Enterococcus faecalis in dental root canals detected by culture and by polymerase chain reaction analysis

Transcription

1 Enterococcus faecalis in dental root canals detected by culture and by polymerase chain reaction analysis Brenda P. F. A. Gomes, PhD, MSc, BDS, a Ericka T. Pinheiro, MSc, BDS, b Ezilmara L. R. Sousa, MSc, BDS, b Rogério C. Jacinto, MSc, BDS, b Alexandre A. Zaia, PhD, MSc, BDS, a Caio Cezar Randi Ferraz, PhD, MSc, BDS, a and Francisco José de Souza-Filho, PhD, MSc, BDS, a Piracicaba, Brazil STATE UNIVERSITY OF CAMPINAS-UNICAMP Objective. The objective of this study was to investigate the presence of Enterococcus faecalis in endodontic infections by culture and polymerase chain reaction analyses. Study design. Microbial samples were obtained from 50 teeth with untreated necrotic pulps (primary infection) and from 50 teeth with failing endodontic treatment (secondary infection). Culture techniques were used including serial dilution, plating, incubation, and biochemical identification. For PCR detection, samples were analyzed using a species-specific primer of the 16S rdna and the downstream intergenic spacer region. Results. Culture and PCR detected the test species in 23 of 100 and 79 of 100 of the teeth, respectively. E faecalis was cultured from 2 (4%) of 50 necrotic canals and from 21 (42%) of 50 root-treated canals. PCR detection identified the target species in 41 (82%) and 38 (76%) of 50 primary and secondary infections respectively. Conclusion. E faecalis was detected as frequently in teeth with necrotic pulp as in teeth with failing endodontic treatment when a PCR analysis was used. (Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;102:247-53) We thank Dr. Eugene J. Leys and Dr. Ann L. Griffen, from the Ohio State University College of Dentistry, for providing the facilities. We are also thankful to Dr. Purnima S. Kumar and Ms. Zheng Wang for their help, to Mr. Francisco J. Martinez and Mr. Adailton dos Santos Lima for technical support, and to Biolab Mérieux for the MiniApi equipment. This work was supported by the Brazilian agencies FAPESP (04/ , 05/ ), CNPq (304282/03-0), and CAPES (BEX 2528/02-9, PRODOC 0118/05-2). a Associate Professor, Department of Restorative Dentistry, Endodontic Area, Piracicaba Dental School, State University of Campinas- UNICAMP. b Postgraduate Student, Department of Restorative Dentistry, Endodontic Area, Piracicaba Dental School, State University of Campinas-UNICAMP. Received for publication Jun 29, 2005; returned for revision Nov 21, 2005; accepted for publication Nov 30, /$ - see front matter 2006 Mosby, Inc. All rights reserved. doi: /j.tripleo Culture methods have revealed that the microbiota of necrotic teeth is different in numbers and species from that found in root-filled teeth with apical periodontitis. The selective pressures operating in the root canal environment suggest that certain bacteria are more capable of surviving and multiplying in the root canal than others, favoring the growth of obligate anaerobes in primary infected root canals (i.e., necrotic pulp tissues) 1 and the growth of facultatives, particularly Enterococcus faecalis, in secondary endodontic infections (i.e., failed root-treated teeth). 2-7 Enterococci are common inhabitants of the human gastrointestinalandgenitourinarytracts. 8,9 However,theyare also able to colonize a variety of other sites, including the oralcavity. 10 Thesemicroorganismshavebeenassociated with oral mucosal lesions in immunocompromized patients, 11 periodontitis, 12 and root canal infections. 2-7,13-15 Enterococci constitute a small percentage of the microbial species isolated from root canals of teeth with necrotic dental pulps. 1 Incontrast, they are the most commonly isolated species from root canals of teeth with failed endodontic treatment. Among the enterococci species isolated from root canals, E faecalis is the most common species. Sundqvist et al. 2 found E faecalis in 38% of root-filled teeth with apical periodontitis. Other studies have isolated this microorganism in approximately 50% of the canals that had recoverable microorganisms in cases of teeth with failed endodontic treatment. 3,6,7 Peciuliene et al. 4,5 reported an isolation frequency of enterococci as high as 70% when rootfilled teeth are associated with chronic apical periodontitis. However, most of the studies of the microbiota of root canals of teeth with failed endodontic treatment have used culture techniques for bacterial identification. All of them have reported different percentages of negative culture, pointing out the difficulties in taking bacteriologic samples from previously root-filled canals. 2-7 Therefore, techniques that are more sensitive may be necessary to accurately characterize the microbial composition of root-filled teeth with periapical lesions

2 248 Gomes et al August 2006 Although molecular techniques, particularly the polymerase chain reaction (PCR) analysis, have been widely used to detect bacteria in primary endodontic infections, few studies have used this technique to investigate the microbiota of secondary endodontic infections. Recently, researchers have used PCR to investigate the microorganisms associated with failed endodontic treatment ,20 These authors have detected E faecalis in 77%, 67%, 64%, and 22% of the cases, respectively. Conversely, Rolph et al. 21 have not found E faecalis in any refractory cases using culture or molecular methods. Data concerning the molecular detection of E faecalis in secondary infections vary widely. Furthermore, few studies have used PCR to investigate the prevalenceof E faecalis inprimaryrootcanalinfections. 14,16 Therefore, the aim of this study was to investigate the presence of E faecalis in primary and secondary rootinfected canals with periapical lesions by both culture and PCR analyses. MATERIAL AND METHODS Patient selection A total of 100 patients in need of endodontic treatment were referred from the Dental School of Piracicaba, SP, Brazil. No study patient had received antibiotic treatment during the preceding 3 months or had a systemic disease. The Human Volunteers Research and Ethics Committee of the Dental School of Piracicaba approved the study, and all patients signed an informed consent. Clinical features Fifty teeth with no prior endodontic treatment had necrotic pulp (primary infection), and 50 teeth that had previously had root canal treatment but showed radiographic evidence of apical periodontitis (secondary infection) were used for sampling. Failure of root canal treatment was determined on the basis of clinical and radiographical examinations. Most of the teeth with secondary endodontic infection (45/50) had been root canal treated more than 4 years previously. In 5 cases, the teeth had been root filled more than 2 years previously and the patients presented persistent symptoms and/or discomfort to percussion. The previous root canal treatment of the teeth investigated in this study was carried out by unknown operators. Previous root fillings were classified as good if no voids were present and were within 2 mm of the radiographic apex. If one or more of these criteria were not met, they were classified as poor. 22 Similarly, coronal restorations were categorized as sound if they clinically and radiographically appeared intact; and as defective if there were open margins, fracture, or recurrent decay. Age, gender, tooth type, and pulp status were recorded for each patient. Clinical symptoms and signs included history of previous pain, tenderness to percussion, pain on palpation, mobility, presence of a sinus tract and its origin (endodontic or periodontal), presence of swelling of the periodontal tissues (i.e., acute abscess), probing depth of any periodontal pockets, history of previous and present antibiotic therapy and any other relevant medication, and the internal status of the canal such as dry canal or the presence of clear, hemorrhagic, or purulent exudates, detected as a distinct dampening or stain on the sampling paper points. Each type of exudate was analyzed separately and also grouped with the other types under the denomination wet canal. Sampling procedure The method followed for the microbiological procedures has been previously described Aseptic techniques were used throughout the endodontic sample acquisition. Briefly, after a 2-stage access cavity preparation, which was made under manual irrigation with sterile saline solution and employing sterile burs, the study teeth were individually isolated from the oral cavity with a rubber dam. Teeth and rubber dam were disinfected with 30% hydrogen peroxide followed by 2.5% sodium hypochlorite. The sterility of the operation field was checked after inactivation of the antiseptic solution with 5% sodium thiosulfate in order to avoid interferences in the results. Preexisting root canal fillings were removed using Gates Glidden drills (Maillefer, Ballaigues, Switzerland) and endodontic K- files without the use of chemical solvents. Irrigation with sterile saline solution was performed in order to remove any remaining treatment material prior to sample collection. Sampling included a single root canal, even in the multi-rooted teeth, in order to confine the microbial evaluation to a single ecological environment. The criteria used to choose the canal to be microbiologically investigated in the multirooted teeth were the presence of exudation, or in its absence, the largest canal or the canal associated with periapical radiolucency. Before sampling the selected canal of the multirooted teeth, the entrance of the others was closed with sterile cotton pellets. For microbial sampling, a sterile paper point was introduced into the full length of the root canal, as determined in a preoperative radiograph, and kept in place for 60 seconds. In the case of a dry root canal, a second paper point, moistened in sterile saline solution, was used to ensure adequate sample acquisition. In the case of a wet root canal, as many paper points as needed were employed to absorb all fluid inside the

3 Volume 102, Number 2 Gomes et al 249 canal. The canal orifice was flushed with nitrogen gas during sampling. The paper points were immediately transferred to a test tube containing 1 ml of the viability medium Götenberg agar (VMGA) III transport medium 27 and placed within 15 minutes inside an anaerobic workstation (Don Whitley Scientific, Bradford, UK). After thoroughly shaking the endodontic sample in a mixer for 60 seconds (Vortex, Marconi, São Paulo, SP, Brazil), 250 L of the transport medium was used for cultivation and 750 L, in 3 different vials (250 L each), was frozen at 70 o C for further molecular analyses. Microbial isolation and identification In summary, after vortexing, 250 L were diluted in brain heart infusion broth (BHI; Oxoid, Basingstoke, UK) by using a 10-fold serial dilution to Fifty microliters of each dilution was spread onto 5% defibrinated sheep blood BHI agar plates (Oxoid). The plates were incubated aerobically at 37 C. The same dilutions, also plated on 5% sheep blood BHI agar, were incubated at 37 C in anaerobic atmosphere. All aerobic cultures were examined at 24 to 48 hours, whereas anaerobic cultures were kept for at least 2 weeks but examined for growth every 3 days. From each bacterial plate, representative colonies of each morphologic type were subcultured. Pure cultures were initially characterized according to their Gram stain characteristic, ability to produce catalase, and gaseous requirements. Facultative gram-positive cocci, catalase negative, were then selected for further identification using the Rapid ID 32 Strep (Bio Merieux, Marcy-l Etoile, France). Miniapi software (BioMérieux) was used to automatically read ID 32 tests. In order to confirm their identity, all enterococcal strains were subjected to partial 16S rdna sequencing, and analyzed using the BLAST software of the National Center for Biotechnology Information (NCBI) for species determination. All strains were identified at the species level based on the E faecalis V583 genome sequence (ref. NC ), showing 100% of identity. Detection of E faecalis using PCR DNA was extracted according to Leys et al. 28 Briefly, 250 L of the sample were centrifuged at g for 30 seconds, after which the supernatant was removed and discarded. The pellet was suspended in 300 L of 50 mm Tris-HCl (ph 8.0)-1 mm EDTA- 1% sodium dodecyl sulfate. Proteinase K was added to a concentration of 1 mg/ml, and the sample was incubated at 37 C for 1 to 2 hours. The DNA was purified by the standard Geneclean (Bio 101, Inc., La Jolla, Fig. 1. Schematic representation of the prokaryotic ribosomal operon and the locations and orientations of the primers and resulting DNA fragments. Universal primers 785 and 422 were used to generate a DNA fragment in a first nonspecific amplification step, and species-specific primer and the universal primer L189 were used in a second amplification. Calif) protocol, with the addition of one additional washing step. This simplified purification method provided DNA of suitable integrity for PCR amplification. DNA isolated from the root canal specimens was first amplified with prokaryotic universal ribosomal 16S and 23S primers (785 and 422 respectively), as described elsewhere. 29,30 This amplification included the 16S rdna and the downstream intergenic spacer region (ISR). Inclusion of the ISR provided an additional check of the specificity of the primers, because the length of this region varies among species. PCR reactions were performed in a total volume of 50 L containing 1.25 U Taq DNA polymerase (Perkin- Elmer, Foster City, Calif), 5 L of10 PCR buffer plus 3 mm MgCl 2, 0.25 mm of each primer and 0.2 mm (each) deoxynucleoside triphosphates. For each sample, 0.5 L of extracted DNA was added to the reaction mixture. PCR was also performed using a positive control (0.5 L of DNA extracted from the E faecalis strain ATCC 29212) and a negative control (only the reaction mixture without DNA). Samples were subjected to 22 cycles of denaturation at 94 o C for 1 minute, annealing at 42 o C for 2 minutes, and primer extension at 72 o C for 3 minutes, and a final extension of 72 o C for 10 minutes, in an automated thermal cycler (Perkin-Elmer Cetus). E faecalis was then identified by a second, nested amplification with species-specific 16S primers paired with a universal primer located in the 23S gene (L189) (Fig. 1). The PCR reaction conditions were as follows: 27 cycles of 94 o C for 1 minute, 52 o C for 2 minute, and 72 o C for 3 minute. Similarly to the first amplification, positive and negative controls were used in the latter PCR reactions. Primer sequences are shown in Table I. All primers were synthesized by Biosynthesis (Lewisville, Tex).

4 250 Gomes et al August 2006 Table I. Primers used in this study Primers Specificity/ location/orientation Sequence ENFE Enterococcus faecalis/16s/forward GTCGCTAGACCGCGAGGTCATGA Sm785 Universal primer/16s/785 bp from 5 end/forward GGATTAGATACCCTGGTAGTC 422 Universal primer/23s/422 bp from 5 end/forward GGAGTATTTAGCTT L189 Universal primer/23s/forward GGTACTTABATGTTTCAGTTC PCR products were analyzed by 1% agarose gel electrophoresis, stained with ethidium bromide, and viewed under ultraviolet transilluminating light. A positive or negative identification was based on the presence of clear bands of the expected molecular size (831 bp)(fig.2)usinga21-kblambdadnaladder(invitrogen Corporation, Carlsbad, Calif). All assays were repeated, and if the results were not in agreement, they were repeated again. Primer specificity The species-specific primer in the 16S rdna coding region was selected based on previous investigation of endodontic bacteria by cloning and sequencing of the bacterial 16S gene 31 and on sequences available in GenBank. The species specificity was further confirmed by sequencing at least one PCR product from a clinical sample for the specific primer in an ABI Prism 310 automated sequencer (AME Bioscience Ltd, London, UK), as described by Rumpf et al. 32 and by comparing the sequence generated with those available in GenBank, using the BLAST software available via the Internet at Statistical analysis The data collected for each case (clinical features) were typed onto a spreadsheet and statistically analyzed using SPSS for Windows (SPSS Inc., Chicago, Ill). The Pearson 2 test or the 1-sided Fisher s exact test, as appropriate, was chosen to test the null hypothesis that there was no relationship between endodontic clinical symptoms and signs and the presence of E faecalis. RESULTS Some signs and symptoms were present in 100 canals (50 primary and 50 secondary infections, respectively), as follows: 45 cases with spontaneous pain (42/50 and 3/50); 56 with tenderness to percussion (41/50 and 15/50); 41 with pain to palpation (39/50 and 2/50); 30 with swelling (30/50 primary infections); and 21 with purulent exudates (19/50 and 2/50). Most teeth with necrotic pulps presented defective coronal restorations (21/50) or caries (19/50); 9 teeth had open root canals. Similarly, most teeth with previous root canal treatment had coronal leakage by defective coronal Fig. 2. Amplified E faecalis DNA fragments. The markers in lane 1 are EcoRI and HindIII digestion products of bacteriophage lambda DNA. The other lanes contain DNA amplified with E faecalis specific primer, which appears at 831 bp amplicon. Scoring for the presence of E faecalis ( or ) is indicated in the diagram above the gel. restorations (19/50), old temporary restorative materials (8/50), or coronally unsealed teeth (11/50). Upon radiographic examination, 17 teeth had good root fillings, while 33 had poorly obturated canals. All canals were fully negotiated before sampling. Microbial growth was achieved in 49 and 45 cases of primary and secondary infections, respectively. Culture and molecular methods identified E faecalis in 23 of 100 and 79 of 100 cases, respectively. Culture yielded E faecalis in 2 (4%) of 50 root canal samples from primary infections and in 21 (42%) of 50 root canal samples from secondary infections. In primary infections, E faecalis was always present in polymicrobial species, forming a small percentage of the total bacterial flora. In secondary infections, 14 of 21 cases in which E faecalis was found were in pure culture. PCR yielded the test microorganisms in, respectively, 41 (82%) of 50 and 38 (76%) of 50 of the

5 Volume 102, Number 2 Gomes et al 251 Fig. 3. Detection of E faecalis using culture and PCR techniques. primary and secondary root canals infections studied (Fig. 3). Based on culture results, significant associations were found between E faecalis and secondary infection (P.0001) and absence of symptomatology (P.01). However, such associations were not found when the PCR results were analyzed. DISCUSSION Culture versus PCR techniques In the present study, E faecalis was recovered from 23 of 100 and 79 of 100 root canals examined by culture and PCR analyses, respectively, showing a higher sensitivity of the PCR technique over the culture for detecting E faecalis from root canal samples. The reason for this finding possibly relies on the detection limit of both techniques used. The sensitivity of culture is approximately 10 4 to 10 5 cells for target species using nonselective media, while for PCR varies from 10 to 10 2 cells depending on the technique used. 33,34 For instance, the nested PCR take the detection limit down to about 10 cells. 33,34 Moreover, PCR can detect nonviable or viable but nonculturable cells (VBNC). 35 Presence of E faecalis in necrotic canals (primary infection) In teeth with necrotic pulps, E faecalis was rarely isolated by culture methods (4%), but frequently detected by PCR (82%). The possibility exists that E faecalis occurs in such a low numbers in necrotic pulps that it cannot be cultured from these samples. Earlier studies using culture methods have reported that E faecalis is not normally present or is present in very low numbers in the untreated canals. 1,2 The high prevalence of E faecalis in primary infection detected by PCR in this study is different from that reported in other molecular studies. The discrepancies may be caused by the different molecular techniques employed. Rôças et al. 14 and Fouad et al., 20 using 16S rdna primers, reported a smaller occurrence of E faecalis, 18% and 8% respectively. In the present study, the PCR amplification included the 16S rdna and the downstream intergenic spacer region (ISR). According to Leys et al., 28 specific regions of the 16S and 23S rdna gene flanking the spacer region are known to be highly conserved among prokaryotic species. Moreover, inclusion of the ISR may provide an additional check of the specificity of the primers, because the length of this region varies among species. Another reason that may have contributed for the high detection rate of E faecalis in the root canals by PCR is the coronal leakage. In this study, most of the teeth with necrotic pulp (49/50) had coronal leakage by defective coronal restorations, caries, or coronally unsealed teeth. Coronal microleakage may be one of the routes for the entrance of enterococci in the pulp space, iftheyarepresentelsewhereinthemouth.goldetal., 36 collecting samples from multiple oral sites reported the occurrence of E faecalis in 60% to 75% of the cases. These numbers fall within the rate of E faecalis detected by PCR in the root canals of teeth with microbial leakage analyzed in this study. Presence of E faecalis in endodontically treated teeth (secondary infection) Using culture procedures, E faecalis was frequently recovered from secondary infections, being found in 21 (46.6%) of 45 canals with bacterial growth. This finding agrees with those reported by Pinheiro et al., 6,7 Molander et al., 3 and Sundqvist et al., 2 who respectively found E faecalis in 53%, 45.8%, 47%, and 38% of previously root-treated canals with positive culture. Peciuliene et al. 4,5 recovered this microorganism from 70% and 64% of the cases, respectively, using culture techniques. However, it has been suggested that culture techniques may fail to detect bacteria in canals of root-filled teeth. This was confirmed in the present study where PCR techniques could detect a higher frequency of E faecalis (38/50) than culture (21/50). In root-filled canals, the number of microorganisms can be low and/or the number of microbial cells can be lost during the procedures to remove the previous root filling and debris. As a consequence, the number of cells sampled can be lower than the detection rate of the culture method. 13 Inthe present work, E faecalis was detected in 76% of root-filled teeth by PCR. Previous studies using molecular methods found E faecalis in 77%, 67%, and 64% of the cases, which strongly support our results. These findings disagree with those reported by Fouad et al., 20 who found this microorganism in 22% of unsuccessfully endodontically treated teeth. Moreover, Rolph et al. 21 have not found E faecalis in any of the canals investigated.

6 252 Gomes et al August 2006 In this study, the majority of teeth with previous root canal treatment had poorly obturated canals (33/50) or coronal leakage (38/50), or both. As discussed in the primary infection group, microbial leakage may also have contributed to the high detection of E faecalis in cases of secondary infections. In such cases, E faecalis was somewhat less prevalent (76%) by PCR when compared with primary infections (82%). It is possible that the coronal status of the teeth may have had an impact on the results, as the retreated group presented fewer teeth with coronal leakage (38/50) than the primary one (49/50). Final remarks Our study, using a nested PCR technique, showed that E faecalis is frequently detected not only in secondary endodontic infection but also in the primary infection. Therefore, E faecalis involved in the etiology of endodontic failure may be those originally present in the necrotic pulps that have survived to the chemomechanical procedures and intracanal medicaments, which caused ecological changes in the root canals. 1,25,37-40 Additionally, coronal microleakage, during or after treatment, may allow the entrance of enterococci strains into the root canal. In the present work, most of the teeth presented caries or defective restorations. The finding that E faecalis is frequently detected in primary and secondary endodontic infections should lead to the development of more effective antimicrobial strategies during root canal treatment and retreatment. It has been demonstrated that E faecalis is resistant to the antimicrobial effect of calcium hydroxide. 39,40 Therefore, other medicaments, such as chlorhexidine, either alone or associated with calcium hydroxide, have been proposed. 40,41 It is worthwhile to note that as important as the disinfection of the root canal and its complete obturation is the placement of a good coronal seal immediately after endodontic treatment to prevent microbial reinfection of the canal system. Although E faecalis is found in most cases of infected canals, its role, if any, in the pathogenesis of the periapical diseases associated with necrotic pulp or endodontic failure, remains to be elucidated. Finally, it should be emphasized that the PCR technique only detected the target species, but did not enumerate the total number of bacteria present in the samples. This points out the importance of considering, when using molecular assays, not only the presence of a specific microorganism but also the number of cells in a sample, in order to associate it with different types of endodontic infections. CONCLUSION E faecalis was detected as frequently in teeth with necrotic pulp as in teeth with failing endodontic treatment when a PCR analysis was used. REFERENCES 1. Sundqvist G. Ecology of the root canal flora. J Endod 1992;18: Sundqvist G, Fidgor D, Sjögren U. Microbiology analysis of teeth with endodontic treatment and the outcome of conservative retreatment. Oral Surg Oral Med Oral Pathol 1998;85: Molander A, Reit C, Dahlen G, Kvist T. Microbiological status of root-filled teeth with apical periodontitis. Int Endod J 1998; 31: Peciuliene V, Balciuniene I, Eriksen HM, Haapasalo M. Isolation of Enterococcus faecalis in previously root-filled canals in a Lithuanian population. J Endod 2000;26: Peciuliene V, Reynaud AH, Balciuniene I, Haapasalo M. Isolation of yeasts and enteric bacteria in root-filled teeth with chronic apical periodontitis. Int Endod J 2001;34: Pinheiro ET, Gomes BPFA, Ferraz CCR, Sousa ELR, Teixeira FB, Souza-Filho FJ. Microorganisms from canals of root filled teeth with periapical lesions. Int Endod J 2003;36: Pinheiro ET, Gomes BPFA, Ferraz CCR, Teixeira FB, Zaia AA, Souza-Filho FJ. Evaluation of root canal microorganisms isolated from teeth with endodontic failure and their antimicrobial susceptibility. Oral Microbiol Immunol 2003;18: Murray BE. The life and times of the Enterococcus. Clin Microbiol Rev 1990;3: Morrison D, Woodford N, Cookson B. Enterococci as emerging pathogens of humans. Soc Appl Bacteriol Symp Ser 1997; 26:89S-99S. 10. Smyth CJ, Matthews H, Halpenny MK, Brandis H, Colman G. Biotyping, serotyping dfsband phage typing of Streptococcus faecalis isolated from dental plaque in the human mouth. J Med Microbiol 1987;23: Wahlin YB, Holm AK. Changes in the oral microflora in patients with acute leukemia and related disorders during the period of induction therapy. Oral Surg Oral Med Oral Pathol 1988;65: Rams TE, Feik D, Young V, Hammond BF, Slots J. Enterococci in human periodontitis. Oral Microbiol Immunol 1992;7: Siqueira JF Jr, Rôças IN. Polymerase chain reaction-based analysis of microorganisms associated with failed endodontic treatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;97: Rôças IN, Siqueira Jr JF, Santos KRN. Association of Enterococcus faecalis with different forms of periradicular diseases. J Endod 2004;30: Rôças IN, Jung II-Y, Lee CY, Siqueira JF Jr. Polymerase chain reaction identification of microorganisms in previously root-filled teeth in a South Korean population. J Endod 2004;30: Fouad AF, Barry J, Caimano M, Clawson M, Zhu Q, Carver R, et al. PCR-based identification of bacteria associated with endodontic infections. J Clin Microbiol 2002;40: Conrads G, Gharbia SE, Gulabivala K, Lampert F, Shah HN. The use of a 16r DNA directed PCR for the detection of endodontopathogenic bacteria. J Endod 1997;23: Siqueira JF Jr, Rôças IN. PCR methodology as a valuable tool for identification of endodontic pathogens. J Dent 2003;31: Baumgartner JC, Siqueira JF Jr, Xia T, Roças IN. Geographical differences in bacteria detected in endodontic infections using polymerase chain reaction. J Endod 2004;30: Fouad AF, Zerella J, Barry J, Spangberg LSW. Molecular de-

7 Volume 102, Number 2 Gomes et al 253 tection of Enterococcus species in root canals of therapy-resistant endodontic infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005;99: Rolph HJ, Lennon A, Riggio MP, Saunders WP, MacKenzie D, Coldero L, et al. Molecular identification of microorganisms from endodontic infections. J Clin Microbiol 2001;39: Ray HA, Trope M. Periapical status of endodontically treated teeth in relation to the technical quality of the root filling and the coronal restoration. Int Endod J 1995;28: Gomes BPFA, Drucker DB, Lilley JD. Clinical significance of dental root canal microflora. J Dent 1996;24: Gomes BPFA, Drucker DB, Lilley JD. Association of endodontic signs and symptoms with particular combinations of specific bacteria. Int Endod J 1996;29: Gomes BPFA, Drucker DB, Lilley JD. Variations in the susceptibilities of components of the endodontic microflora to biomechanical procedures. Int Endod J 1996;29: Gomes BPFA, Pinheiro ET, Gadê-Neto CR, Sousa ELR, Ferraz CCR, Zaia AA, et al. Microbiological examination of infected dental root canals. Oral Microbiol Immunol 2004;19: Dahlén G, Pipattanagovit P, Rosling B, Möller AJR. A comparison of two transport media for saliva and subgingival samples. Oral Microbiol Immunol 1993;8: Leys EJ, Griffen AL, Strong SJ, Fuerst PA. Detection and strain identification of Actinobacillus actinomycetemcomitans by nested PCR. J Clin Microbiol 1994;32: McClellan DL, Griffen AL, Leys EJ. Age and prevalence of Porphyromonas gingivalis in children. J Clin Microbiol 1996;34: Kumar PS, Griffen AL, Barton JA, Paster BJ, Moeschberger ML, Leys EJ. New bacterial species associated with chronic periodontitis. J Dent Res 2003;82: Gomes BPFA, Griffen AL, Kumar PS, Pinheiro ET, Sousa ELR, Jacinto RC, et al. Molecular and culture analysis of bacteria in infected root canals. J Dent Res 2004;83:1040 SL (abstract). 32. Rumpf RW, Griffen AL, Wen BG, Leys EJ. Sequencing of the ribosomal intergenic spacer region for strain identification of Porphyromonas gingivalis. J Clin Microbiol 1999;37: Zambon JJ, Haraszthy VI. The laboratory diagnosis of periodontal infections. Periodontol ;7: Spratt DA. Significance of bacterial identification by molecular biology methods. Endod Topics 2004;9: Signoretto C, Lleo MM, Tafi MC, Canepari P. Cell wall chemical composition of Enterococcus faecalis in the viable but nonculturable state. Appl Environ Microbiol 2000;66: Gold OG, Jordan HV, van Houte J. Prevalence of enterococci in the human mouth and their pathogenicity in animal models. Arch Oral Biol 1975;20: Love MR. Enterococcus faecalis a mechanism for its role in endodontic failure. Int Endod J 2001;34: Siren EK, Haapasalo PP, Ranta K, Salmi P, Kerosuo ENJ. Microbiological findings and clinical treatment procedures in endodontic cases selected for microbiological investigation. Int Endod J 1997;30: Haapasalo M, Orstavik D. In vitro infection and disinfection of dentinal tubules. J Dent Res 1987;66: Gomes BP, Souza SF, Ferraz CC, Teixeira FB, Zaia AA, Valdrighi L, et al. Effectiveness of 2% chlorhexidine gel and calcium hydroxide against Enterococcus faecalis in bovine root dentine in vitro. Int Endod J 2003;36: Evans MD, Baumgartner JC, Khemaleelakul S, Xia T. Efficacy of calcium hydroxide: chlorhexidine paste as intracanal medication in bovine dentin. J Endod 2003;29: Reprint requests: Brenda P. F. A. Gomes, PhD, MSc, BDS Endodontia Faculdade de Odontologia de Piracicaba FOP-UNICAMP Avenida Limeira, 901 Piracicaba, SP, Brazil bpgomes@fop.unicamp.br