM-1(4-6). A nontransfected well served as the control, with exposure to equivalent amounts of Optimem media and Lipofectamine 2000 under the same conditions as the transfected cells, but without any plasmid DNA. Cells were stained with fluorescein-labeled rat anti-mouse CD54 antibody (clone: YN1/1.7.4) (BioLegend) that presumably binds to domain 1 of ICAM-1, which is expressed in all isoforms, though this has not been conclusively determined. These transfected cells were subject to flow cytometry analysis in order to determine the expression of ICAM-1 on the cells. The DNA samples with the highest mean fluorescent intensities, which provide estimates of the amount of ICAM-1 that was expressed by the sample as a whole, were used in transfection for the Western blot analysis and binding assays. Western Blot of mouse ICAM-1 isoforms Although flow cytometry analyses were performed in order to assess the surface expression of ICAM-1 after transfection, this did not provide information about the molecular weight of the ICAM-1 protein that was expressed after transfection with a given isoform plasmid. Thus, Western Blot analysis was performed in order to determine the size of the ICAM-1 proteins that were expressed by the transfected HEK293T cells. HEK293T cells were plated into a twelve-

16 Greenwald 16 well plate and allowed to grow until 80-90% confluent. The cells were then transiently transfected with 4 μg of template plasmid containing full-length ICAM-1 or the designed ICAM- 1 isoform plasmids. A non-transfected well served as the control, with exposure to equivalent amounts of Optimem media and Lipofectamine 2000 under the same conditions as the transfected cells, but without any plasmid DNA. The cells were incubated at 37 C for one day. They were then harvested and lysed using RIPA buffer containing protease inhibitor cocktails (complete). Following centrifugation, the supernatants containing the protein were collected. The protein concentrations of the supernatants were measured and calculated using a bicinchoninic acid assay. 10 μg of the protein was prepared in a 1:1 ratio of protein to Laemmli buffer and the protein was denatured at 95 C for five minutes. This was then loaded for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). A loading control was not included. Proteins were then transferred from the gel to a polyvinylidene difluoride (PVDF) membrane and probed using rat anti-mouse fluorescein CD54 antibody (YN1/1.4.7) (BioLegend) as a primary antibody (1:1,000 dilution) followed by goat anti-rat IgG-horseradish peroxidase (HRP) (Cell Signaling) (1:1,000 dilution) as the secondary antibody. This assay was used to provide evidence that the cells were expressing the desired ICAM-1 protein isoform. Mouse ICAM-1: mouse Mac-1 Binding assay with V-bottom wells The V-bottomed binding assay was used to measure the adhesion of mouse ICAM-1 isoformexpressing HEK293T cells to mouse Mac-1 protein. This was adapted from the protocol outlined in Weitz-Schmit and Chreng, HEK293T cells were transiently transfected with the pcmv-mouse ICAM-1 full-length and customized isoform plasmids, with a non-transfected control exposed to the same conditions of Optimem and Lipofectamine A 96-well V- bottom plate was coated with mouse Mac-1 protein (R&D Systems) overnight at 4 C using carbonate coating buffer. The wells were blocked with 1.5% bovine serum albumin (BSA) in phosphate buffered saline (PBS) for one hour at 37 C in order to ensure that observed binding

17 Greenwald 17 was specific to the interaction between ICAM-1 and Mac-1, and not due to nonspecific adhesion of the cells to the plate. Following a wash with 200 μl of PBS, 50 μl of HEPES-buffered saline (HBS) solutions of 10mM ethylenediaminetetraacetic acid (EDTA), 2mM Mg 2+ /Ca 2+, or 2mM Mg 2+ /ethylene-bis(oxyethylenenitrilo)tetraacetic acid (EGTA) were aliquoted to each well, resulting in final concentrations of 5mM EDTA, 1mM Mg 2+ /Ca 2+, and 1mM Mg 2+ /EGTA. The EDTA chelates divalent cations and acts as a control because divalent cations are required to activate Mac-1. Mg 2+ activates human Mac-1, while Ca 2+ antagonizes this activation 5,30. EGTA is a chelating agent for Ca 2+ in the presence of Mg 2+ ; thus in the Mg 2+ /EGTA condition, EGTA coordinated with Ca 2+, allowing for Mg 2+ to activate Mac-1 without the potential antagonism by Ca 2+. The Mg 2+ /EGTA condition is used to activate human Mac-1, and was expected to activate mouse Mac-1 here. This resulted in three activation conditions: EDTA that served as the control without any activating ions, Mg 2+ /Ca 2+ that contained two divalent cations Mg 2+ and Ca 2+, and Mg 2+ /EGTA that contained divalent cation Mg 2+ and chelating agent EGTA that removed any potential Ca 2+ ions that may have been present. These conditions allowed us to assess any possible influence of Ca 2+ in activating or antagonizing activation of Mac-1 by Mg 2+ because one condition contained both Mg 2+ and Ca 2+, and the other chelated all Ca 2+. The HEK293T cells that expressed ICAM-1 isoforms were harvested and stained with 2,7 -bis(-2-carboxyethyl)-5(and- 6)-carboxyfluorescein acetoxymethyl ester (BCECF AM). 50 μl of stained cells were added to each well and the plate was incubated at 37 C for 20 minutes. The plate was then spun down at 1,000 and 1,200rpm and the non-adhered cells pelleted in the middle of the V-bottom wells. The fluorescent intensity was measured with a plate reader (fluorescence 483nm/emission 535nm). The raw binding percentage was calculated by subtracting the fluorescent intensity of the wells under the activation conditions, Mg 2+ /Ca 2+ and Mg 2+ /EGTA, by the control condition, EDTA, and dividing that value by the fluorescence value for EDTA:,

18 Greenwald 18 where X stands for Ca 2+ or EGTA. The relative binding percentage of an individual isoform was then calculated by subtracting the binding percentage of that isoform by the binding percentage of the non-transfected control that did not express any forms of ICAM-1:. The average relative binding percentages for each isoform were calculated separately for each activation condition, Mg 2+ /Ca 2+ or Mg 2+ /EGTA. Human ICAM-1 isoform expression analysis with RT-PCR Reverse transcription PCR (RT-PCR) was used in order to evaluate the presence of alternatively spliced ICAM-1 mrna transcripts in RNA samples from human blood, liver, and lung. The quality of the liver and lung RNA was assessed by running the RNA samples on an agarose gel. 5 μg of RNA from liver tissue (Takara Clontech), lung tissue (Takara Clontech), and blood (K. Yuki) were used to produce complementary DNA (cdna), and then PCR was run on the sample of cdna using full-length human ICAM-1 primers. To produce cdna, 5 μg of the RNA template were mixed with 1 μl each of oligo-dt primers and dntps and heated to 65 C for 5 minutes. 4 μl of first-strand buffer, 2 μl of 0.1 M dithiothreitol (DTT), and 1 μl of ddh2o were added to the reaction tube, and samples were incubated for 2 minutes at 42 C. Then, 1 μl of superscript III reverse transcriptase was added and the reaction mixture was incubated at 42 C for 50 minutes. The first trial of PCR of the cdna used previously designed primers. The later reactions used two sets of full-length human ICAM-1 primers designed using Genetyx Mac software. The forward primer from set 1 used the sequence 5 -TGTGACCAGCCCAAGTTGTT-3 from exon 2 and the reverse primer from set 1 used the sequence 5 -TCCCTTTTTGGGCCTGTTGT-3 from exon 7. The forward primer from set 2 used the sequence 5 -AGCCCAAGTTGTTGGGCATA-3 from exon 2 and the reverse primer from set 2 used the sequence 5 -GGAGAGCACATTCACGGTCA-3 from the end of exon 6 and the beginning of exon 7. PCR of the cdna was run with GAPDH primers to serve as a

19 Greenwald 19 control to confirm the production of cdna, and a band was expected at 150 base pairs. This PCR reaction contained 12.5 μl of Taq polymerase master mix, 2 μl of a 1:10 dilution of cdna: ddh2o, and 0.5 μl of each primer, to a total volume of 25 μl. The reaction was run with an initial denaturation of 95 C for 3 minutes, and 35 cycles of denaturation at 95 C for 30 seconds, annealing between C for 30 seconds, and extension at 68 C for 1 minute, and then a final extension at 68 C for 5 minutes. Primer set 1 was successful in amplifying ICAM-1 from the cdna of blood, liver, and lung at a 50 C annealing temperature, and therefore primer set 1 was used in all subsequent reactions. Equal amounts of cdna were used in a PCR reaction with primer set 1 at 50 C, 53.9 C, 58.3 C, and 61 C annealing temperatures. Several annealing temperatures were used to try to optimize the human ICAM-1 amplification conditions. The PCR products were run on an agarose gel in order to determine the size of the DNA sequences that had been amplified. These PCR reactions were often run several times in order to amplify the cdna samples enough to observe bands in the gel. Statistical Significance Statistical analyses were performed using IBM SPSS Statistics 23 software 31. Two-way univariate analyses of variance (ANOVA) with relative binding percentage as the dependent variable and ion and isoform as independent variables was used to assess whether the relative binding percentages of the different mouse ICAM-1 isoforms to mouse Mac-1 differed from one another. Independent two-way t-tests were performed separately for the Mg 2+ /Ca 2+ and Mg 2+ /EGTA conditions in order to assess the difference in the average relative binding percentages of each isoform to that of the full-length ICAM-1 under each activation condition.

20 Results Greenwald 20 Mouse ICAM-1 exon deletion Mouse ICAM-1 exon deletion variants were cloned into the pcmv plasmid based on the PCRmediated plasmid deletion protocol 29, which is a modification to QuikChange mutagenesis. PCR products were transformed into DH5α E. coli competent cells, and the plasmids were purified using Miniprep. First, ICAM-1(2-4) was cloned, which does not contain exon 3, and cloning primers were designed (as described in Materials and Methods: Mouse ICAM-1 exon deletion). After PCR products were obtained, they were transformed into DH5α cells. Of the colonies that grew from the transformed DH5α cells, five were inoculated and Miniprep was performed in order to purify the plasmids. The regions surrounding the deletion were amplified via PCR using primers that specifically bind the junction between exons 2 and 4 in order to verify the exon 3 deletion (Figure 7). A band was expected around 214 base pairs, and this was observed. PCR was also performed using the T7 and BGH primers that flank the ICAM-1 reading frame in the plasmid (Figure 8). Bands were expected around 1299 base pairs for the mouse ICAM-1(2-4) isoform DNA and around 1614 base pairs for the full-length ICAM-1 DNA, and this was observed for all samples. Figure 7: ICAM-1(2-4) isoform-specific primers amplified at the expected 214bp. The DNA samples were designated 1-5 as each sample was inoculated from a different colony.

21 Greenwald 21 Figure 8: The T7 and BGH primers showed that full-length ICAM-1 was longer than the DNA purified from the transformed (2-4) samples; a band was observed for full-length ICAM-1 at approximately 1614 base pairs, as expected, and bands were observed for the (2-4) samples at approximately 1299 base pairs, as expected. The ICAM-1(4-6) isoform DNA, which does not contain exon 5, was cloned using the same method, and transformed into DH5α cells. All seven colonies of transformed DH5α cells were inoculated and the plasmids were purified using Miniprep. The ICAM-1(4-6) isoform DNA was amplified via PCR using the T7 and BGH primers that flank the ICAM-1 reading frame in the plasmid (Figure 9). Bands were expected around 1356 base pairs for the mouse ICAM-1(4-6) isoform DNA and around 1614 base pairs for the full-length ICAM-1 DNA, and this was observed for all samples. Figure 9: The T7 and BGH primers showed that full-length ICAM-1 was longer than the DNA purified from the transformed (4-6) samples; a band was observed for full-length ICAM-1 at approximately 1614 base pairs, as expected, and bands were observed for the (4-6) samples at approximately 1356 base pairs, as expected. Mouse ICAM-1(2-6) and ICAM-1(3-6) plasmids were cloned by K. Yuki using these techniques.

22 Mouse ICAM-1 isoform expression analysis Greenwald 22 HEK293T cells were transiently transfected with plasmids containing full-length or isoform ICAM-1 and flow cytometry analysis was used to evaluate whether the cells were expressing the ICAM-1 protein. First, HEK293T cells transfected with full-length ICAM-1 and ICAM-1(2-4) were tested, and those transfected with full-length ICAM-1 and with samples 2 through 5 of ICAM-1(2-4) plasmids showed expression of ICAM-1, as shown in Figure 10 by the different fluorescent patterns of these samples of transfected cells from the control cells. Cells transfected with sample 1 of ICAM-1(2-4) showed minimal expression. Similarly, flow cytometry analysis of HEK293T cells transfected with samples 1, 2, 3, 6, and 8 of the ICAM-1(4-6) DNA all showed expression of ICAM-1, as indicated by the different fluorescent patterns of these samples from the control in Figure 11. Figure 10: Results from the FACS of HEK293T cells transfected with the full-length ICAM-1 plasmid and the five samples of the ICAM-1(2-4) plasmid (designated by numbers 1-5). The Y-axis depicts the count of cells going through the flow cytometer and the X-axis depicts the fluorescent intensity of those cells. The fluorescent tag FITC- CD54 tagged ICAM-1 expressed on the cells, and therefore a higher fluorescent intensity was observed when ICAM-1 was expressed. The black curve is the graph of the control cells, which were not transfected, and the fluorescent intensity of this curve dropped off at about The blue curve is the graph of the cells transfected with the indicated plasmid sample. The peaks for the transfected samples, other than sample 1, showed a higher intensity, a right shift in the peak, which indicated expression of ICAM-1. Sample 4 had the highest mean fluorescent intensity.

23 Greenwald 23 Figure 11: Results of FACS of HEK293T cells transfected with the full-length ICAM-1 plasmid and five of the samples of the ICAM-1(4-6) plasmid. The Y-axis depicts the count of cells going through the flow cytometer and the X-axis depicts the fluorescent intensity of those cells. The fluorescent tag FITC-CD54 tagged ICAM-1 expressed on the cells, and therefore a higher fluorescent intensity was observed when ICAM-1 was expressed. The black curve is the graph of the control cells, which were not transfected with DNA, and the fluorescent intensity of this curve dropped off at about The red curve is the graph of the cells transfected with the indicated plasmid sample. The peaks for the transfected samples showed small peaks at a higher intensity than the controls, which indicated expression of ICAM-1. Sample 2 had the highest mean fluorescent intensity. Western Blot of mouse ICAM-1 isoforms Protein lysates were obtained from full-length or isoform mouse ICAM-1-expressing HEK293T cells and subjected to Western blot analysis probed with ICAM-1 antibody (YN1/1.4.7) in order to evaluate the expression and size of the ICAM-1 isoforms. The results of this Western blot are shown in Figure 12. Predicted molecular sizes of these forms of ICAM-1 are as follows (predictions were made using ExPASy Compute pi/mw Tool 32 and Bioinformatics Protein Molecular Weight prediction software 33 ): full-length ICAM-1 has a predicted molecular weight of approximately 58.83kDa, though it is typically characterized at 55kDa 4,15,34, ICAM-1(2-4) has a predicted molecular weight of 47.38kDa, ICAM-1(2-6) has a predicted molecular weight of 27.48kDa, ICAM-1(3-6) has a predicted molecular weight of 38.95kDa, and ICAM-1(4-6) has a predicted molecular weight of 49.50kDa 32,33. Given that ICAM-1 can be heavily glycosylated,

24 Greenwald 24 the actual protein sizes can differ. The suggested molecular weight of the mature full-length ICAM-1 glycoprotein on a Western blot is approximately 90kDa 13,15,19, which we observed in a strong band for the sample that had been transfected with full-length ICAM-1 (see Figure 12). All samples, including the non-transfected control, showed bands around 130 and 100kDa, the identity of which was unknown. As this large band was expressed in the control sample, it was not introduced via transfection of our plasmids and was therefore disregarded as background expression in the cells or due to inaccurate or nonspecific binding by the antibody. The sample that had been transfected with full-length ICAM-1 displayed a strong band at a molecular weight of approximately 90kDa, as expected 15. The ICAM-1(2-4) isoform did not display any unique bands. The ICAM-1(4-6) isoform displayed a smear along the top of the lane, until a molecular weight of approximately 190kDa. The ICAM-1(2-6) isoform displayed a smear until a molecular weight of approximately 100kDa and a clear band at a molecular weight of approximately 40kDa. Although we expect to observe a band at 27.48kDa for this isoform, the band at 40kDa could be a glycosylated form of the ICAM-1(2-6) isoform. The ICAM-1(3-6) isoform displayed a smear until a molecular weight of approximately 95kDa; within this smear, there is a clear band at approximately 150kDa and 110kDa, and there may be a band below the smear at approximately 50kDa. Although we expect to observe a band at 38.95kDa for this isoform, the glycosylated ICAM-1(3-6) isoform could have a molecular weight of 50kDa.

25 Greenwald 25 Figure 12: The control lane contained the protein lysates of a non-transfected control well that was exposed to the same conditions as all other samples, including Optimem and Lipofectamine 2000, but was not exposed to any DNA plasmid for transfection. The full-length lane contained the protein of the cells transfected with the full-length pcmv-mouse ICAM-1 plasmid. Lanes 3-6 were transfected with the plasmids containing the DNA encoding the ICAM-1 isoform plasmids as indicated. The ladder is shown on the far right, and the predicted lengths of the ICAM- 1 isoforms are indicated by blue arrows to the right of the ladder 32,33. Red arrows indicate the bands observed in each sample that may be ICAM-1. A clear band was observed for full-length ICAM-1 at approximately 90kDa. No band was observed for the ICAM-1(2-4) sample. A smear was observed for ICAM-1(4-6) until approximately 190kDa, for ICAM-1(2-6) until approximately 100kDa, and for ICAM-1(3-6) until approximately 95kDa. Mouse ICAM-1: mouse Mac-1 binding assay with V-bottom wells A V-bottom well adhesion assay was used in order to measure the binding affinity of full-length or isoform ICAM-1-expressing HEK293T cells to Mac-1 protein. HEK293T cells were transfected as previously described and successfully expressed DNA encoding full-length mouse ICAM-1, and mouse ICAM-1 isoforms (2-4), (2-6), (3-6), and (4-6). The Mac-1 protein on the plates was activated by divalent cations in a solution of 1 mm Mg 2+ /1 mm Ca 2+ and a solution of 1 mm Mg 2+ /5 mm EGTA. EGTA served as a chelating agent for any potential calcium that may have been present. Two of these adhesion trials were successful (trial 2 courtesy of K. Yuki). The results of these adhesion trials are shown in Figures 13 and 14. Full-length ICAM-1 demonstrated an average relative binding percentage of 35.34% in the presence of Mg 2+ /Ca 2+ and

26 Greenwald % in the presence of Mg 2+ /EGTA. ICAM-1(2-4) demonstrated the highest relative binding percentage to Mac-1, with an average relative binding percentage of 41.31% in the presence of Mg 2+ /Ca 2+, and an average relative binding percentage of 42.31% in the presence of Mg 2+ /EGTA. ICAM-1(2-6) demonstrated the lowest relative binding percentage to Mac-1, with an average relative binding percentage of 6.81% in the presence of Mg 2+ /Ca 2+, and an average relative binding percentage of 9.88% in the presence of Mg 2+ /EGTA. ICAM-1(3-6) demonstrated an average relative binding percentage of 12.58% in the presence of Mg 2+ /Ca 2+, and an average relative binding percentage of 20.36% in the presence of Mg 2+ /EGTA. ICAM- 1(4-6) demonstrated an average relative binding percentage of 31.71% in the presence of Mg 2+ /Ca 2+, and an average relative binding percentage of 35.61% in the presence of Mg 2+ /EGTA. Figure 13: The average relative binding percentages for each isoform in the presence of a solution of 1mM Mg 2+ /Ca 2+ or a solution of 1mM Mg 2+ /5mM EGTA. Mg 2+ activated Mac-1; Ca 2+ antagonized Mac-1 activation; EGTA served as a chelating agent for any Ca 2+ that may have been present. See Materials and Methods: ICAM-1: Mac-1 Adhesion Assay for protocol and calculations. Error bars span the standard deviation of the average r. The presence of calcium vs. no calcium had no significant effect on observed ICAM-1 isoform: Mac-1 relative binding percentage (p=0.930 according to two-way ANOVA); the ion solution also did not show a significant interaction with the isoform to influence a particular isoform s binding ratio to Mac-1 (p=0.800 according to two-way ANOVA). The isoforms did not all display the same relative binding percentage to Mac-1 (p=0.024 according to two-way ANOVA).

27 Isoform Relative Binding % in Mg 2+ /Ca 2+ Significance in Mg 2+ /Ca 2+ Relative Binding % in Mg 2+ /EGTA Greenwald 27 Significance in Mg 2+ /EGTA Full-length ICAM %±16.08% N/A 22.13±2.88 N/A ICAM-1(2-4) 41.31%±9.94 t= , p= %±2.72 t= , p=0.019 ICAM-1(2-6) 6.81%±24.77 t=1.366, p= %±0.39 t=5.957, p=0.100 ICAM-1(3-6) 12.58%±3.25 t=1.082, p= %±10.81 t=0.224, p=0.856 ICAM-1(4-6) 31.71%±17.29 t=0.217, p= %±13.57 t= , p=0.386 Figure 14: Independent t-tests compared the ICAM-1: Mac-1 relative binding percentage of each isoform to that of full-length ICAM-1 under each activation condition. The t-statistic tells the magnitude of difference between relative binding percentage of the given isoform and full-length ICAM-1. The p-value indicates the probability that this difference was observed due to chance. The ICAM-1(2-4) isoform showed significantly higher binding to Mac-1 than full-length ICAM-1 in the presence of Mg 2+ /EGTA (p=0.019 according to independent two-way t-test). All other relative binding percentages did not show a significant difference in binding to Mac-1 compared to full-length ICAM-1 (p>0.05 according to independent two-way t-tests). Univariate two-way Analysis of Variance (ANOVA) was performed with ion and isoform as independent variables in order to determine the influence of the ion in solution and the statistical significance of these data. The observed mean relative binding percentages were not significantly different across the different ion solutions (p=0.930) and the observed mean relative binding percentages for each isoform were not significantly different across the different ion solutions (p=0.800). Therefore, the ion conditions of Mg 2+ /Ca 2+ vs. Mg 2+ /EGTA did not result in a significant difference in relative binding percentage of any particular isoform or of the binding ability of the ICAM-1-expressing HEK293T cells to Mac-1. Two-way ANOVA yielded a p- value of for the effect of isoform on relative binding percentage in the presence of a given ion. This p-value of indicates that the average relative binding percentage of the isoforms differed significantly in the presence of each ion. Therefore, among the five isoforms, at least one exhibited a distinct binding pattern to Mac-1 from the others when ion condition was taken into account. Independent two-way t-tests were run for each isoform in order to assess the significance of the relative binding percentage of each isoform to Mac-1 in comparison to the relative binding percentage of full-length ICAM-1 under a particular ion condition, and the results are shown in Figure 14 above. The ICAM-1(2-4) isoform showed a significantly different

28 Greenwald 28 relative binding percentage to Mac-1 than full-length ICAM-1 in the presence of Mg 2+ /EGTA (p=0.019 according to an independent two-way t-test between full-length ICAM-1 and ICAM- 1(2-4)). According to independent two-way t-tests, the ICAM-1(2-6), (3-6), and (4-6) isoforms in the presence of Mg 2+ /EGTA and all isoforms in the presence of Mg 2+ /Ca 2+ did not demonstrate significantly different relative binding percentages to Mac-1 than full-length ICAM-1 in the presence of the respective ions (p>0.05 according to each independent two-way t-test). Further statistical analyses could not be performed with a sample size of 2, and these results must be interpreted with caution due to the small sample size. Human ICAM-1 isoform expression analysis with RT-PCR Reverse transcription PCR was performed in order to assess the existence of ICAM-1 isoforms in human RNA samples from lung tissue, liver tissue, and blood. Figure 15 to the right depicts the RNA gel that was run in order to evaluate the quality of the liver and lung RNA samples. The bright band at 28S contains the ribosomal RNA (rrna) of the large subunit of the ribosome and the band at 18S contains the small subunit of the ribosome. The smear in between and below these bands contains the messenger RNA (mrna). Based on the isoforms that have been reported in mice, the Figure 15: Gel of liver and lung RNA. The white arrows indicate the bands at 28S and 18S that contained the rrna of the large and small subunits of the ribosome, respectively. The smear in between contained mrna and the smear below 18S contained smaller mrna. expected lengths of alternative splice variants of human ICAM-1 were determined and compared to the bands observed on the gels run with the RT-PCR products from human ICAM-1 samples. In Figure 16, the liver cdna and lung cdna was loaded in lanes 2 and 3 to compare with lanes 4 and 5 that contained the PCR products that had been run with the template cdna from the given sample and previously designed full-length human ICAM-1 primers. Bands were observed in the wells of both cdna samples, indicating the presence of long strands of cdna. Several

29 Greenwald 29 bands were observed for the liver sample in Figure 16, at approximately 1600 base pairs, 500 base pairs, and 300 base pairs. The full-length human ICAM-1 gene is 1599 base pairs long, and a band of approximately 1600 base pairs is observed in Figure 16 in the liver RT-PCR sample, which is likely full-length human ICAM-1. The two bands below, at approximately 500 base pairs and 300 base pairs may be isoforms. However, based on the membrane-bound isoforms that exist in mice, the shortest ICAM-1 splice variant that we expect to observe has exons 1, 2, 6, and 7, and therefore a length of 753 base pairs. There is not a logical combination of ICAM-1 exons that would produce an alternatively spliced variant of membrane-bound ICAM-1 with lengths of 500 base pairs or 300 base pairs, based on the isoforms present in mice. These short bands would represent ICAM-1 isoforms of a single immunoglobulin domain, if they are ICAM-1 isoforms. No bands were observed for the full-length ICAM-1 PCR on the cdna of the lung sample. PCR was performed on the liver cdna with primers for the housekeeping gene GAPDH to serve as a control that confirmed that cdna had been produced from the liver sample of RNA (see Figure 17). Bands were observed near the expected length of 150 base pairs, thus confirming successful production of cdna from the liver RNA sample. Liver Lung Liver full Lung full Ladder cdna cdna ICAM-1 ICAM-1 Full: 1599bp (4-6): 1347bp (3-5): 1314bp, (2-4): 1296bp (3-6): 1059bp, (2-5): 1008b (2-6): 753bp Figure 16: The original cdna sample and full-length ICAM-1 PCR products. The blue arrows indicate the expected lengths for the ICAM-1 isoform mrna transcripts (note that the (3-5) isoform is not observed in mice). Long bands were observed that remained in the wells of the cdna lung sample, indicating that the development of the cdna was successful. Bands were observed in the liver full-length ICAM-1 sample, which are indicated with white arrows and used the sample of RNA from the liver tissue and primers for full-length human ICAM-1. A band was observed at approximately 1600 base pairs, and was likely full-length ICAM-1, which has 1599 base pairs, and there were also bands observed around 500 and 300 base pairs. No bands were observed in the lung samples.

30 Greenwald 30 Figure 17: PCR products of human liver cdna using the mouse primers for the housekeeping gene GAPDH. The bands that are circled at 150 base pairs in the GAPDH lanes indicate that cdna was produced. The dark bands are from the shadow of the dye in the loading buffer. The next experiment produced cdna from the same human liver and lung RNA samples, and a human blood RNA sample as well. This experiment ran PCR with the full-length human ICAM- 1 primers designed by E. Greenwald and used GAPDH as a control to confirm successful cdna production (see Figure 18). Bands at the expected 150 base pairs were observed for the blood, liver, and lung samples run with GAPDH primers in lanes 2, 5, and 8, respectively. The samples of PCR products that had been run with set 1 of full-length human ICAM-1 primers amplified the ICAM-1 transcripts, as observed in lanes 3 and 9; primer set 1 was thus used in the subsequent RT-PCR reactions. The samples run with set 2 of full-length human ICAM-1 primers did not amplify the ICAM-1 transcripts, as observed in lanes 4, 7, and 10. In the blood sample in lane 3, a clear band was observed at approximately 1000 base pairs, and faint bands were observed at approximately 600 base pairs, 550 base pairs, and 450 base pairs. In the liver sample in lane 6, no clear bands were observed, which differed from the results of the previous RT-PCR experiment (Figure 16). In the lung sample in lane 9, a clear band was observed around 1600 base pairs, and a faint band was observed around 800 base pairs.

31 Greenwald 31 Full: 1599bp (4-6): 1347bp (3-5): 1314bp, (2-4): 1296bp (3-6): 1059bp, (2-5): 1008b (2-6): 753bp Figure 18: PCR of the cdna samples after amplification with GAPDH and full-length human ICAM-1 primers as indicated. The blue arrows indicate the expected lengths for the ICAM-1 isoform mrna transcripts (note that the (3-5) isoform is not observed in mice). Black arrows indicate the bands that were observed. The bands at the expected 150 base pairs in the GADPH lanes indicated that cdna was produced for all samples. Bands were observed for samples run with primer set 1, which indicated success of the amplification with this primer set; primer set 2 did not amplify. Bands were observed around 1000, 600, 500, and 450 base pairs in the blood sample. Bands were observed in the lung sample around 1600 base pairs and a faint band around 800 base pairs. No bands were observed in the liver sample. This PCR product shown in Figure 18 was then amplified further and the results are shown in Figure 19. Bands were observed in the lung sample at approximately 1500 base pairs, 1300 base pairs, 1200 base pairs, 1000 base pairs, 700 base pairs, 650 base pairs, and 500 base pairs, with some faint shorter bands observed as well. Bands were observed in the blood sample at approximately 1000 base pairs, 550 base pairs, 400 base pairs, 300 base pairs, and 200 base pairs. Bands were observed in the liver sample at approximately 1400 base pairs, 1000 base pairs, and 900 base pairs. In Figure 19, the bands at approximately 1500 base pairs in the liver and lung samples were likely full-length ICAM-1. The bands of approximately 1300, 1200, 1000, and 700 base pairs in the lung sample, in the blood sample around 1000 base pairs, and in the liver sample around 1000 and 900 base pairs may have been ICAM-1 isoforms. The bands of approximately 1300 base pairs in the lung sample could be ICAM-1(2-4), for which we expect a length of 1296 base pairs, ICAM-1(4-6), for which we expect a length of 1347 base pairs, or

32 Greenwald 32 ICAM-1(3-5), which is not observed in mice but for which we would expect a length of 1314 base pairs. The bands of approximately 1200 base pairs in the lung sample could be ICAM-1(2-4), for which we expect a length of 1296 base pairs, or ICAM-1(3-6), for which we expect a length of 1059 base pairs. The bands of approximately 1000 base pairs in the lung, blood, and liver samples may be ICAM-1(2-5), for which we expect a length of 1008 base pairs, or ICAM- 1(3-6), for which we expect a length of 1059 base pairs. The band of approximately 900 base pairs in the liver sample may be ICAM-1(2-5), for which we expect a length of 1008 base pairs. The band of approximately 700 base pairs in the lung sample may have been ICAM-1(2-6), for which we expect a length of 753 base pairs. Figure 19: The PCR product of PCR amplification with primer set 1 of the DNA that was previously amplified in Figure 18. The blue arrows indicate the expected lengths for the ICAM-1 isoform mrna transcripts. The black arrows indicate the bands observed; bands were observed in the lung samples at approximately 1500 base pairs, 1300 base pairs, 1200 base pairs, 1000 base pairs, 700 base pairs, 650 base pairs, and 500 base pairs; bands were observed in the blood samples at approximately 1000 base pairs, 550 base pairs, 400 base pairs, 300 base pairs, and 200 base pairs; bands were observed in the liver samples at approximately 1400, 1000, and 900 base pairs.

Gladstone Institutes, University of California (UCSF), San Francisco, USA

Gladstone Institutes, University of California (UCSF), San Francisco, USA Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Mapping the Ligand-binding Site on a GPCR Using Genetically-encoded Photocrosslinkers

Mapping the Ligand-binding Site on a GPCR Using Genetically-encoded Photocrosslinkers Mapping the Ligand-binding Site on a GPCR Using Genetically-encoded Photocrosslinkers Amy Grunbeck, Thomas Huber, Pallavi Sachdev, Thomas P. Sakmar Laboratory of Molecular Biology and Biochemistry, The

More information

Defining the Role of Notch Signaling in Vascular Smooth Muscle Cell Differentiation. Honors Research Thesis

Defining the Role of Notch Signaling in Vascular Smooth Muscle Cell Differentiation. Honors Research Thesis Defining the Role of Notch Signaling in Vascular Smooth Muscle Cell Differentiation Honors Research Thesis Presented in Fulfillment of the Requirements for graduation with research distinction at The Ohio

More information

Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System

Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System Overview of the Expressway Cell-Free Expression Systems The Expressway Cell-Free Expression Systems use an efficient coupled transcription and translation reaction to produce up to milligram quantities

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

For the rapid, sensitive and accurate quantification of Ras in various samples

For the rapid, sensitive and accurate quantification of Ras in various samples ab128504 Ras Assay Kit Instructions for Use For the rapid, sensitive and accurate quantification of Ras in various samples This product is for research use only and is not intended for diagnostic use.

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

An Investigation into the Effects of the Addition of Synthetic Receptor on Chemokine Induced Jurkat T-Cell Migration

An Investigation into the Effects of the Addition of Synthetic Receptor on Chemokine Induced Jurkat T-Cell Migration An Investigation into the Effects of the Addition of Synthetic Receptor on Chemokine Induced Jurkat T-Cell Migration Jessica Jurado, Jianfang Hu, Avery August, PhD PSU Undergraduate Animal Bioscience July

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set

Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Catalog Number : SEK11695 To achieve the best assay results, this manual must be read carefully before using this product

More information

Purification and Fluorescent Labeling of Exosomes Asuka Nanbo 1*, Eri Kawanishi 2, Ryuji Yoshida 2 and Hironori Yoshiyama 3

Purification and Fluorescent Labeling of Exosomes Asuka Nanbo 1*, Eri Kawanishi 2, Ryuji Yoshida 2 and Hironori Yoshiyama 3 Purification and Fluorescent Labeling of Exosomes Asuka Nanbo 1*, Eri Kawanishi 2, Ryuji Yoshida 2 and Hironori Yoshiyama 3 1 Graduate School of Medicine, Hokkaido University, Sapporo, Japan; 2 Graduate

More information

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)

More information

Manual. Precision Red Advanced Protein Assay Reagent. Cat. # ADV02. cytoskeleton.com. Cytoskeleton, Inc.

Manual. Precision Red Advanced Protein Assay Reagent. Cat. # ADV02. cytoskeleton.com. Cytoskeleton, Inc. The Protein Experts Manual Cytoskeleton, Inc. V. 6.0 Precision Red Advanced Protein Assay Reagent Cat. # ADV02 cytoskeleton.com Phone: (303) 322.2254 Fax: (303) 322.2257 Customer Service: cserve@cytoskeleton.com

More information

Influenza A H1N1 HA ELISA Pair Set

Influenza A H1N1 HA ELISA Pair Set Influenza A H1N1 HA ELISA Pair Set for H1N1 ( A/Puerto Rico/8/1934 ) HA Catalog Number : SEK11684 To achieve the best assay results, this manual must be read carefully before using this product and the

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E. Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1

More information

Collagenase Assay Kit

Collagenase Assay Kit Collagenase Assay Kit Catalog # 31 and 32 For Research Use Only - Not Human or Therapeutic Use INTRODUCTION Collagenases are members of the matrix metalloproteinase (MMP) family and degrade collagen types

More information

STORE AT 4 o C Version 3

STORE AT 4 o C Version 3 Instruction Manual Advanced Protein Assay Reagent (Cat. # ADV01) ORDERING INFORMATION To order by phone: (303) - 322-2254 To order by Fax: (303) - 322-2257 To order by e-mail: cserve@cytoskeleton.com Technical

More information

Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint

Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint APPLICATION NOTE AlphaLISA Technology Authors: Matthew Marunde Stephen Hurt PerkinElmer, Inc. Hopkinton, MA Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint Introduction

More information

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay

More information

Exo-Glow TM Exosome Labeling Kits

Exo-Glow TM Exosome Labeling Kits Exo-Glow TM Exosome Labeling Kits Cat# EXOR100A-1 Cat# EXOG200A-1 Cat# EXOC300A-1 User Manual Store kit at -20 o C on receipt Version 8 3/10/2017 A limited-use label license covers this product. By use

More information

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

Structural vs. nonstructural proteins

Structural vs. nonstructural proteins Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?

More information

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the

More information

AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT

AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT AquaPreserve DNA/RNA/Protein Order # Preservation and Extraction Kit 8001MT, 8060MT MoBiTec GmbH 2014 Page 2 Contents 1. Description... 3 2. Kit Contents... 3 3. Terms & Conditions... 3 4. AquaPreserve

More information

Chapter 4. Estrogen receptor expression in human macrophages

Chapter 4. Estrogen receptor expression in human macrophages Chapter 4 Estrogen receptor expression in human macrophages 4.1. Introduction Macrophages respond to estrogen present in their microenvironment and hence should express functional estrogen receptors unless

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

gliomas. Fetal brain expected who each low-

gliomas. Fetal brain expected who each low- Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

HiPer Western Blotting Teaching Kit

HiPer Western Blotting Teaching Kit HiPer Western Blotting Teaching Kit Product Code: HTI009 Number of experiments that can be performed: 5/20 Duration of Experiment: ~ 2 days Day 1: 6-8 hours (SDS- PAGE and Electroblotting) Day 2: 3 hours

More information

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel

More information

Optimization of the Fuse-It-mRNA Protocol for L929 Cells in the µ-plate 24 Well

Optimization of the Fuse-It-mRNA Protocol for L929 Cells in the µ-plate 24 Well Optimization of the Fuse-It-mRNA Protocol for L929 Cells in the µ-plate 24 Well 1. General Information... 1 2. Background... 1 3. Material and Equipment Required... 2 4. Experimental Procedure and Results...

More information

The Annexin V Apoptosis Assay

The Annexin V Apoptosis Assay The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.

More information

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit 2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as

More information

Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College

Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation Sarah J. MacDonald Assistant Professor Missouri Valley College Phytoremediation of Organic Compounds Phytodegradation: Plants

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze. This document is available at www.stemcell.com/pis Catalog #18765 EasySep Mouse CD4+CD62L+ T Cell Isolation Kit For processing 1x 10^9 cells Description Isolate highly purified naïve CD4+ T cells (CD4+CD62L+)

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Protein Synthesis

Protein Synthesis Protein Synthesis 10.6-10.16 Objectives - To explain the central dogma - To understand the steps of transcription and translation in order to explain how our genes create proteins necessary for survival.

More information

RNA Processing in Eukaryotes *

RNA Processing in Eukaryotes * OpenStax-CNX module: m44532 1 RNA Processing in Eukaryotes * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you

More information

Chapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues

Chapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues Allergy and Immunology Review Corner: Chapter 3, Part A (pages 37-45) of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 3, Part A (Pages

More information

Protocol. G-LISA Rac1 Activation Assay Biochem Kit : 24 Assays (Absorbance Based) Cat. # BK128-S. cytoskeleton.com. Cytoskeleton, Inc.

Protocol. G-LISA Rac1 Activation Assay Biochem Kit : 24 Assays (Absorbance Based) Cat. # BK128-S. cytoskeleton.com. Cytoskeleton, Inc. The Protein Experts Protocol Cytoskeleton, Inc. V 8.1 G-LISA Rac1 Activation Assay Biochem Kit : 24 Assays (Absorbance Based) Cat. # BK128-S cytoskeleton.com Phone: (303) 322.2254 Fax: (303) 322.2257 Customer

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze. This document is available at www.stemcell.com/pis Catalog #18765 EasySep Mouse CD4+CD62L+ T Cell Isolation Kit For processing 1x 10^9 cells Description Isolate highly purified naïve CD4+ T cells (CD4+CD62L+)

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

OxisResearch A Division of OXIS Health Products, Inc.

OxisResearch A Division of OXIS Health Products, Inc. OxisResearch A Division of OXIS Health Products, Inc. BIOXYTECH pl GPx Enzyme Immunoassay Assay for Human Plasma Glutathione Peroxidase For Research Use Only. Not For Use In Diagnostic Procedures. Catalog

More information

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,

More information

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

RayBio Human PPAR-alpha Transcription Factor Activity Assay Kit

RayBio Human PPAR-alpha Transcription Factor Activity Assay Kit RayBio Human PPAR-alpha Transcription Factor Activity Assay Kit Catalog #: TFEH-PPARa User Manual Jan 5, 2018 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

Chapter 5. Generation of lymphocyte antigen receptors

Chapter 5. Generation of lymphocyte antigen receptors Chapter 5 Generation of lymphocyte antigen receptors Structural variation in Ig constant regions Isotype: different class of Ig Heavy-chain C regions are encoded in separate genes Initially, only two of

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described

In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described Supplemental Methods In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described previously 1 2 using 32P-labeled 211 bp fragment from 3 HS1. Footprinting reaction mixes contained

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze. This document is available at www.stemcell.com/pis EasySep Mouse Monocyte Isolation Kit Catalog #19861 For processing 1 x 10^9 cells Description Isolate untouched and highly purified monocytes from mouse

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information

Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells

Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells Int J Clin Exp Pathol 2017;10(5):5039-5062 www.ijcep.com /ISSN:1936-2625/IJCEP0052419 Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures FastImmune Intracellular Cytokine Staining Procedures BD has developed protocols for the detection of intracellular cytokines in activated lymphocytes and in activated monocytes. The procedures have been

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset:

A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset: A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset: Josh Glason: Sales Manager, DiaSorin Australia Pty Ltd September 6, 2014 This product is not currently

More information

ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 3 ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Staining of human whole blood with the ezkine Th1/Th17 Whole Blood Intracellular

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

More information

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by

More information

O. Repeat the measurement in all relevant modes used in your experiments (e.g. settings for orbital averaging).

O. Repeat the measurement in all relevant modes used in your experiments (e.g. settings for orbital averaging). Before You Begin Read through this entire protocol sheet carefully before you start your experiment and prepare any materials you may need. This year, in order to improve reproducibility, we are requiring

More information

EPIGENTEK. EpiQuik HDAC2 Assay Kit (Colorimetric) Base Catalog # P-4006 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik HDAC2 Assay Kit (Colorimetric) Base Catalog # P-4006 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik HDAC2 Assay Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik HDAC2 Assay Kit is very suitable for measuring HDAC2 levels from various fresh tissues and

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

International Graduate Research Programme in Cardiovascular Science

International Graduate Research Programme in Cardiovascular Science 1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Chapter 2 (pages 22 33): Cells and Tissues of the Immune System. Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group

Chapter 2 (pages 22 33): Cells and Tissues of the Immune System. Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group Allergy and Immunology Review Corner: Cellular and Molecular Immunology, 8th Edition By Abul K. Abbas, MBBS; Andrew H. H. Lichtman, MD, PhD; and Shiv Pillai, MBBS, PhD. Chapter 2 (pages 22 33): Cells and

More information

RayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit

RayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit RayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit Catalog #: PEL-DDR2-Y740-T User Manual Last revised March 22, 2018 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607

More information

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor

More information

MODULE 3: TRANSCRIPTION PART II

MODULE 3: TRANSCRIPTION PART II MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain

More information

Chapter 4 Cellular Oncogenes ~ 4.6 -

Chapter 4 Cellular Oncogenes ~ 4.6 - Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of

More information

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit]

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit] MANUAL IL-1alpha (mouse) ELISA Kit [Interleukin-1 alpha (mouse) ELISA Kit] For research use only. Not for diagnostic use Version 1 (March-5-2013) Cat. No. AG-45B-0003-KI01 www.adipogen.com Table of Contents

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information