Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study
|
|
|
- Erica Hoover
- 5 years ago
- Views:
Transcription
1 Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria, 1:100 Glucagon Mouse K79bB10 Abcam, Cambridge, UK 1:2000 Enterovirus VP-1 peptide Mouse 5-D8/1 Novocastra, Newcastle Upon Tyne, UK 1:200 Interferon-alpha Mouse MMHA-3 PBL Biomedical Laboratories, 1:50 Piscataway, NJ Interferon-beta1 Rabbit - LifeSpan BioSciences, Seattle, WA 1:100 Interferon-gamma Rabbit - Santa Cruz Biotechnology, Santa Cruz, 1:50 CXCL10 Goat - R&D Systems, Minneapolis, MN 1:80 CXCR3/CD183 Mouse 1C6 BD Bioscience, San Jose, 1:50 MHC class I Mouse EMR8-5 HOKUDO Co., LTD., Sapporo, Japan 1:50 MHC class II Mouse TAL.1B5 Dako, Carpinteria, 1:30 TLR3 Rabbit - ABGENT, San Diego, 1:25 TLR4 Mouse 76B357.1 IMGENEX, SanDiego, 1:100 RIG-I/DDX58 Rabbit - Abcam, Cambridge, UK 1:200 MDA5 Goat - Abcam, Cambridge, UK 1:50 CD1a Mouse 010 Dako, Carpinteria, 1:50 CD4 Mouse IF6 Novocastra, Newcastle Upon Tyne, UK 1:50 CD8 Mouse C8/144B Dako, Carpinteria, 1:50 CD11c Rabbit EP1347Y Abcam, Cambridge, UK 1:100 CD56 Mouse 123C3 Dako, Carpinteria, 1:50 CD57 Mouse B321(NK-1) Abcam, Cambridge, UK 1:20 CD68 Mouse PG-M1 Dako, Carpinteria, 1:50 Foxp3 Rat PCH101 ebioscience, San Diego, 1:20 IL-18 Mouse 25-2G MBL, Nagoya, Japan 1:20 IL-18 Rabbit - MBL, Nagoya, Japan 1:200 IL-12 Mouse JJ07 Santa Cruz Biotechnology, Santa Cruz, 1:50 IL-12 Mouse R&D Systems, Minneapolis, MN 1:25 Fas Rabbit - Santa Cruz Biotechnology, Santa Cruz, 1:25 FasL Rabbit - Santa Cruz Biotechnology, Santa Cruz, 1:50 Cleaved caspase 3 Rabbit - Cell Signaling Technology, Danvers, 1:400 MA Cleaved caspase 8 Rabbit 18C8 Cell Signaling Technology, Danvers, 1:50 MA Cleaved caspase 9 Rabbit - Novus Biologicals, Littleton, CO 1:1000 RARRES3 Rabbit - Sigma, St. Louis, MO 1:250 IRF-7 Rabbit - Novus Biologicals, Littleton, CO 1:200
2 Supplementary Figure 1. Immunohistochemical staining in pancreas from non-diabetic controls (A-H) and patients with type 1 diabetes (I-L). A-D: Immunohistochemical staining of MDA5 (A), glucagons (B), insulin (C) and merged image of (D) of (A) (B) and (C) in pancreases of non-diabetic controls. The merged image (D) shows weak expression of MDA5 in a few alpha cells (arrowheads). E-H. Immunostaining for RIG-I (E), glucagons (F), insulin (G), merged image (H) of (E) (F) and (G) in nondiabetic controls. Hyper-expression of RIG-I is hardly observed. (I)-(J): Immunohistochemical staining of MDA5 (I) and merged image (J) of insulin (red) and MDA5 (green, arrowheads) in type 1 diabetic control pancreas. Similar to non-diabetic controls, weak expression of MDA5 in non-beta cells (green, arrowheads) was observed in type 1 diabetic control pancreas. (K), (L): Immunohistochemical staing of RIG-I (K) and CD 68 (L) in type 1 diabetic control pancreas showed no RIG-I expression in the CD68+mononuclear cell infiltrated islet.
3 Supplementary Figure 2. Immunohistochemical staining of the pancreas obtained from fulminant type 1 diabetes for enterovirus capsid protein (VP1)(A) and insulin (B). The merged image (C) shows positive staining for VP1 in beta cell and non-beta cells (x200, case 2). Non-diabetic control pancreas showed no staining for VP1 (D). Color balance of (C) is adjusted.
4 Supplementary Figure 3. Fas and Fas-ligand (FasL) expression in the pancreas of non-diabetic controls and type 1 diabetic controls. Fas was not stained in both non-diabetic controls and type 1 diabetic controls (A), (E). FasL-positive mononuclear cells (G) are infiltrated to the islet of type 1 diabetic controls, while FasL was not stained for the islet of non-diabetic controls (C). (B), (D), (F), (H): Immuno-histochemical staining for insulin.
5 Supplementary Figure 4. Immunohistochemical demonstration of RARRES3, activated caspase 8, caspase 9 and caspase 3 in the affected islets by fulminant type 1 diabetes. (A), (B), (C): Double-immunofluorescent staining for insulin (A) and RARRES3 (B)(x400, case2). A merged image (C) shows specific expression of RARRES3 in beta cells (arrowheads). Double-immunofluorescent staining for insulin (D) and activated caspase 8 (E) (x400, case1). The merged image (F) demonstrates that activated caspase 8 is expressed specifically in beta cells (arrowheads). Double-immunofluorescent staining for insulin (G) and activated caspase 9 (H) (x400, case1). The merged image (I) demonstrates that activated caspase 9 is expressed specifically in beta cells (arrowheads) (x400, case1). Double-immunofluorescent staining for insulin (J) and activated caspase 3 (K) (x400, case 1). The merged image (L) demonstrates that activated caspase 3 is expressed specifically in beta cells (arrowheads).
6 Supplementary Figure S5. Immunohistochemical staining of activated caspase 8, caspase 9 and caspase 3 in type 1 diabetic controls and autopsied non-diabetic controls. (A), (B), (C): Double-immunostaining for caspase 8 (A) and insulin (B) in type1 diabetic controls (x200). A merged image (C) shows weak staining in some islet beta cells. (D), (E), (F): Double-immunostaining for caspase 8 (D) and insulin (E) and merged image (F) in autopsied nondiabetic controls. Activated caspase 8 was not shown. (G), (H), (I): Double-immunostaining for caspase 9 (G) and insulin (H) in type1 diabetic controls (x200). A merged image (I) shows weak staining in some islet beta cells. (J), (K), (L): Double-immunostaining for caspase 9 (J) and insulin (K) and merged image (L) in autopsied nondiabetic controls. Activated caspase 9 was not shown. (M), (N), (O): Double-immunostaining for caspase 3 (M) and insulin (N) in type1 diabetic controls (x200). A merged image (O) shows weak staining in some islet beta cells. (P), (Q), (R): Double-immunostaining for caspase 3 (P), insulin (Q) and merged image (R) in autopsied nondiabetic controls. Activated caspase 3 was not shown.
SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
Supplemental Material to:
Landes Bioscience www.landesbioscience.com Supplemental Material to: Martinet et al. High endothelial venules (HEVs) in human melanoma lesions: Major gateways for tumor-infiltrating lymphocytes OncoImmunology
Supplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and
Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Primary Children s Hospital, Salt Lake City, UT, both
Supplementary Figure S1. DD2 reactivity on human tonsils and analysis of slandc proliferation. Sections are from a representative human tonsil (a-f;
Supplementary Figure S1. DD2 reactivity on human tonsils and analysis of slandc proliferation. Sections are from a representative human tonsil (a-f; n=10) and a representative M- TDLN (g-h; n=5) and stained
P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl
P-Akt Thr38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG Anti-α3 IgG V Fig. 1. 3 or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
npod Viral Workgroup IHC studies update Dr Sarah Richardson
npod iral Workgroup IHC studies update Dr Sarah Richardson sarah.richardson@pms.ac.uk 2 Task 1: Collated Results LABORATORY OPPC ID Disease Location of block D FFPE/ Frozen HIER Primary Antibody/ Dilution
Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF
Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF- 02341066 Assay IC 50 nm Selectivity Ratio d Biochemical Activity In Vitro c-met/hgfr enzyme (Ki, nm) a 4 NA Cellular Activity
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
CAN Resubmission SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION CAN-05-0686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
Mouse DCs were cocultured with ID8-ova lysates, matured and analyzed for CD11c. SIINFEKL-pentamer staining and mouse Treg cell phenoytyping
Supplementary Materials and Methods Detection of SIINFEKL-MHC Class I complex on mouse DCs Mouse DCs were cocultured with ID8-ova lysates, matured and analyzed for CD11c (clone N418, Armenian hamster IgG,
Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression
a b c DAPI YFP CC3 DAPI YFP PCNA DAPI YFP ph3 DAPI YFP KI67 e 6 Mitosis f 1 PCNA expression %ph3 + /YFP + n= 63 87 61 3 13 8 n= 15 3 9 1 5 %PCNA+/YFP+ 8 6 Supplementary Figure 1. Proliferation/apoptosis
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer
Supplementary Information Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer Grit S. Herter-Sprie, Shohei Koyama, Houari Korideck, Josephine Hai, Jiehui Deng, Yvonne Y. Li, Kevin A. Buczkowski,
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Figure S1. A Non-lesional Lesional
Figure S1 Non-lesional Lesional GEN1 Non-lesional GEN1 Lesional C Normal Negative control Figure S1. Dermal Populations of + cells are found in human skin. Immunohistochemistry for on fixed, frozen skin
Supporting Information
Supporting Information Soltani et al. 10.1073/pnas.1102715108 SI Experimental Procedures Evaluation of Mice and Drug Administration. IPGTT, insulin tolerance test, and glucagon tolerance test were performed
CAN Resubmission SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION CAN-5-686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)
Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses
Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified
U.S. ARMY MEDICAL RESEARCH INSTITUTE OF CHEMICAL DEFENSE
U.S. ARMY MEDICAL RESEARCH INSTITUTE OF CHEMICAL DEFENSE USAMRICD-TR-03-07 Optimization of Glial Fibrillary Acidic Protein Immunoreactivity in Formalinfixed, Paraffin-embedded Guinea Pig Brain Sections
Supplementary Figure 1
Supplementary Figure 1. (A) Representative confocal analysis of cardiac mesenchymal cells from nondiabetic (ND-CMSC) and diabetic (D-CMSC) immunostained with anti-h3k9ac and anti-h3k27me3 antibodies. Analysis
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
Islet-Expressed CXCL10 Promotes Autoimmune Destruction of Islet Isografts in Mice With Type 1 Diabetes
Diabetes Volume 66, January 2017 113 Christine Bender, 1 Selina Christen, 1 Klaus Scholich, 2 Monika Bayer, 1 Josef M. Pfeilschifter, 1 Edith Hintermann, 1 and Urs Christen 1 Islet-Expressed CXCL10 Promotes
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
ImageStream cytometer analysis. Cells were cultured as described above in vented-cap
ImageStream cytometer analysis. Cells were cultured as described above in vented-cap polypropylene tubes, stained with αcd66b-fitc, αm-dc8-pe and αcd56-pe-cy5.5 mabs, washed and fixed with 4 % (w/v) paraformaldehyde.
Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on
Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Johnson DB, Balko JM, Compton ML, et al. Fulminant myocarditis
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1175194/dc1 Supporting Online Material for A Vital Role for Interleukin-21 in the Control of a Chronic Viral Infection John S. Yi, Ming Du, Allan J. Zajac* *To whom
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
SUPPLEMENTARY DATA. Supplementary experimental procedures
Supplementary experimental procedures Glucose tolerance, insulin secretion and insulin tolerance tests Glucose tolerance test (GTT) and glucose stimulated insulin secretion (GSIS) was measured in over-night
Int J Clin Exp Pathol 2017;10(3): /ISSN: /IJCEP
Int J Clin Exp Pathol 2017;10(3):3671-3676 www.ijcep.com /ISSN:1936-2625/IJCEP0046381 Original Article Comparison of immunofluorescence and immunohistochemical staining with anti-insulin antibodies on
Sipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the
Supplementary information, Data S1 Materials and Methods Mice, Ad vectors and reagents Female C57BL/6 mice, 8-10 weeks of age, were purchased from Joint Ventures Sipper BK Experimental Animal Co. (Shanghai,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.
T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8
Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells. in the nasal mucosa. Suzana Radulovic MD, Mikila R Jacobson PhD,
Radulovic 1 1 2 3 Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells in the nasal mucosa 4 5 6 7 Suzana Radulovic MD, Mikila R Jacobson PhD, Stephen R Durham MD, Kayhan T Nouri-Aria
In vitro differentiation optimization Flow Cytometry
In vitro differentiation optimization The effect of various basal media formulations were examined during stages 3 4 of the differentiation protocol. For these studies, conditions were as described for
Supplementary Information
Supplementary Information Methods Lymphocyte subsets analysis was performed on samples of 7 subjects by flow cytometry on blood samples collected in ethylenediaminetetraacetic acid (EDTA)-containing tubes
Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
Supplementary information:
Supplementary information: Sterile inflammation as a factor in human male infertility: Involvement of Toll like receptor 2, biglycan and peritubular cells C. Mayer 1, M. Adam 1,2, L. Glashauser 1, K. Dietrich
Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
References. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan).
Detailed Methods Experiment I enos / mice were purchased from Jackson Laboratory (Bar Harbor, USA). C57BL/6J mice on the same genetic background were purchased from KBT Oriental (Hamamatsu, Japan). Eleven-week-old
CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
January 25, 2017 Scientific Research Process Name of Journal: ESPS Manuscript NO: Manuscript Type: Title: Authors: Correspondence to
January 25, 2017 Scientific Research Process Name of Journal: World Journal of Gastroenterology ESPS Manuscript NO: 31928 Manuscript Type: ORIGINAL ARTICLE Title: Thiopurine use associated with reduced
HIV-infected subjects were recruited from an ongoing clinic-based cohort (SCOPE)
SUPPLEMENTAL METHODS Populations studied HIV-infected subjects were recruited from an ongoing clinic-based cohort (SCOPE) based at the University of California, San Francisco. From this cohort, we recruited
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA; e Boone Pickens
Nanosomes carrying doxorubicin exhibit potent anticancer activity against human lung cancer cells Akhil Srivastava a,h,+, Narsireddy Amreddy a,h,+, Anish Babu a,h, Janani Panneerselvam a,h, Meghna Mehta
Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer.
Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer Pailler, et al Data Supplement Table S1. Numbers and Percentages of ALK-Rearranged
The prevalence of enteroviral vp1 immunostaining in pancreatic islets in human type 1 diabetes
The prevalence of enteroviral vp1 immunostaining in pancreatic islets in human type 1 diabetes S. J. Richardson, A. Willcox, A. J. Bone 1, A. K. Foulis 2, N. G. Morgan Institute of Biomedical and Clinical
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) (B) (C) (D) (E)
Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) Confocal images of septal olfactory epithelium of an adult Gγ8-sypGFP-tdTom mouse showing colocalization
Fas and Fas ligand expression in inflamed islets in pancreas sections of patients with recent-onset Type I diabetes mellitus
Diabetologia (1999) 42: 1332±1340 Ó Springer-Verlag 1999 Fas and Fas ligand expression in inflamed islets in pancreas sections of patients with recent-onset Type I diabetes mellitus M. Moriwaki 1, N. Itoh
Materials and Methods
280 Fujisawa et al. 5. In order to ascertain the biological signifi cance of CD56 epithelial cells found in the duct system, we made an immunohistochemical study of fetal and normal adult pancreatic tissues
Supplemental materials
Supplemental materials 1 Supplemental Fig. 1 Immunogram This immunogram summarizes patient clinical data and immune parameters at corresponding time points for Patient IMF-32. The top panel illustrates
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,
Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,
Enterovirus infection, CXC chemokine ligand 10 (CXCL10) and CXCR3 circuit: a mechanism of accelerated beta-cell failure in fulminant type 1 diabetes
Diabetes Publish Ahead of Print, published online July 29, 2009 Enterovirus infection, CXC chemokine ligand 10 (CXCL10) and CXCR3 circuit: a mechanism of accelerated beta-cell failure in fulminant type
Supplementary Figure 1
CD31 FN Supplementary Figure 1 a Multivariate Cox regression analysis of predicting factors for disease-free and overall survival in 435 HNSCC patients b FN staining in whole sections of HNSCC c FN expression
Supplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense
Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense Shida Yousefi, Jeffrey A. Gold, Nicola Andina, James J. Lee, Ann M. Kelly, Evelyne
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
ORE Open Research Exeter
ORE Open Research Exeter TITLE Expression of the enteroviral capsid protein VP1 in the islet cells of patients with type 1 diabetes is associated with induction of protein kinase R and downregulation of
TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes
Diabetes Volume 64, April 2015 1341 Subha Karumuthil-Melethil, 1 M. Hanief Sofi, 2 Radhika Gudi, 3 Benjamin M. Johnson, 2 Nicolas Perez, 1 and Chenthamarakshan Vasu 2,3 TLR2- and Dectin 1 Associated Innate
Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
Control of Glucose Metabolism
Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream
TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California
Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow
Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose
Categorical analysis of human T cell heterogeneity with One-SENSE
1 2 3 4 Supplementary Information Categorical analysis of human T cell heterogeneity with One-SENSE 5 6 Running title: T cell Analysis by One-SENSE 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26
CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions
CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions Yi Feng, Peng Cui, Xiaowei Lu, Brian Hsueh, Fredrik Möller Billig, Livia Zarnescu Yanez, Raju Tomer, Derek
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
Simultaneous blockade of PD-1 and VEGFR2 induces synergistic. Short title: Synergistic antitumour effect by dual blockade of PD-1 and VEGFR2
carticle Simultaneous blockade of PD-1 and VEGFR2 induces synergistic antitumour effect in vivo 1 Short title: Synergistic antitumour effect by dual blockade of PD-1 and VEGFR2 S. Yasuda 1, M. Sho 1, I.
Effect of glucose on beta cell proliferation and population size in organ culture of foetal and neonatal rat pancreases
J. Embryol. exp. Morph. 74, 303-312 (1983) 3Q3 Printed in Great Britain The Company of Biologists Limited 1983 Effect of glucose on beta cell proliferation and population size in organ culture of foetal
PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
Title Modified Western blotting for insulin and other diabetes-associated peptide hormones
Supplemental Figures Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao
Title. Author(s)Ikeshita, Shunji; Miyatake, Yukiko; Otsuka, Noriyuki. CitationExperimental and Molecular Pathology, 97(1): Issue Date
Title MICA/B expression in macrophage foam cells infiltrat Author(s)Ikeshita, Shunji; Miyatake, Yukiko; Otsuka, Noriyuki CitationExperimental and Molecular Pathology, 97(1): 171-175 Issue Date 2014-08
Supplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells
Chien 1 Supplementary information Manuscript: SREP-16-42480A Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by Repeated Stimulation of Antigen-Presenting B Cells Chien-Hui Chien 1, Hui-Chieh
Pathophysiological mechanisms involving aggressive islet cell destruction in fulminant type 1 diabetes
Endocrine Journal 2013, 60 (7), 837-845 Re v i e w Pathophysiological mechanisms involving aggressive islet cell destruction in fulminant type 1 diabetes Shoichiro Tanaka, Kaoru Aida, Yoriko Nishida and
CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer
CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,