Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
|
|
|
- Prudence Thomas
- 5 years ago
- Views:
Transcription
1 a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level % Control AAV mtm6sf-shrna mtm6sf-shrna6 mtm6sf-shrna8 6 P=.3 3 P=.4 x -6 Hepatic TG (mg/g) 4 Hepatic CE (mg/g) Plasma TG (mg/dl) 5 5 P=3.6x -8 Plasma Cholesterol (mg/dl) 5 5 P=. Supplementary Fig. Short hairpin RNA-mediated knockdown of Tm6sf in mice. (a) AAV vector alone or AAV expressing a shrna directed against mtm6sf mrna were injected into the tail veins of 8 week old chow-fed C57Bl/6J male mice (n=5/group). After two weeks, the mice were killed and the liver, white adipose tissue (WAT) and small intestine were harvested. Levels of Tm6sf mrna were measured using Real-Time PCR and normalized to m36b4 levels. The differences in mean expression levels were compared using a two sample t-test. (b) AAV expressing 3 different shrnas or AAV vector alone were injected intravenously into 8-week old chow-fed C57BL/6J male mice (n=6/group). All three shrnas were directed against mouse Tm6sf, but only shrna8 knocked down the levels of Tm6sf mrna with high efficiency in cultured cells. Two weeks after the injection, mice were fasted for 4 h, the livers were harvested and the levels of TM6SF mrna were measured using Real-Time PCR. Values were normalized to m36b4, and expressed relative to the mean value of the AAV-only treated mice. Plasma was collected in the same experiment and TG and cholesterol levels measured as described in Methods. Differences in mean expression levels were compared using a two-sample T-tests. Ct, cycle threshold value. Nature Genetics: doi:.38/ng.9
2 Supplementary Table Characteristics of Dallas Heart Study participants stratified by TM6SF (E67K) genotype. Characteristic EE a EK KK P-value b Total n 4, Female, n (%),389 (57.6) 5 (53.) 9 (69.).6 Ethnicity c, n (%) Non-Hispanic African-American,3 (53.) 6 (37.8) (5.4). - Non-Hispanic European-American,69 (8.) 74 (4.) (84.6) Hispanic 676 (6.3) 69 (6.3) ().35 Other 3 (.5) (4.7) ().9 Age, years (mean) 45 ± 44 ± 5 ±.73 Body-mass index, kg/m 9.6 (6-35) 8.5 (6-34) 3.8 (8-34).95 Diabetes d, n (%) 53 (.6) 37 (8.7) (6.7).4 Alcohol consumption e > g/day, n (%) 334 (8.) 48 (.4) (7.7).58 Lipid-lowering medication (statins), n (%) 359 (8.8) 33 (8.) ().7 HDL-cholesterol (mg/dl) 5.6 ± ± ± HOMA-IR (U) f 3. (-5).9 (-5) 4.6 (-8).5 Fasting glucose (mg/dl) g 9 (84-98) 9 (85-99) 94 (86-4).5 Gamma-glutamyl transpeptidate (IU/L) 3 (7-36) 4 (6-38) (-8).5 Bilirubin (mg/dl).5 (.4-.7).5 (.4-.7).6 (.5-.8).9 HTGC (%) h 3.5 (.9-6.7) 4.4 (.-9.9) 5.7 ( ) Values are median (interquartile range), mean ± s.d., or number (%). a Missense variant (E67K) in TM6SF. b P-values were calculated using linear regression for continuous variables (age, body-mass index, glucose, HOMA-IR) and logistic regression for categorical variables (gender, ethnicity, diabetes diagnosis, alcohol consumption, and use of lipid-lowering drugs). Regression models were adjusted for age, gender, ethnicity, and BMI (where appropriate). c Ethnicity was self-reported as described in the Methods. d Diabetes was defined as a self-reported diagnosis of diabetes, use of prescription medication, fasting glucose 6 mg/dl or nonfasting glucose mg/dl or HbAc 6.5%. e Alcohol consumption was self-reported. f HOMA-IR, homeostatic model assessment of insulin resistance was calculated as described in the Methods. g Diabetics excluded. h P-value after adjustment for HOMA-IR, alcohol consumption and covariates listed above. Nature Genetics: doi:.38/ng.9
3 Supplementary Table Conditional association analysis for variants in the chromosome 9 region including NCAN, TM6SF, SUGP, CILP, and PBX4 Locus SNP Median Hepatic TG % P P MAF SNP conditional on conditional P rs by genotype Beta Unconditional rs on SNP (%) NCAN rs863 (P9S) NCAN rs5755 (V548L) NCAN rs46537 (S838N) NCAN rs TM6SF rs (E67K) NA NA SUGP rs SUGP rs7756 (R9H) SUGP rs38388 (D4D) CILP, PBX4 rs CILP, PBX4 rs Variants within kb of the coding sequences of NCAN, TM6SF, and SUGP genotyped using the ExomeChip array, with a minor allele frequency of >.5%, and other variants at the 9p3 locus reported in previous GWAS, are listed in the table. Genotypes were coded as,, and for wild-type homozygotes, heterozygotes, and variant allele homozygotes, respectively. Each SNP was tested for association with hepatic TG content using linear regression including ancestry, age, gender, and BMI as covariates. Conditional analysis was also adjusted tor TM6SF rs genotype. NA, not applicable. Nature Genetics: doi:.38/ng.9
4 Supplementary Table 3 Association between TM6SF (E67K) and hepatic triglyceride content (HTGC), liver enzymes and plasma lipid levels in Dallas Heart Study participants stratified by TM6SF (E67K) genotype and (self-reported) ethnicity. Trait Ethnicity EE a EK KK P-value b HTGC (%) mean DHS 5.79 (.4) 8. (.6) 3. (.63) 5.7 x -8 Non-Hispanic African-American 4.78 (.7) 6.5 (.86).5 (-).58 Non-Hispanic European-American 5.86 (.5) 8.63 (.98) 5.4 (.3).7 x -6 Hispanic 8.35 (.4) 9.4 (.38) -.9 HTGC (%) median DHS 3.46 (-7) 4.49 (-) 5.7 (9-8) 5. x -5 Non-Hispanic African-American 3.5 (-5) 4.7 (-7).5 (-). Non-Hispanic European-American 3.5 (-7) 4.9 (-9) 6.87 (3-9).44 6 Hispanic 4.74 (3-) 6. (3-3) -.77 ALT (U) Non-Hispanic African-American ±. 3.3 ± ± NA.78 Non-Hispanic European-American 3.7 ± ± ± Hispanic 7.7 ± ± AST (U) Non-Hispanic African-American 4. ± ± ± NA.9 Non-Hispanic European-American 3.9 ± ±. 7.3 ± Hispanic 5.7 ± ± ALP (U) Non-Hispanic African-American 7.6 ± ±.3 6. ± NA.63 Non-Hispanic European-American 66.6 ± ± ± Hispanic 77. ± ± LDL (mg/dl) Non-Hispanic African-American 8. ± 37.7 ± ± NA.33 Non-Hispanic European-American.8 ± ± ± 4.. Hispanic 8.7 ± ± Triglyceride (mg/dl) Non-Hispanic African-American 7. ± ± ± NA.4 Non-Hispanic European-American 36. ± ± ± 68.6 Hispanic 49.6 ± ± HDL (mg/dl) Non-Hispanic African-American 5.6 ± 5 5 ± ± NA.85 Non-Hispanic European-American 49.7 ± ± ± Hispanic 46.4 ± ± Nature Genetics: doi:.38/ng.9
5 Values are median (interquartile range, st 3 rd quartile) or mean (s.e.m) for HTGC, and mean ± s.d. for all other traits. P-values for comparison of means were calculated using linear regression adjusted for age, gender, BMI and ancestry. P-values for median HTGC were determined using the Jonckheere-Terpstra rank test for trend. Ethnicity was self-reported as described in the Methods. Supplementary Table 4 Characteristics of the Dallas BioBank participants stratified by TM6SF (E67K) genotype. Characteristic EE a EK KK P-value b Total n 7,46, 57 - Female, n (%),65 (3.5) 345 (3.) 8 (3.6).7 Age, years 53± 54± 54±.69 Body-mass index, kg/m 6. (4-9) 6. (4-9) 6. (4-9).7 Diabetes c, n (%) 73 (.3) 7 (.4) (3.5).6 Lipid-lowering medication (statins), n (%) 443 (6.) 7 (6.3) 6 (.5).37 Fasting glucose (mg/dl) d 9 (87-98) 93 (88-99) 9 (86-96).4 Bilirubin (mg/dl).56 (.4-.76).56 (.4-.74).54 ( ).7 HDL-cholesterol (mg/dl) 57.± ± ±9.3.4 Values are median (interquartile range), mean ± s.d., or number (%). a Missense variant (E67K) in TM6SF. b P-values were calculated using linear regression for continuous variables (age, body-mass index, glucose, HOMA-IR) and logistic regression for categorical variables (gender, ethnicity, diabetes diagnosis, alcohol consumption, and use of lipid-lowering drugs). Regression models were adjusted for age, gender, and BMI, where appropriate. c Diabetes was defined as a self-reported diagnosis of diabetes by a physician, use of prescription medication, fasting glucose 6 mg/dl or non-fasting glucose mg/dl or HbAc 6.5%. e Alcohol consumption was self-reported. d Diabetics excluded. Nature Genetics: doi:.38/ng.9
6 Supplementary Table 5 Baseline characteristics of participants in the Copenhagen General Population Study and the Copenhagen City Heart Study combined (The Copenhagen Study), stratified by TM6SF (E67K) genotype. Characteristics EE EK a KK P-value b Total n 6,79, Age, years 58 (47-67) 58 (47-67) 56 (45-66). Female, n (%) 34,75 (56) 6,377 (55) 35 (57).7 Body mass index, kg/m 6 (3-8) 6 (3-8) 5 (3-8).4 Diabetes c 3,5 (5) 588 (5) 34 (6).4 Physical activity c 8,858 (48) 5,459 (47) 67 (49).6 Alcohol consumption c,874 (8),4 (8) 3 (9).3 Gamma-glutamyltransferase, U/L 8 (-4) 8 (-4) 8 (-4).6 Bilirubin, μmol/l (8-3) (8-3) (8-4).87 Lipid-lowering therapy c (statins), n (%) 5,693 (9),3 (9) 45 (8).3 HDL (mg/dl) 6. ± ± ± Values are median (interquartile range), mean ± s.d., or number (%). a Missense variant (E67K) in TM6SF. b P-values were calculated using Kruskal-Wallis analysis of variance or Pearson s χ -test. c Diabetes, physical activity in leisure time, alcohol consumption, and lipid-lowering therapy were self-reported, dichotomized, and defined as diabetes (self-reported disease, use of insulin, use of anti-diabetic medication, and/or non-fasting plasma glucose >. mmol/l) versus no diabetes, physical activity (four hours or more per week of light physical activity in leisure time versus less than four hours), alcohol consumption (>4/ versus 4/ units per week in women/men; unit=g alcohol), and use of lipid-lowering drugs (yes/no), mainly statins (>97%). Nature Genetics: doi:.38/ng.9
7 Supplementary Table 6. Primers used for amplication using the polymerase chain reaction Sequence Amplified Forward Primer Reverse Primer TM6SF-rs GCATGGCACCAGCAGGTA CCTGCACCATGGAAGGCAAATA Mouse TM6SF cdna 3 CCTCGGTGGTGGACCTTGT 4 TCCTTGGTGTAGAAATCCATGAAG Human TM6SF cdna 5 GGCTGCCTATGCTCTCACCTT 6 TGCCTCCAGCAAACACCAA Nature Genetics: doi:.38/ng.9
Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC
Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT
A total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in
Supplemental Material The N342S MYLIP polymorphism is associated with high total cholesterol and increased LDL-receptor degradation in humans by Daphna Weissglas-Volkov et al. Supplementary Methods Mexican
Supplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
SITA 100 mg (n = 378)
Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)
Supplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups
Supplemental Table S1: Unadjusted and Adjusted Hazard Ratios for Diabetes Associated with Baseline Factors Considered in Model 3 SMART Participants Only Unadjusted Adjusted* Baseline p-value p-value Covariate
Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with
Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti
ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Table S1. Characteristics associated with frequency of nut consumption (full entire sample; Nn=4,416).
Table S1. Characteristics associated with frequency of nut (full entire sample; Nn=4,416). Daily nut Nn= 212 Weekly nut Nn= 487 Monthly nut Nn= 1,276 Infrequent or never nut Nn= 2,441 Sex; n (%) men 52
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic
Supplementary Information The title of the manuscript Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic stroke Xin-Wei He 1, Wei-Ling Li 1, Cai Li
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
Supplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Supplementary Table 1. Association of rs with risk of obesity among participants in NHS and HPFS
Supplementary Table 1. Association of rs3826795 with risk of obesity among participants in NHS and HPFS Case/control NHS (1990) HPFS (1996) OR (95% CI) P- value Case/control OR (95% CI) P- value Obesity
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Supplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplementary Online Content
Supplementary Online Content Leibowitz M, Karpati T, Cohen-Stavi CJ, et al. Association between achieved low-density lipoprotein levels and major adverse cardiac events in patients with stable ischemic
LEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME
LEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME Diana A. Chirinos, Ronald Goldberg, Elias Querales-Mago, Miriam Gutt, Judith R. McCalla, Marc Gellman and Neil Schneiderman
Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures
Supplementary Data Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures Quintiles of Systolic Blood Pressure Quintiles of Diastolic Blood Pressure Q1 Q2
Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
Supplemental Table 1. Components of MDS and AHEI
Supplemental Table 1. Components of MDS and AHEI MDS AHEI Vegetable Fruit SSB & fruit juice Nut Legume Whole grain Fish Red meat MUFA/SAT ratio EPA & DHA PUFA Trans-fat Alcohol Sodium MDS: Mediterranean-style
The classical metabolic work-up, approved by the Ethics Committee of the Antwerp
SUPPLEMENTARY MATERIALS METHODS Metabolic work-up The classical metabolic work-up, approved by the Ethics Committee of the Antwerp University Hospital and requiring written informed consent, included a
Pair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
CONTENT SUPPLEMENTARY FIGURE E. INSTRUMENTAL VARIABLE ANALYSIS USING DESEASONALISED PLASMA 25-HYDROXYVITAMIN D. 7
CONTENT FIGURES 3 SUPPLEMENTARY FIGURE A. NUMBER OF PARTICIPANTS AND EVENTS IN THE OBSERVATIONAL AND GENETIC ANALYSES. 3 SUPPLEMENTARY FIGURE B. FLOWCHART SHOWING THE SELECTION PROCESS FOR DETERMINING
Know Your Number Aggregate Report Single Analysis Compared to National Averages
Know Your Number Aggregate Report Single Analysis Compared to National s Client: Study Population: 2242 Population: 3,000 Date Range: 04/20/07-08/08/07 Version of Report: V6.2 Page 2 Study Population Demographics
Supplementary Online Content
Supplementary Online Content Lotta LA, Stewart ID, Sharp SJ, et al. Association of genetically enhanced lipoprotein lipase mediated lipolysis and low-density lipoprotein cholesterol lowering alleles with
ALKA VITA DIABETES TEST
ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O
A loss-of-function variant in CETP and risk of CVD in Chinese adults
A loss-of-function variant in CETP and risk of CVD in Chinese adults Professor Zhengming CHEN Nuffield Dept. of Population Health University of Oxford, UK On behalf of the CKB collaborative group (www.ckbiobank.org)
Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations
Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations Kouichi Ozaki 1, Hiroshi Sato 2, Katsumi Inoue 3, Tatsuhiko Tsunoda 4, Yasuhiko
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Supplementary Online Content
Supplementary Online Content Pedersen SB, Langsted A, Nordestgaard BG. Nonfasting mild-to-moderate hypertriglyceridemia and risk of acute pancreatitis. JAMA Intern Med. Published online November 7, 2016.
indicated in shaded lowercase letters (hg19, Chr2: 217,955, ,957,266).
Legend for Supplementary Figures Figure S1: Sequence of 2q35 encnv. The DNA sequence of the 1,375bp 2q35 encnv is indicated in shaded lowercase letters (hg19, Chr2: 217,955,892-217,957,266). Figure S2:
Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance
Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,
EFFECT OF OBESITY ON INSULIN RESISTANCE AND HBA1C IN TYPE 2 DIABETIC PATIENTS AND ITS RELATIONS WITH FTO GENE SNP (RS )
wjpmr, 2019, 5(1), 226-231 SJIF Impact Factor: 4.639 Research Article WORLD JOURNAL OF PHARMACEUTICAL AND MEDICAL RESEARCH ISSN 2455-3301 www.wjpmr.com WJPMR EFFECT OF OBESITY ON INSULIN RESISTANCE AND
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
![Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.](/thumbs/90/103696086.jpg "Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.")
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
殧 KCNJ11 11 KCNJ11 8 KCNJ11 P < KCNJ11 HDL-C. TT CT t = P =
47 2 2018 3 JOURNAL OF HYGIENE RESEARCH Vol. 47 No. 2 Mar. 2018 237 1000-8020 2018 02-0237-05 檾檾檾檾 DANONE INSTITUTE CHINA Young Scientists' Forum 檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾檾 KCNJ11 1 252059 11 KCNJ11
Letter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes *
814 Biomed Environ Sci, 2016; 29(11): 814-817 Letter to the Editor Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes * ZHANG Lu 1,^,
Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis
Supplementary Material Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis Kwangwoo Kim 1,, So-Young Bang 1,, Katsunori Ikari 2,3, Dae
Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group
Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,
SUPPLEMENTARY DATA. 1. Characteristics of individual studies
1. Characteristics of individual studies 1.1. RISC (Relationship between Insulin Sensitivity and Cardiovascular disease) The RISC study is based on unrelated individuals of European descent, aged 30 60
For more information about how to cite these materials visit
Author(s): Kerby Shedden, Ph.D., 2010 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Share Alike 3.0 License: http://creativecommons.org/licenses/by-sa/3.0/
Supplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Ahlqvist E, Storm P, Käräjämäki A, et al. Novel
Nonalcoholic fatty liver disease
TM6SF2: Catch-22 in the Fight Against Nonalcoholic Fatty Liver Disease and Cardiovascular Disease? Nonalcoholic fatty liver disease (NAFLD) is rapidly becoming the most common cause of chronic liver disease
DIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
Expanded View Figures
Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old
Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
The association between white blood cell subtypes and prevalence and incidence of nonalcoholic fatty liver disease
834477EJI0010.1177/2058739219834477European Journal of InflammationZhang et al. letter2019 Letter to the Editor The association between white blood cell subtypes and prevalence and incidence of nonalcoholic
Impact Of Gain-Of-Function Mutations In The Low-Density Lipoprotein Receptor Related Protein 5 (lrp5) On Glucose And Lipid Homeostasis
Yale University EliScholar A Digital Platform for Scholarly Publishing at Yale Yale Medicine Thesis Digital Library School of Medicine January 2014 Impact Of Gain-Of-Function Mutations In The Low-Density
Types of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline
INTRODUCTION TO BIOSTATISTICS FOR GRADUATE AND MEDICAL STUDENTS Files for today (June 27) Lecture and Homework Descriptive Statistics and Graphically Visualizing Data Lecture #2 (1 file) PPT presentation
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency
AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,
Gender: M Chart No: Fasting: Yes. Boston Heart HDL Map TM Test 1 ApoA-I (mg/dl) levels in HDL particles. α Range > <14 mg/dl. α-2 50.
Pro vider: Ordering Provider 123 Main Street Anytown, ST 12345 Account No: DOB: 00/00/1950 Framingham Risk Score: Patient Info: FAMILY HIST CVD Lipid, Lipoprotein and Apolipoprotein Tests Total Cholesterol
Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.
Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Gaudet D, Brisson D, Tremblay K, et al. Targeting APOC3 in
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer
Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer risk in stage 1 (red) and after removing any SNPs within
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Socioeconomic inequalities in lipid and glucose metabolism in early childhood
10 Socioeconomic inequalities in lipid and glucose metabolism in early childhood Gerrit van den Berg, Manon van Eijsden, Francisca Galindo-Garre, Tanja G.M. Vrijkotte, Reinoud J.B.J. Gemke BMC Public Health
Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels.
Supplementary Online Material Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels. John C Chambers, Weihua Zhang, Yun Li, Joban Sehmi, Mark N Wass, Delilah Zabaneh,
ALT and aspartate aminotransferase (AST) levels were measured using the α-ketoglutarate reaction (Roche,
Supplemental Methods Analytical determinations ALT and aspartate aminotransferase (AST) levels were measured using the α-ketoglutarate reaction (Roche, Basel, Switzerland). Glucose, triglyceride, total
Supplementary Online Content
Supplementary Online Content Anagnostou E, Aman MG, Handen BL, et al. Metformin for treatment of overweight induced by atypical antipsychotic medication in young people with autistic spectrum disorder:
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
Big Data Training for Translational Omics Research. Session 1, Day 3, Liu. Case Study #2. PLOS Genetics DOI: /journal.pgen.
Session 1, Day 3, Liu Case Study #2 PLOS Genetics DOI:10.1371/journal.pgen.1005910 Enantiomer Mirror image Methadone Methadone Kreek, 1973, 1976 Methadone Maintenance Therapy Long-term use of Methadone
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Study No.: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
Tables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
Statin therapy in patients with Mild to Moderate Coronary Stenosis by 64-slice Multidetector Coronary Computed Tomography
Statin therapy in patients with Mild to Moderate Coronary Stenosis by 64-slice Multidetector Coronary Computed Tomography Hyo Eun Park 1, Eun-Ju Chun 2, Sang-Il Choi 2, Soyeon Ahn 2, Hyung-Kwan Kim 3,
Statistical Analysis Plan FINAL. DexComG4 (DexCom Corporation) CGMMDI GOLD-Study
1.0 Page 1 of 15 FINAL DexComG4 (DexCom Corporation) CGMMDI GOLD-Study monitoring (CGM) in individuals with type 1 diabetes treated 2016-07-07 Approvals Name/Title: Nils-Gunnar Pehrsson / Statistiska Konsultgruppen,
The role of physical activity in the prevention and management of hypertension and obesity
The 1 st World Congress on Controversies in Obesity, Diabetes and Hypertension (CODHy) Berlin, October 26-29 2005 The role of physical activity in the prevention and management of hypertension and obesity
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
By: Dr Mehrnoosh Shanaki
Resveratrol could partly improve the crosstalk between canonical β-catenin/wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: A case control study By: Dr Mehrnoosh Shanaki
Supplementary Figures
Supplementary Figures Supplementary Fig 1. Comparison of sub-samples on the first two principal components of genetic variation. TheBritishsampleisplottedwithredpoints.The sub-samples of the diverse sample
LIPOPROTEINE ATEROGENE E ANTI-ATEROGENE ATEROGENE
LIPOPROTEINE ATEROGENE E ANTI-ATEROGENE ATEROGENE Sebastiano Calandra Dipartimento di Scienze Biomediche Università di Modena e Reggio Emilia Incidence Rate/1000 200-150 - 100-50 - Women 0 Men
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
Supplementary Figure 1. Principal components analysis of European ancestry in the African American, Native Hawaiian and Latino populations.
Supplementary Figure. Principal components analysis of European ancestry in the African American, Native Hawaiian and Latino populations. a Eigenvector 2.5..5.5. African Americans European Americans e
Rare Variant Burden Tests. Biostatistics 666
Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls
ClinialTrials.gov Identifier: HOE901_4020 Insulin Glargine Date: Study Code: This was a multicenter study that was conducted at 59 US sites
These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription Sponsor/company: Generic drug name:
~550 founders
Lipid GWAS in the Amish: New Insights into Old Genes Coleen M. Damcott, PhD Assistant Professor of Medicine Division of Endocrinology, Diabetes and Nutrition Program in Genetics and Genomic Medicine University
JUPITER NEJM Poll. Panel Discussion: Literature that Should Have an Impact on our Practice: The JUPITER Study
Panel Discussion: Literature that Should Have an Impact on our Practice: The Study Kaiser COAST 11 th Annual Conference Maui, August 2009 Robert Blumberg, MD, FACC Ralph Brindis, MD, MPH, FACC Primary
Learning Objectives. Disclosures. Self Assessment Questions. Background
Association of Hyperuricemia with Liver Dysfunction amongst Adults with Metabolic Disorders in the United States: A Cross Sectional Study Disclosures Dr. Prashant Sakharkar and Dr. Subrata Deb declare(s)
Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism
Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao