Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Size: px
Start display at page:

Download "Tissue factor-par2 signaling promotes diet-induced obesity and adipose"

Transcription

1 Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya Samad 1,3 1 Department of Cell Biology, Torrey Pines Institute for Molecular Studies, San Diego, CA, USA. 2 Department of Immunology and Microbial Science, The Scripps Research Institute, La Jolla, CA, USA. 3 Correspondence to Wolfram Ruf, ruf@scripps.edu and Fahumiya Samad, fsamad@tpims.org 1

2 Supplementary Figure 1: Regulation of body mass by TF-PAR2 signaling. (a) TF-PAR2 signaling regulates body weights on a normal diet. Body weights of week old male mice on a low fat chow diet showed no effect of PAR1-deficiency (F2r -/- mice) versus WT controls. F2rl1 -/-, TF ΔCT, and TF ΔCT /F2rl1 -/- mice weighed significantly less than WT mice; mean ± SD, n = 6-12; *** P < for WT versus knock-out mice. (b) Reduced adipose tissue mass in HFD F2rl1 -/- and TF ΔCT mice. Mice were sacrificed after 16 weeks on a HFD and organ weights were normalized to body weights. Mean ± SD, n = 6-12; * P < 0.05 for WT versus knock-out mice. 2

3 Supplementary Figure 2: Glucose homeostasis in WT and knock-out mice. (a, b) Glucose tolerance and insulin tolerance tests for WT or TF ΔCT mice on a HFD for 16 weeks; mean ± SD, n = 15; *P <0.05, **P<0.01, ***P<0.001 WT versus TF ΔCT. (c, d) Glucose tolerance and insulin tolerance tests of WT, F2rl1 -/-, and TF ΔCT /F2rl1 -/- mice on a HFD; mean ± SD, n= 8; # P<0.05, ## P<0.01, ### P<0.001 for WT versus TF ΔCT /F2rl1 -/- *P<0.05, **P<0.01, ***P<0.001 for WT versus F2rl1 -/-. 3

4 Supplementary Figure 3: TF expression in macrophages from BM transplanted mice. Lethally irradiated WT mice were reconstituted with BM from WT, TF ΔCT or F2rl1 -/- mice. After 6 weeks of recovery, mice were fed a HFD for at least 16 weeks and SVF cells were obtained by collagenase digestion of the epididymal VAD. (a) Gates of CD11b + /F4/80 + and CD11b + /CD11c + macrophages in the SVF fraction from WT mice transplanted with the indicated BM. (b) TF mean fluorescence of CD11b + /CD11c + cells from chimeras with the indicated BM; mean ± SD, n = 3. 4

5 Supplementary Figure 4: Improved glucose homeostasis in mice with a TF-PAR2 signalingdeficient BM compartment. Glucose tolerance (a) and insulin tolerance (b) tests in WT mice BM transplanted with WT, TF ΔCT or F2rl1 -/- BM after 16 weeks on a HFD; mean ± SD, n = 10-14, *P<0.05, **P<0.01 for WT versus knock-out BM chimeras. 5

6 Supplementary Figure 5: Control experiments for TFKI BM chimeras and antibody 21E10 therapy. HFD-induced weight gain (a) and insulin tolerance test (b) of chimeric WT mice reconstituted with BM from WT (n = 7) or human TF knock-in (TFKI) mice; mean ± SD, n = 12. (c) Insulin tolerance test in TF ΔCT mice on a HFD for 16 weeks was performed 24 hours after injection of 20 mg per kg body weight of antibody 21E10 to mouse TF or control antibody; mean ± SD, n = 4. 6

7 Supplementary Figure 6: Contribution of TF-PAR2 signaling to metabolism and energy expenditure. Food intake, activity, O 2 consumption and CO 2 output, and respiratory exchange ratio (RER) in WT versus TF ΔCT (a) or F2rl1 -/- (b) mice after 16 weeks on a HFD. Note that the presented data in these panels and in Fig. 4 of the main manuscript were not normalized for body weights. Normalization for body weights showed that both, TF ΔCT and F2rl1 -/- mice (c) as well as BM chimeras of these strains carrying WT BM (d) have significantly increased VO 2 and VCO 2 relative to WT controls; mean ± SD, n = 5; *P<0.05, **P < 0.01 different from WT control. With the understanding that such normalization may underestimate energy expenditure of more obese WT mice, these data indicate that TF ΔCT and F2rl1 -/- mice are protected from obesity due to a common mechanism of increased energy expenditure. 7

8 Supplementary Figure 7: Specificity of antibody 21E10 for mouse TF. Rat monoclonal antibody 21E10 was generated by immunizing rats with recombinant mouse TF extracellular domain and screening for reactivity with mouse, but not human TF. Antibody 21E10 dose-dependently inhibited TF-VIIa mediated FX activation by mouse adipocytes (left panel), but did not inhibit Xa generation by relipidated recombinant human TF (right panel). Inhibition with anti-human TF antibody 5G9 is shown as a positive control; mean ± SD, n = 3. 8

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly, 1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates

More information

An introduction to the COCVD Metabolic Phenotyping Core

An introduction to the COCVD Metabolic Phenotyping Core An introduction to the COCVD Metabolic Phenotyping Core Capabilities and procedures Manager: Wendy S. Katz, Ph.D. University of Kentucky Medical Center Department of Pharmacology 577 Charles T. Wethington

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171 SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)

More information

University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba

University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check

More information

Supplementary Figures

Supplementary Figures Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,

More information

TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin

TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin D ward Number: W81XH--1-497 TITLE: dipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin PRINCIPL INVESTIGTOR: Dr. Fahumiya Samad CONTRCTING ORGNIZTION: La Jolla

More information

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

Adipocyte SIRT1 Controls Systemic Insulin Sensitivity by Modulating Macrophages in Adipose Tissue

Adipocyte SIRT1 Controls Systemic Insulin Sensitivity by Modulating Macrophages in Adipose Tissue Manuscript EMBO-2016-43184 Adipocyte SIRT1 Controls Systemic Insulin Sensitivity by Modulating Macrophages in Adipose Tissue Xiaoyan Hui, Mingliang Zhang, Ping Gu, Kuai Li, Yuan Gao, Donghai Wu, Yu Wang,

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation ORIGINAL ARTICLE STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation Anca D. Dobrian, 1 Elena V. Galkina, 2 Qian Ma, 1 Margaret Hatcher, 1 Sabai Myo Aye, 1 Mathew

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

La Jolla, CA Approved for Public Release; Distribution Unlimited

La Jolla, CA Approved for Public Release; Distribution Unlimited AD Award Number: TITLE: Suppression of Breast Cancer Progression by Tissue Factor PRINCIPAL INVESTIGATOR: Wolfram Ruf, M.D. CONTRACTING ORGANIZATION: The Scripps Research Institute La Jolla, CA 92037 REPORT

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Fawaz G. Haj Associate Professor Diagnosed Obesity and Diabetes for Adults aged 20 years in United States

More information

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan Supplementary Methods Animal models We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan or Jackson Laboratories. All mice were housed under a 12-h light-dark cycle and allowed

More information

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water

More information

Regulation of adipose tissue remodeling by peripheral serotonin

Regulation of adipose tissue remodeling by peripheral serotonin Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin

TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin AD Award Number: W81XWH-05-1-0497 TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin PRINCIPAL INVESTIGATOR: Fahumiya Samad CONTRACTING ORGANIZATION:

More information

Does PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model

Does PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model Does PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model Susan M. Smith Nutrition Research Institute University of North Carolina at Chapel Hill C57Bl/6J Teklad 8626 Mouse Model of PAE Our

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Expanded View Figures

Expanded View Figures Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice

Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti

More information

Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control

Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control Jan Trost Prof. Gudrun A. Brockmann Humboldt Universität zu Berlin Department of Crop and Animal Sciences Breeding Biology and Molecular

More information

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the

More information

pplementary Figur Supplementary Figure 1. a.

pplementary Figur Supplementary Figure 1. a. pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective

More information

Metabolic Calculations

Metabolic Calculations Metabolic Calculations Chapter 5 and Appendix D Importance of Metabolic Calculations It is imperative that the exercise physiologist is able to interpret test results and estimate energy expenditure. Optimizing

More information

Pearson r = P (one-tailed) = n = 9

Pearson r = P (one-tailed) = n = 9 8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

More information

HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance

HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance FEBS Letters 585 (2011) 2285 2290 journal homepage: www.febsletters.org HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance Ha-Jung Kim a, Hong-Min

More information

NMED-A65251A. Supplementary Figures.

NMED-A65251A. Supplementary Figures. NMED-A65251A Supplementary Figures. Sup. Fig. 1. ILC3 cells are the main source of in obese mice a. We gated on T cells (upper panels) or T cells (lower panels), and examined production. b. CD45 + - IL-13

More information

Cystinosis Research Foundation Progress Report. Energy homeostasis and muscle wasting in nephropathic cystinosis. Final Report

Cystinosis Research Foundation Progress Report. Energy homeostasis and muscle wasting in nephropathic cystinosis. Final Report Cystinosis Research Foundation Progress Report Energy homeostasis and muscle wasting in nephropathic cystinosis Principle Investigator: Robert Mak, MD, PhD Institution: University of California, San Diego

More information

Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice

Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice ACTA ACADEMIAE MEDICINAE SINICAE 410011 0731-85295846 lixia2014@vip. 163. com 4 C57BL /6 20-1 mrna 20 P < 0. 05 O 20 P > 0. 05 M2 P < 0. 05-1 mrna P < 0. 05 P > 0. 05 R589. 2 DOI 10. 3881 /j. issn. 1000-503X.

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: TITLE: Suppression of Breast Cancer Progression by Tissue Factor PRINCIPAL INVESTIGATOR: Wolfram Ruf, M.D. CONTRACTING ORGANIZATION: The Scripps Research Institute La Jolla, CA 92037 REPORT

More information

RAGE Regulates the Metabolic and Inflammatory Response to High-Fat Feeding in Mice

RAGE Regulates the Metabolic and Inflammatory Response to High-Fat Feeding in Mice 1948 Diabetes Volume 63, June 2014 Fei Song, 1 Carmen Hurtado del Pozo, 1 Rosa Rosario, 1 Yu Shan Zou, 1 Radha Ananthakrishnan, 1 Xiaoyuan Xu, 2 Payal R. Patel, 3 Vivian M. Benoit, 3 Shi Fang Yan, 1 Huilin

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy

More information

Data supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity

Data supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity Data supplement Netrin- promotes adipose tissue macrophage accumulation and insulin resistance in obesity Bhama Ramkhelawon, Elizabeth J Hennessy, Mickaël Ménager 2, Tathagat D. Ray, Frederick J Sheedy,

More information

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G

More information

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Authors: Georgios K. Paschos, Salam Ibrahim, Wen-Liang Song, Takeshige Kunieda, Gregory Grant, Teresa M. Reyes, Christopher

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

Why Obesity Is A Chronic Disease

Why Obesity Is A Chronic Disease Why Obesity Is A Chronic Disease Arya M Sharma, MD, FRCP(C) Professor of Medicine Chair in Obesity Research & Management University of Alberta Edmonton, AB, Canada www.drsharma.ca Global Obesity Map 2014

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from

More information

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )

More information

Successful completion of Phase I clinical trial of AMPK activator O304

Successful completion of Phase I clinical trial of AMPK activator O304 Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination

More information

SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong, X; Gua, J; Xu, A. Citation Nature Communications, 2017, v. 8, p.

SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong, X; Gua, J; Xu, A. Citation Nature Communications, 2017, v. 8, p. Title mediates adaptive thermogenesis by promoting intracellular activation of thyroid hormones in brown adipocytes Author(s) SHU, L; Hoo, RLC; WU, X; PAN, Y; LEE, PC; CHEONG, LY; Bornstein, SR; Rong,

More information

Adipocyte/macrophage fatty acid binding proteins contribute to metabolic deterioration through actions in both macrophages and adipocytes in mice

Adipocyte/macrophage fatty acid binding proteins contribute to metabolic deterioration through actions in both macrophages and adipocytes in mice Research article Adipocyte/macrophage fatty acid binding proteins contribute to metabolic deterioration through actions in both macrophages and adipocytes in mice Masato Furuhashi, Raquel Fucho, Cem Z.

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Food Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Food Intake Regulation & the Clock Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Circadian disruption affect multiple organ systems: The diagram provides examples of how circadian disruption

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

Reviewer #1 (Remarks to the Author)

Reviewer #1 (Remarks to the Author) Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Chapter 12. Ingestive Behavior

Chapter 12. Ingestive Behavior Chapter 12 Ingestive Behavior Drinking a. fluid compartments b. osmometric thirst c. volumetric thirst Eating a. energy sources b. starting a meal c. stopping a meal d. eating disordersd Drinking a. fluid

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

CCR7 Maintains Nonresolving Lymph Node and Adipose Inflammation in Obesity

CCR7 Maintains Nonresolving Lymph Node and Adipose Inflammation in Obesity 2268 Diabetes Volume 65, August 2016 Jason Hellmann, 1 Brian E. Sansbury, 1 Candice R. Holden, 2 Yunan Tang, 2 Blenda Wong, 1 Marcin Wysoczynski, 2 Jorge Rodriguez, 3 Aruni Bhatnagar, 2 Bradford G. Hill,

More information

Supplementary figure 1 (related to fig 1)

Supplementary figure 1 (related to fig 1) Histological score linical Score Weight loss (%) olon length (cm) Supplementary figure (related to fig ) N ### ## ays on % E ### - - - - N ays on % $$ $$ # ## N. N N Supplementary figure : Lack of fibre

More information

Investigating Massage as a Complementary Therapy for Weight Loss By Morgan J Lawless, LMT

Investigating Massage as a Complementary Therapy for Weight Loss By Morgan J Lawless, LMT Investigating Massage as a Complementary Therapy for Weight Loss By Morgan J Lawless, LMT Obesity and excess body fat in The United States is a growing health risk to many Americans. The Center for Disease

More information

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic

More information

Supplementary Information

Supplementary Information Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu

More information

PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes

PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes Sébastien Bolze 1 ; Sophie Hallakou-Bozec 1 ; Michael Roden 2, 3,4 ; Julien Roux

More information

Combined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer

Combined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer Supplementary Information Combined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer Gi-Hoon Nam, Eun-Jung Lee, Yoon Kyoung Kim, Yeonsun Hong, Yoonjeong Choi,

More information

Osteopontin mediates obesity-induced adipose tissue macrophage infiltration and insulin resistance in mice

Osteopontin mediates obesity-induced adipose tissue macrophage infiltration and insulin resistance in mice Research article Osteopontin mediates obesity-induced adipose tissue macrophage infiltration and insulin resistance in mice Takashi Nomiyama, 1 Diego Perez-Tilve, 2 Daisuke Ogawa, 1 Florence Gizard, 1

More information

Industrialized Food Components and Obesity Risk. Kylie Kavanagh, VMS MS MPH Department of Pathology

Industrialized Food Components and Obesity Risk. Kylie Kavanagh, VMS MS MPH Department of Pathology Industrialized Food Components and Obesity Risk Kylie Kavanagh, VMS MS MPH Department of Pathology Overview Role of science in policy development Components versus calories Past lessons (trans fat) Present

More information

Bile acid receptor FXR: metabolic regulator in the gut. Sungsoon Fang

Bile acid receptor FXR: metabolic regulator in the gut. Sungsoon Fang Bile acid receptor FXR: metabolic regulator in the gut Sungsoon Fang Nuclear hormone receptor 1905: Ernest Starling coined hormone 1929: Estrogen structure 1958: Estrogen receptor by Elwood Jensen 1985:

More information

Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas Summary

Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas Summary Published in "" which should be cited to refer to this work. Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas http://doc.rero.ch Laboratory of Metabolic Stress Biology, Division

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Chapter 1, Part A: Biological background of obesity, insulin resistance and dyslipidemia

Chapter 1, Part A: Biological background of obesity, insulin resistance and dyslipidemia General introduction The introduction to this thesis consists of two parts. The first part gives an overview of the current concepts and developments regarding obesity and insulin resistance, as well as

More information

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.

More information