NASDAQ: CPHD. Defining on-demand molecular diagnostics

Transcription

1 NASDAQ: CPHD Defining on-demand molecular diagnostics

2 Forward Looking Statement During the course of this presentation, we may make projections or other forward looking statements regarding future events or the future financial performance of Cepheid. We wish to caution you that such statements are just projections and that actual events or results may differ materially. We refer you to the documents that we have filed from time to time with the SEC, specifically our last filed Form 10-K. These documents contain and identify important factors that could cause the actual results to differ materially from those contained in these projections and forward looking statements.

3 Meeting Overview Objectives Review new products being introduced at the AACC GeneXpert Infinity Series of high-volume systems 6-color multiplex capabilities for the entire GeneXpert family Laboratory Information System (LIS) interface capabilities for the GeneXpert family GX-I single module system. Presentations John Bishop, CEO The strategic direction of the new systems David Persing, Executive Vice President and Chief Medical and Technology Officer The company s expanding pipeline of tests Rob Koska, Senior Vice President of Sales & Marketing Current marketing programs with a special focus on the developing MRSA market

4 Cepheid Investment Highlights Fully integrated Molecular Diagnostics Company Extensive biologics development capability Unique system platform Broad market applicability Clinical Industrial Biothreat Expanding market adoption of Molecular Diagnostics First PCR Molecular product CLIA categorized as Moderate Complexity First cleared molecular product for viral meningitis Established base of operations in US and Europe ~370 employees 2006 revenues - $86 million Expected 2007 revenues - $112 to $120 million

5 A Fully Enabled Molecular Diagnostics Company Probes Targets Quenchers Dyes Nucleic Acid Chemistry/Chemistry Primers Scorpions Amplification Technology Taqman GeneXpert Platform SmartCycler

6 GeneXpert : A Paradigm Shift in Molecular Automation Accuracy Sensitivity Specificity Random Access On-Demand Testing Short Time-to-Result Compact Footprint Universal Environmental Application

7 GeneXpert Cartridge Contains all reagents for a particular test Contamination Control: sample and reagents never leave cartridge Universal sample prep Runs nested PCR Reflexive test capability Easy disposal of biological materials PCR Reaction Tube Cartridge Body with Multiple Reagent Reservoirs Rotary Valve Ultrasonic Interface Patents - 6,374,684 & 6,391,541

8 GeneXpert Cartridge Direct Universal Sample Prep GeneXpert Cartridge Blood Serum Plasma Urine CSF Swab elution Sputum Fecal Tissue Competitive Sample Prep Blood Serum Plasma Urine CSF X Swab elution X Sputum X Fecal X Tissue

9 Multiplexing - Virtual Array Type of Test Simultaneous unrelated targets Example Multiple infections, wounds Est. Number of Targets (2 Stages) 5 per channel X 6 channels = 30 (60) Simultaneous related targets Broad-spectrum targets ( Barcoding ) Quantitative analysis of simultaneous unrelated targets SNPs Sepsis Multiple viral load targets Gene expression analysis 2 SNPs per channel X 6 channels = 12 (24) SNPs > per channel X 6 channels = 5 (10) * * Includes a control

10 GeneXpert Platform Strategic Reach GeneXpert Module GX-I GX-IV GX-XVI GX-

11 GeneXpert Infinity Systems High throughput system available in variable throughput configurations /7 robotic cartridge handling capability True random access Reflexive test capability Enhanced multiplexing with 6 color optics LIS interface Unlimited on-line test menu capability

12 GeneXpert Infinity Systems Infinity tests/24 hours* Infinity tests/24 hours* * Assumes 72 minute assay run time

13 GeneXpert Infinity Systems

14 Throughput Analysis

15 Example 1

16

17

18

19

20 Example 2

21

22

23

24

25 Example 3

26

27

28

29

30 GeneXpert Pricing Matrix 1 Module 4 Modules 16 Modules 24 Modules 48 Modules 72 Modules GeneXpert Available now $27,100 $78,200 $155,250 Infinity 48* Available mid 09 $235,000 $350,000 Infinity 72* Available mid 09 $251,000 $366,000 $475,000 * Preliminary pricing estimates

31 Modularity Enables System-wide Access Labor and Delivery Hospital Central Lab Reference Lab Regional Lab Main Laboratory ER Lab HemeOnc Clinic

32 Modularity Enables Alternate Site Testing Medical Office Building Doctors Office Group Laboratory

33 Test Pipeline Strategy Cepheid & Partner Cepheid Cepheid & Grant/Contract BCR-ABL Factor II/V GBS MRSA Sepsis Panel EBV EV STD s MRSA/SA TB Breast Cancer CMV 2C9/VKORC1 C. diff FLU Prostate HPV VZV VRE Lung HIV HCV Bladder Women s Health Hospital Acquired Infection Critical Infectious Disease Immuno-Compromised Oncology Genetic Disease

34 GeneXpert Menu Coverage Near Patient / Mobile Lab Hospital/ Physician Lab Hospital Core Lab High-Volume Lab GBS Factor II/V TB Flu A/B/AI CT/GC HPV HCV HIV Prostate Cancer Bladder Cancer Market GBS EV BC R-A BL MRSA MRSA/SA Factor II/V C. difficile VRE Flu A/B/AI TB HPV HIV HCV Breast Cancer Prostate Cancer Bladder Cancer Sepsis Panels CT/GC GBS EV BC R-A BL MRSA MRSA/SA Factor II/V TB Flu A/B/AI C. difficile VRE Sepsis Panels CT/GC HPV HIV HCV Breast Cancer

35 GeneXpert : Transforming Real-time PCR into Realtime Patient Results David H. Persing Executive Vice President Chief Medical and Technology Officer

36 Product GeneXpert Clinical Assay Development (Currently Active Projects) FDA Classification Status MRSA/SA 510(k)/CE-IVD Development VRE 510(k)/CE-IVD Development C. difficile 510(k)/CE-IVD Development Factor 2/5 510(k)/CE-IVD Development TB / rifampin resistance PMA/CE-IVD Development Influenza virus 510(k)/CE-IVD Development Sepsis Panels Gram Positive PMA/CE-IVD Development Gram Negative PMA/CE-IVD Development Fungal PMA/CE-IVD Development

37 HAI A Rapidly Developing Market Increasing clinical interest in utilizing molecular diagnostics Emergence of drug resistant and virulent organisms MRSA C. difficile VRE Acinetobacter Pseudomonas Increasing need for real-time results (STAT testing) Sepsis Tests-to-treat Growing interest in expanding molecular diagnostics testing capability of outside of traditional lab setting Emergency department Intensive Care Units Doctor s offices

38 Limitations of First Generation Real-Time PCR Slide 1 of 2 Specimens are run in batches, so turnaround time is limited Example: for the BD GeneOhm MRSA test run on the SmartCycler System, analytical time is 2 hours, but effective TAT is much longer (19-24 h weekdays, longer on weekends) On-demand testing is nearly impossible to perform, especially on nights and weekends The greatest asset of molecular detection, that of speed relative to culture, is not leveraged in most situations

39 Limitations of First Generation Real-Time PCR Slide 2 of 2 All first generation tests are CLIA high complexity Requirement for specially trained, relatively expensive lab techs Requirement for dedicated space, contamination control First generation PCR technology is unable to respond to STAT requests Just the settings in which the technology could prove to have the highest impact

40 Testing-To-Treat (T 3 ): High-Impact Opportunities Sepsis Meningitis VRE C. difficile Influenza Tuberculosis CA-MRSA Warfarin PgX Many others..

41 To maximize its potential, realtime PCR needs to live up to its name and provide real-time patient results which lead to high-impact treatment or management decisions

42 On-Demand Molecular Diagnostics Xpert MRSA MRSA test available now Nasal swabs Rapid detection may reduce patient and healthcare worker exposure risk while saving healthcare dollars 510(k) cleared by FDA CLIA categorized as Moderate Complexity On-demand, 24/7 results with existing lab personnel Built-in flexibility to accommodate additional samples from the same patient, which allows for enhanced sampling procedures to be evaluated

43 On-Demand Molecular Diagnostics Xpert MRSA / SA 24/7 real-time testing of positive blood culture bottles for a leading cause of sepsis in hospitalized patients STAT testing of surgical sites in febrile patients Effective elimination of false-positive MRSA results by avoiding detection of empty-cassette variants, a growing problem in the US and EU Test-to-treat for outpatient STTI s due to SA and MRSA

44 GeneXpert T 3 for Next Generation MRSA Drugs Drug Company FDA Status Side effects / Comments Linezolid Pharmacia / Pfizer Approved Marrow Suppression Quinupristin / dalfopristin King Pharma Approved MS pain, phlebitis Oritavancin Targanta Ph. 3 Hypersensitivity Daptomycin Cubist Pharma Approved MS pain Tigecycline Wyeth Approved GI intolerance Dalbavancin Pfizer Approved Not active vs VRE

45 SA and MRSA Prevalence Among Emergency Department Patients

46 Clostridium difficile Associated Diarrhea (CDAD) Most common cause of nosocomial infectious diarrhea (up to 25% of total) 1 Significant associated morbidity and mortality 2 Antibiotic use is strongly associated with CDAD 1 Judicious antibiotic use decreases incidence of CDAD 3 Current rapid EIA tests are low sensitivity, leading to uncertainty and multiple test requests 1. Anand A et al. Am J Gastroenterol. 1994;89: Kelly CP et al. Annu Rev Med. 1998;49: Settle CD et al. Aliment Pharmacol Ther. 1998;12:

47 What Do We Know About CDAD? CDAD is brought on by exposure to the organism and particular antibiotics Its incidence has increased dramatically over the past 2 decades CDAD is virulent and potentially lethal Hospitals are reservoirs of C. difficile CDAD is increasing and moving to the community setting it is acting like an emerging pathogen like MRSA

48 GeneXpert T 3 for new C. difficile Drugs Company Product (type) Patient Response Stage Genzyme Tolevamer (polymer)* 58/70 Pts Phase III Oscient Ramoplanin (abx) 25/29 Pts Phase III Optimer OPT-80 (abx)* 41/45 Pts Phase IIb ActivBiotics Rifalazil (abx)* Unknown None Salix Rifaximin (abx)* 9/10 Pts Phase III Presutti Tinidazole (abx) Unknown Unknown Romark Nitazoxanide 68/76 Pts Phase II Medarex Monoclonal Aby* Unknown Phase II Acambis CD Vaccine Unknown Phase II *poly = polymer, abx antibiotic, Aby - antibody

49 GeneXpert VRE Medical Rationale: VRE can cause UTI, bacteremia / sepsis, and wound infections; is prevalent in patients without disease and is nosocomially transmitted Causes 1/3 of infections in ICU (CDC) Rapid detection enables more effective infection control; patient isolation Companion product to Xpert MRSA in infection control

50 GeneXpert T 3 for New VRE Drugs Drug Company FDA Status Side Effects/Comments Linezolid Pharmacia/Pfizer Approved Marrow Suppression Quinupristin/ dalfopristin King Pharma Approved MS pain, phlebitis Oritavancin Targanta Ph. 3 Hypersensitivity Daptomycin Cubist Pharma Approved MS pain Tigecycline Wyeth Approved GI intolerance

51 Sepsis Diagnostics: Batch Testing is Nearly Unthinkable GeneXpert Sepsis Features: Emphasis on HAI (MRSA, VRE, Pseudomonas, Acinetobacter) Direct detection from blood (culture independent) Batch independent, on-demand testing Rapid result (less than 1 hour) Ability to be run by STAT-lab personnel Detection of the major infectious causes of sepsis Treatment-informing results

52 Xpert Influenza PCR for detection of seasonal human influenza viruses Time to result of ~30 minutes Differentiate avian influenza (Flu A/H5N1) from seasonal human influenza viruses Quickly adaptable if the virus mutates over time or if new viruses emerge that have potential to cause a pandemic FDA IVD clearance and CE-IVD mark CLIA-waived for point of care use Sensitivity and specificity better than existing POC tests

53 Xpert Influenza: the ultimate T 3 Result - Influenza A, H1 Low likelihood of amantidine resistance Consider inexpensive Amantidine or Rimantidine Result - Influenza A, H3 - High likelihood of amantidine and rimantidine resistance Consider expensive NA inhibitors as first-line choice Result Influenza B Consider expensive NA inhibitors as first-line choice Result - Influenza A, H5 NA inhibitors as first-line choice Consider moving to rural Montana

54 A Worldwide Problem: Mycobacteria tuberculosis (TB) Rapid testing would allow for timely therapy and prevent further spread of disease TB remains one of the deadliest diseases in the world Worldwide: 8 million new cases occur annually* Worldwide: 2 million deaths occur annually* US:14,517 cases of TB reported in 2004** ~ 19 million TB cultures performed worldwide*** 12.2 million in developing countries 6.4 million in developed countries Unmet Medical Needs Currently, no rapid molecular assays that detect TB and rifampin resistance Other molecular tests only 64-71% sensitive on AFB smear negative results * World Health Organization, ** CDC, ***FIND Data, **** Frost and Sullivan

55 Rifampin-resistance mutations in M. tuberculosis rpob gene Deletion AATTCATGG Deletion GACCAG Deletion GAACAA Deletion GGCACC Deletion CCATTC Insertion TTC Deletion CAGAAC Del AAC GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTG TCGGGGTTGACCCACAAGCGCCGACTG TCGGCGCTG * * ** * * * ** * * ** ** * *** * ** * ** ** * Insertion TTCATG rpob 81 base pair core region

56 Factor 2 and Factor 5 Genotyping Mutations convey increased risk of venous thrombosis Factor 5 (Leiden) 1691G mutation causing change from arginine to glutamine at amino acid 506 (R506Q) resulting in a protein resistant to cleavage by activated protein C (APC) Factor G mutation in the 3 untranslated region (UTR) Even carriers (heterozygotes) are at increased risk of clotting Factor 5 heterozygotes carry a 4-7 fold increased risk Factor 5 homozygous mutants carry an 80 fold increased risk Factor 2 heterozygotes carry a 2-4 fold increased risk Compound heterozygotes carry a fold increased risk Collaboration with Instrumentation Laboratories

57 Current Marketing Programs Rob Koska, Senior Vice President of Sales & Marketing

58 Clinical Product Overview The SmartCycler System Systems accommodate from 16 to 96 independent reaction sites Available in desktop, laptop and mobile configurations The GeneXpert System Systems with 1 to 72 modules Configured with desktop or laptop computer Standard and new Infinity Series Scope of Tests FDA cleared / approved products ASR products RUO products European CE Marked products

59 FDA Cleared Products Product Platform FDA Classification Status GBS GeneXpert 510k Market Enterovirus GeneXpert 510k* Market MRSA GeneXpert 510k Market GBS SmartCycler 510k Market * De novo

60 ASR* Products Product Platform FDA Classification Status B. pertussis SmartCycler ASR Market HSV Non-typing SmartCycler ASR Market HSV Typing SmartCycler ASR Market Enterovirus SmartCycler ASR Market Parvovirus B19 SmartCycler ASR Market Spa (Staphylococcus aureus) SmartCycler ASR Market meca SmartCycler ASR Market Mycoplasma pneumoniae SmartCycler ASR Market Flu A/B SmartCycler ASR Market RSV (Respiratory syncytial virus) SmartCycler ASR Market B. pertussis / B. parapertussis SmartCycler ASR Market Norovirus SmartCycler ASR Market *Analyte Specific Reagents (ASR). Analytical and performance characteristics are not established. ASRs can only be sold to clinical laboratories regulated under the CLIA of 1988 as qualified to perform high complexity testing under 42 CFR part 493 or under VHA directive 1106.

61 RUO* Products Product Platform FDA Classification Status BCR/ABL GeneXpert RUO Market CMV SmartCycler RUO Market EBV SmartCycler RUO Market VZV SmartCycler RUO Market *Research Use Only. Not for use in diagnostic procedures

62 CE Mark Products Product Platform Classification Status GBS GeneXpert CE Market Enterovirus GeneXpert CE Market MRSA GeneXpert CE Market BCR/ABL GeneXpert CE Market GBS SmartCycler CE Market CMV SmartCycler CE Market EBV SmartCycler CE Market VZV SmartCycler CE Market HBV SmartCycler CE Market HSV 1&2 Mx3000P CE Market BKV Mx3000P CE Market Aspergillus Mx3000P CE Market

63 Worldwide Reach 22 North American Sales Positions 6 North American FTSS Positions 75 ROW Distributors North American Direct Sales & Support Rest of World Distribution

64 Hospital Acquired Infection Problem 1.7 million patients a year get hospital acquired infections* 100,000 annual deaths from hospital infections* Annually over $30 billion spent in managing hospital infections* The leading cause of hospital acquired infections is MRSA * Source: Forbes

65 Building HAI Momentum * APIC.org Market Opportunity: Building the Perfect Storm Guidelines CDC SHEA APIC MRSA Prevalence Study (June 2007) 46/1000 patients were infected or colonized with MRSA This rate is 8 to 11 times higher than previously estimated VA System Mandate Legislative Activity* Reimbursement Reform Mandatory Reporting: 22 States Legislative Surveillance Mandatory Reporting to State PHD: 1 State Additional pending legislation for mandatory surveillance testing at: Voluntary Reporting: 2 States Illinois: HB 378, SB 233 Legislation Pending: 11 States New Jersey: HB 3921 No legislation: 14 States Maryland: HB 966, SB 837

66 Target Market: HAI Hospital Bed Size # of Hospitals Avg. Admissions/Day Avg. High Risk Admissions/Day > * TWP Hospital Acquired Infections Report and AHA admissions statistics

67 HAI Surveillance Pathogen Application Annual Test Opportunities Total Potential Market ($ MM) United States MRSA VRE High Risk Patients 10.5 Million Invasive Procedures 25 Million 1700 MRSA All Admissions* 35.5 Million Europe MRSA VRE All Admissions** 59.3 Million 4032 TOTAL Included in Total 6,412 * TWP H ospital Acquired Infecti ons R eport and AHA admissions statistics ** Cephei d Europe Internal Estimates

68 MRSA/SA Diagnostics Specimen Application Annual Test Opportunities Total Potential Market ($ MM) United States Wounds Blood Culture Bottle Inpatients* Community Acquired/ED Confirmation of Positives ** 2.2 Million 1.0 Million 500, Europe Wounds Blood Culture Bottle Inpatients/ED + Confirmation of Positives Million 300, TOTAL 295 * Preventing Surgical Site Infecti ons: A Surgeon s Perspecti ve, EID, April 2001; Diabetic Ulcers, WebMD, December 2006 ** Rapid Identification of Staphyloc occus aureus in Bl ood Cult ures by a Combination of Fluorescence In Situ Hybridizations Using Peptide Nucleic Aci d Probes and Fl ow Cytometr y, JCM, September 2005; AdvanDx website; Personal communications + Cepheid Europe Internal Esti mates

69 HAI Total Market Specimen Annual Test Opportunities Total Potential Market ($ MM) HAI Surveillance Million 6,412 HAI Diagnostics* 11.5 Million 652 TOTAL 7,064 * Includes $357 million C. diff testing

70 Cepheid Progress with VA s Working at all levels - National, Regional & Local Conducted national webinars Regional level contracts VISN & WSNC Education of NAB and national Director Regional & Local level price/budget discussions & negotiations VOC Pricing & Specs buy-in by Technical and Contracting Working with national on Capitol Hill to support VAMCs request for increased funding for GeneXpert Systems Submitted GSA 66, FSS 65 VII & FSS 66 III

71 Veterans Integrated Service Networks (VISN) Total VISN s 10 VISN s: Selected VOC at VISN level 7 VISN s: VOC with at least 1 hospital VISN level decision in Contracting Process where GeneXpert is Vendor of Choice (VOC) VISN where at least ONE hospital going to bid where GeneXpert is Vendor of Choice (VOC)

72 VA Total Potential Market Total VA Acute Admissions/YR Total Potential Testing Opportunity = 2.1 Tests/patient 780,000* 1,670,000** Total Potential Market $60,120,000 * VHA Public Health Strategic Healthcare Group Webpage ** VA MRSA Directive: Dr. Rodriguez (2009 Expectations)

73 Progress in Surveillance Implementation Universal Health Services (UHS) 57 Total hospitals - 20 hospitals to implement PCR surveillance Health Corporation of America (HCA) 180 Total Hospitals Most have implemented CHROMagar and are currently evaluating PCR Tenet Health System 57 Total hospitals - 55 deciding to implement CHROMagar or PCR

74 Sales of GeneXpert System Configurations (North America) GX-IV 59% YTD Plan GX-XVI 10% GX-IV (2) 31% GX-XVI 36% GX-XVI (4) 5% GX- XV I (8) 5% YTD Actual GX-IV (2) 5% GX-XVI (12) 2% GX-IV (4) 47% 48% GX-XVI Cabinets

75 In Conclusion The GeneXpert System uniquely addresses the full breadth of the market A broad test menu is in development and strategically planned that is in line with the needs and strategic development of the clinical market Cepheid s products are developing clear market traction

76 NASDAQ: CPHD Defining on-demand molecular diagnostics