Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4. glucose metabolism in mice.
|
|
- Dwayne Pearson
- 5 years ago
- Views:
Transcription
1 Role of the ventromedial hypothalamic Steroidogenic Factor 1/ Adrenal 4 Binding Protein neurons in the regulation of whole body energy and glucose metabolism in mice. Eulalia Coutinho Department of Physiological Sciences, School of Life Science, SOKENDAI (The Graduate University for Advanced Studies) September
2 INTRODUCTION: The hypothalamus is the brain center which communicates with the periphery to control autonomic pathways which regulate energy intake, expenditure and storage. It is made up of different nuclei: arcuate hypothalamus (ARC), dorsomedial hypothalamus (DMH), lateral hypothalamus (LH), paraventricular hypothalamus (PVH) and the ventromedial hypothalamus (VMH), etc. The VMH was the first hypothalamic region found to play a crucial role in body weight regulation and energy homeostasis. The VMH came to be known as the 'satiety center' because studies showed that VMH lesions resulted in hyperphagia and obesity. Electrical stimulation of the VMH suppressed feeding behavior and decreased food intake in rats. Researchers also found that electrical or chemical stimulation of the VMH increased glucose uptake in peripheral tissues like skeletal muscle and brown adipose tissue. The VMH has glucosensing neurons which have been well studied. VMH neurons also have receptors for hormones like leptin and insulin and sense and integrate these hormones to regulate food intake and metabolism. Microinjection of leptin into the VMH increased glucose uptake by the skeletal muscle and brown adipose tissue (BAT) through the sympathetic nervous system. The VMH consists of different neuron populations characterized by the expression of either steroidogenic factor-1 (SF-1), brain derived neurotrophic factor (BDNF), pituitary adenylate cyclase activating polypeptide (PACAP) or cerebellin 1 (Cbln1). SF-1 neurons are concentrated in the dorsomedial part of the VMH and play a key role in the development of VMH structure as well as expression of other genes. Its indispensable role in the development of the VMH and the effect of its knockout on body weight regulation has shed light on the importance of SF-1 neurons in energy homeostasis. Most of the studies demonstrating the importance of SF-1 neurons in the regulation of body weight, food intake and glucose metabolism deleted a key receptor or signaling molecule from SF-1 neurons. However, deletion of a key receptor or signaling molecule could interfere with the normal development of the VMH and its neuronal circuit, which in turn, could be responsible for the 2
3 reported results. Also, the effect of specific activation or inhibition of SF-1 neurons is unknown. Therefore, in my research, I examined the effect of activation or inhibition of VMH specific SF-1 neurons on energy and glucose metabolism. I used the DREADD system, to activate or inhibit SF-1 neurons. 3
4 MATERIALS AND METHODS: SF-1 Cre-recombinase transgenic (SF-1 Cre Tg) mice were obtained from The Jackson Laboratory [STOCK Tg(Nr5a1-cre)7Lowl/J]. Bilateral steel cannualae were implanted to twelve-fourteen weeks old SF-1 Cre Tg mice targeting the VMH. The stereotaxic coordinates obtained from the Atlas by Franklin and Paxinos, were AP 1.32 (1.32 mm anterior to the bregma), H 5.72 (5.72 mm below the surface of the skull above bregma) and L 0.3 (0.3 mm lateral to bregma on either sides). Surgery for catheter implantation into the jugular vein and carotid artery was carried out 3 days before day of clamp. Catheters were flushed daily after surgery to prevent clotting in the catheters. Two weeks after VMH cannulation, DREADD (hm3dq and hm4di) AAV vectors (500 nl) were microinjected to both sides at the rate of 50 nl/ min. To activate the DREADD, clozapine-n-oxide (CNO) (Enzo Life Sciences, New York, USA) was injected into AAV infected mice intraperitoneally. On another day, same mice were injected saline and used as a control, except for hyperinsulinemic-euglycemic clamp and 2-[ 14 C] Deoxyglucose uptake experiments. For these experiments, wild-type mice obtained from SF-1 Cre Tg breeding and injected with saline was used as control mice. Food intake was measured for 3 hours after overnight fasting and during the start of dark period. Total energy expenditure and respiratory quotient (RQ) were measured by indirect calorimetry with use of gas analysis consisting CO2 and O2 mass spectrometric analyzer (Arco-2000, Arco system, Chiba, Japan). Locomotor activity (cm/min) was simultaneously measured with force plate system that was set below the cage (Actracer-2000, Arco system). Energy expenditure and the amount of carbohydrate or fat oxidized were calculated from O2 consumption (VO2) and CO2 production (VCO2) as described previously. Equations for those calculations were as follows: Energy expenditure (cal/min) = VO VCO2 Carbohydrate oxidation (cal/min) = [(4.51 VCO2) - (3.18 VO2)] 4.1 Lipid oxidation (cal/min) = [1.67 (VO2 - VCO2)] 9.3 4
5 Mice were acclimated to the special cages for 3 days prior to measurement. During this period, body weight and food intake were measured to ensure acclimatization. On the day of the experiment, saline or CNO was injected and VO2, VCO2 and locomotor activity were measured every minute. The data were averaged for every consecutive 5 minutes and summarized for 1 hour. For insulin tolerance tests (ITT), food was removed 1 hour before the start of the test. At time (t) = -30 (minutes), saline or clozapine-n-oxide (CNO) (Enzo Life Sciences) was injected into mice expressing DREADD (hm3dq or hm4di) in the VMH, intraperitoneally. At t = 0, insulin (1U/kg, Sigma-Aldrich Japan, Tokyo, Japan) was injected intraperitoneally. Blood glucose was measured at t = -30, 0, 15, 30, 60 and 90 using One Touch glucometer (Life Scan Japan, Johnson & Johnson, Tokyo, Japan). The hyperinsulinemic-euglycemic clamp protocol was performed in conscious and unrestrained mice. Insulin (2.5mU/kg/min) was infused to induce hyperinsulinemia. In order to maintain the euglycemia, 30% glucose was infused. For assessment of glucose uptake, 2-[ 14 C] Deoxyglucose (2DG) was injected intravenously. An arterial blood sample (40 µl) was collected at t = 0, 5, 15, 25, 35, 45 after injection of 2DG. Immediately after collection of the final blood sample, mice were killed with an overdose of pentobarbital sodium, and the soleus, red and white part of the gastrocnemius, inguinal white adipose tissue (Inguinal WAT), BAT, spleen, heart, and liver were rapidly dissected and immediately dropped in liquid N2 for immunoblot analysis and 2DG uptake measurement. For immunoblot analysis, tissues were homogenized on ice in 20mM Tris (ph 7.4), 5mM EDTA (ph8.0), 10mM sodium pyrophosphate, 1% Triton X, phosphatase inhibitor (Calbiochem, San Diego, USA) and proteinase inhibitor (Sigma-Aldrich Japan). The homogenates were centrifuged, and the resulting supernatants (20µg of protein) were fractionated by SDS-PAGE. Immunoblot analysis was then carried out with specific antibodies. Immune complexes were visualized with horseradish peroxidase conjugated secondary antibodies (Santa Cruz Biotechnology, Santa Cruz, USA) and 5
6 enhanced chemiluminescence reagents (GE Healthcare, Tokyo, Japan). Protein bands were quantified using CS analyzer software (Atto Corporation, Tokyo, Japan). Total RNA was isolated from each tissue with the use of Trizol (Life Technologies Japan, Tokyo, Japan), and portions of the RNA (400 ng) were subjected to reverse transcription with an oligo dt primer and avian myeloblastosis virus reverse transcriptase (Takara, Shiga, Japan). The resulting cdna was measured and was subjected to qpcr. For qpcr, cdna was amplified using SYBR Green PCR Mix and dye (Takara) with an ABI 7500 real-time PCR system. Data were normalized by the amount of 36B4. All animal experiments were performed in accordance with institutional guidelines for the care and handling of experimental animals and they were approved by the Institutional Animal Care and Use Committee (IACUC) of the National Institutes of Natural Sciences (NINS). Data are as means ± standard error of the mean (SEM). Statistical comparisons among multiple groups and between 2 groups were performed by analysis of variance (ANOVA) followed by Tukey's HSD post hoc test, and Student s t test, respectively. A P value of <0.05 was considered statistically significant. 6
7 RESULTS SF-1 Cre Tg mice expressed cre recombinase in the VMH, pituitary gland, adrenal glands and gonads. I examined posthumous brain sections from DREADD AAV infected mice and they showed expression of DREADD-mCherry only in the VMH. CNO injection into hm3dq expressing SF-1 Cre Tg (hm3dq) mice activated SF-1 neurons, while CNO injection into hm4di expressing SF-1 Cre Tg (hm4di) mice inhibited SF-1 neurons. Since the VMH and its SF-1 neurons have been suggested to play a role in food intake regulation, I measured 3 hours food intake after overnight fasting in hm3dq and hm4di mice. CNO injection to hm3dq mice decreased the 3 hours food intake compared to control saline injection. CNO injection to hm4di mice didn t alter its food intake. I also measured the food intake for the first 3 hours of dark period. CNO decreased food intake during the dark period in hm3dq mice. However, there was no change in food intake in hm4di mice. Both these results indicate that activation of SF-1 neurons decreased food intake, while inhibition of SF-1 neurons did not alter food intake. Next, I measured energy expenditure, respiratory quotient (RQ) and locomotor activity using the Arco system. Prior to the start of experiment, I kept the mice in the metabolic cages to acclimatize them to the cages. On the day of measurement, I injected saline or CNO at 9:00 into hm3dq mice and measured energy expenditure, RQ and locomotor activity for 5 hours post injection. RQ, which is the ratio of the volume of CO2 produced by the volume of O2 consumed was also measured and calculated. CNO injection to hm3dq mice increased the energy expenditure compared to the control saline injection. CNO injection showed a tendency to decrease locomotor activity compared to saline injection. CNO injection into hm3dq mice decreased the RQ significantly. From the VO2 and VCO2, I calculated the energy from carbohydrate oxidation or fat oxidation using formulas mentioned in materials and methods. CNO injection increased fat oxidation whereas there was no change in carbohydrate oxidation. I also measured energy expenditure in hm4di mice during the dark period. 7
8 CNO injection to hm4di mice did not alter energy expenditure. There was also no change in locomotor activity in hm4di mice after CNO. These results suggest that increased energy expenditure on activation of SF-1 neurons was due to increased fatty acid oxidation and independent of locomotor activity. Conversely, inhibition of SF-1 neurons didn t alter energy expenditure or locomotor activity. Furthermore, CNO injection to hm3dq mice increased insulin sensitivity and improved insulin tolerance during ITT. In contrast, injection of CNO into hm4di mice impaired insulin tolerance during ITT. During hyperinsulinemic-euglycemic clamp, SF-1 neuronal activation significantly increased glucose infusion rate required to maintain euglycemia. In accordance, activation of SF-1 neurons also enhanced insulin-induced suppression of gene expression of rate-limiting gluconeogenic enzymes like glucose 6 phosphatase (G6Pase) and phosphoenol pyruvate carboxykinase (PEPCK) in the liver significantly. Activation of SF-1 neurons showed a tendency to increase glucose uptake by the red type skeletal muscle under basal insulin levels. However under hyperinsulinemia, SF-1 neuronal activation greatly increased insulin-stimulated glucose uptake in red type skeletal muscle. I found an increase in phosphorylation of Akt (a key molecule in insulin signaling) in the soleus muscle of hm3dq mice, further demonstrating an increase in insulin sensitivity in the muscle under hyperinsulinemia. 8
9 DISCUSSION The occurrence of metabolic diseases like obesity and diabetes has been on the rise globally, becoming a serious health problem worldwide. Imbalances in whole body energy and glucose homeostasis are closely linked to the trend of increased obesity and diabetes. Therefore, understanding the centralperipheral pathways and molecular and cellular mechanisms underlying energy balance, glucose homeostasis, and insulin sensitivity is critical for developing new strategies for the prevention and treatment of metabolic diseases including obesity and diabetes. In my study, using a pharmacogenetic method DREADD system, I found that activation of SF-1 neurons decreased food intake, whereas inhibition of SF-1 neurons didn t affect food intake. I also found that activation of SF-1 neurons increased energy expenditure. I found that activation of SF- 1 neurons decreased RQ, suggesting an increase in fat oxidation. Consistently, activation of SF-1 neurons increased fat oxidation, while carbohydrate oxidation was unchanged. In the case of inhibition of SF-1 neurons, O2 consumption, locomotor activity was unchanged. Furthermore, activation of SF-1 neurons improved insulin tolerance during ITT. In contrast, inhibition of SF-1 neurons impaired insulin tolerance during ITT. Activation of SF-1 neurons also enhanced GIR to keep plasma glucose level and insulin-stimulated glucose uptake by red type skeletal muscle and suppression of hepatic gluconeogenic genes expression during hyperinsulinemiceuglycemic clamp. In summary, my data suggest that SF-1 neurons in the VMH play key roles in the regulation of food intake, energy expenditure, peripheral insulin sensitivity and glucose metabolism. These results support the idea that SF-1 neurons in the VMH are a crucial neuronal population for whole-body metabolism and suggest that through its activity, it regulates energy balance and glucose homeostasis. 9
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationSupplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
More informationBMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
More informationFor pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
More information7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?
7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationMotivation 1 of 6. during the prandial state when the blood is filled
Motivation 1 of 6 I. INTRODUCTION A. Motivation: a condition (usually internal) that initiates, activates, or maintains goal-directed behavior. B. Archery analogy 1. undrawn bow has no potential energy
More informationIntroduction. Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet
Leptin secretion after a high-fat meal in normal-weight rats: strong predictor of long-term body fat accrual on a high-fat diet - Diet - Activity - Genetics etc. Introduction Obesity - Cardiovascular disease
More informationTBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationRole of fatty acids in the development of insulin resistance and type 2 diabetes mellitus
Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating
More informationInsulin-Leptin Interactions
Insulin-Leptin Interactions Ahmed S., Al-Azzam N., Cao B. Karshaleva B., Sriram S., Vu K. If you understand a system, you can predict it. Agenda - Energy homeostasis Overview of leptin and insulin Signaling
More informationHypothalamus. Small, central, & essential.
Hypothalamus Small, central, & essential. Summary: You can t live without a hypothalamus. Located at the junction between the brain stem and the forebrain Medial hypothalamus: interface between the brain
More informationEnergy Metabolism and Body Temperature
Energy Metabolism and Body Temperature Hui-ping Wang( 王会平 ), PhD Dept. of Physiology, Zhejiang University School of Medicine wanghuiping@zju.edu.cn Part I Energy metabolism Definition The metabolic processes
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationDivision of Hypothalamic Research, Departments of Internal Medicine and
1 5-HT 2C Rs Expressed by Pro-opiomelanocortin Neurons Regulate Insulin Sensitivity in Liver Yong Xu 1, 3*, Eric D. Berglund 1*, Jong-Woo Sohn 1, William L. Holland 2, Jen-Chieh Chuang 1, Makoto Fukuda
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationLeptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings
More information! acts via the autonomic nervous system. ! maintaining body weight within tight limits. ! ventromedial (VMN) ! arcuate (ARC) ! neuropeptide Y (NPY)
Brain Regulates energy homeostatis Glucose Sensing in the Brain Seminar 2012 Gareth Price! acts in response to circulating signals of nutrient states! acts via the autonomic nervous system Ensures a balance
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons
Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),
More informationInternal Regulation II Energy
Internal Regulation II Energy Reading: BCP Chapter 16 lookfordiagnosis.com Homeostasis Biologically, what is necessary for life is a coordinated set of chemical reactions. These reactions take place in
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationChronic Stimulation of Leptin on Food Intake and Body Weight after Microinjection into the Ventromedial Hypothalamus of Conscious Rats
TAJ December 2006; Volume 19 Number 2 ISSN 1019-8555 The Journal of Teachers Association RMC, Rajshahi Original Article Chronic Stimulation of Leptin on Food Intake and Body Weight after Micro into the
More informationTitle: Obesity in mice with adipocyte-specific deletion of clock component Bmal1
Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Authors: Georgios K. Paschos, Salam Ibrahim, Wen-Liang Song, Takeshige Kunieda, Gregory Grant, Teresa M. Reyes, Christopher
More informationSupplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and
Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and
More informationCNS Control of Food Intake. Adena Zadourian & Andrea Shelton
CNS Control of Food Intake Adena Zadourian & Andrea Shelton Controlling Food Intake Energy Homeostasis (Change in body adiposity + compensatory changes in food intake) Background Information/Review Insulin
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationChapter 1, Part A: Biological background of obesity, insulin resistance and dyslipidemia
General introduction The introduction to this thesis consists of two parts. The first part gives an overview of the current concepts and developments regarding obesity and insulin resistance, as well as
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationEffect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
More information(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,
1 Supplemental methods cute insulin challenge: For assay of biochemical responses to insulin stimulation, we 3 4 6 7 8 9 1 anesthetized mice after a 6- h fast. We ligated vessels supplying one side of
More informationAnalysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue
Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is
More informationTable 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1
Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2
More informationglucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationHomeostasis and Mechanisms of Weight Regulation
Homeostasis and Mechanisms of Weight Regulation Purpose In this activity students will investigate how negative feedback mechanisms function to maintain homeostatic balance using a recently discovered
More informationCHAPTER 50 Endocrine Systems. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
CHAPTER 50 Endocrine Systems Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Endocrine system All the endocrine glands and other organs with hormonesecreting
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationRoger J. Davis. Metabolic Stress Signaling by the JNK Pathway
Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )
More informationChapter 12. Ingestive Behavior
Chapter 12 Ingestive Behavior Drinking a. fluid compartments b. osmometric thirst c. volumetric thirst Eating a. energy sources b. starting a meal c. stopping a meal d. eating disordersd Drinking a. fluid
More informationIngestive Behavior: Feeding & Weight Regulation. Hypovolemic vs. Osmotic Thirst
Ingestive Behavior: Feeding & Weight Regulation 1 Hypovolemic Thirst Receptors, CNS, Responses Salt Appetite Digestive components Glucose Homeostasis: Insulin & Glucagon Diabetes Mellitus 1 & 2 CNS Hypothalamic
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationTanycytes as gatekeepers of the Metabolic Brain
Tanycytes as gatekeepers of the Metabolic Brain Vincent Prevot Inserm team Development and Plasticity of the Postnatal Brain Jean-Pierre Aubert Research Centre, U837, Lille France Metabolic signals and
More informationArcuate neuropeptide Y inhibits sympathetic nerve activity via multiple neuropathways
Arcuate neuropeptide Y inhibits sympathetic nerve activity via multiple neuropathways Zhigang Shi,, Christopher J. Madden, Virginia L. Brooks J Clin Invest. 2017;127(7):2868-2880. https://doi.org/10.1172/jci92008.
More informationLeptin and Insulin Sensitivity. John Joseph Dubé. BS, Shenandoah University, MS, James Madison University, 1997
Leptin and Insulin Sensitivity by John Joseph Dubé BS, Shenandoah University, 1995 MS, James Madison University, 1997 Submitted to the Graduate Faculty of Health and Physical Activity, in partial fulfillment
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.
Supplementary Figure 1 Splenic atrophy and leucopenia caused by T3 SCI. (a) Gross anatomy of representative spleens from control and T3 SCI mice at 28 days post-injury. (b and c) Hematoxylin and eosin
More informationCentral insulin and leptin-mediated autonomic control of glucose homeostasis
Review Central insulin and leptin-mediated autonomic control of glucose homeostasis Joseph S. Marino 1,2, Yong Xu 4 and Jennifer W. Hill 1,2,3 1 Center for Diabetes and Endocrine Research, College of Medicine,
More informationEntrainment of the mouse circadian clock by sub-acute physical and psychological
Supplementary Information Entrainment of the mouse circadian clock by sub-acute physical and psychological Yu Tahara 1, Takuya Shiraishi 1, Yosuke Kikuchi 1, Atsushi Haraguchi 1, Daisuke Kuriki 1, Hiroyuki
More informationAMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic
More informationSupplementary Materials. Experimental Procedures. Low alpha-synuclein levels in the blood are associated with Insulin Resistance.
Supplementary Materials Experimental Procedures. Low alpha-synuclein levels in the blood are associated with Insulin Resistance. Gerardo Rodriguez-Araujo 1, Hironori Nakagami 2,Yoichi Takami 4, Tomohiro
More informationChp. 17 FUNCTIONAL ORG. Char.of the Endocrine System
Chp. 17 FUNCTIONAL ORG. Char.of the Endocrine System Glands that secrete chemical signals (hormones) into circulatory system Hormone characteristics Produced in small quantities Secreted into intercellular
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
More informationMotivation and Emotion deals with the drives and incentives behind everyday thoughts and actions.
Motivation and Emotion deals with the drives and incentives behind everyday thoughts and actions. Motivation- A need or desire that energizes and directs behavior primarily based on our instincts that
More informationNeuro-Physiology Kamal Mohammed Lecturer Of Physiology LECTURE NO (-) Hypothalamus. Faculty Of Medicine Dept.Of Physiology
LECTURE NO (-) Neuro-Physiology Kamal Mohammed Lecturer Of Physiology Hypothalamus Faculty Of Medicine Dept.Of Physiology Hypothalamus Less than 1% of the brain mass Many connect the hypothalamus to the
More informationLeptin and the Central Nervous System Control of Glucose Metabolism
Physiol Rev 91: 389 411, 2011; doi:10.1152/physrev.00007.2010. Leptin and the Central Nervous System Control of Glucose Metabolism GREGORY J. MORTON AND MICHAEL W. SCHWARTZ Diabetes and Obesity Center
More informationROLE OF VENTROMEDIAL HYPOTHALAMUS ON ENERGY HOMEOSTASIS IN ALBINO RATS: EFFECT OF GENDER
Indian J Physiol Pharmacol 2012; 56(2) : 107 116 ROLE OF VENTROMEDIAL HYPOTHALAMUS ON ENERGY HOMEOSTASIS IN ALBINO RATS: EFFECT OF GENDER SEBANTI DEV 1, PRAVATI PAL 1*, G. K. PAL 1, P. H. ANANTHANARAYANAN
More informationSupplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and
More informationObesity in aging: Hormonal contribution
Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes
More informationab Adipogenesis Assay Kit (Cell-Based)
ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended
More informationHigh-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons Tim Klöckener 1,2,3, Simon Hess 2,4, Bengt F. Belgardt 1,2,3, Lars Paeger 2,4, Linda A. W. Verhagen
More informationHuman Leptin ELISA Kit
Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone
More informationSupplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
More informationBeneficial metabolic effects of M 3 muscarinic acetylcholine receptor deficiency
Beneficial metabolic effects of M 3 muscarinic acetylcholine receptor deficiency Dinesh Gautam, 1 Oksana Gavrilova, 2 Jongrye Jeon, 1 Stephanie Pack, 2 William Jou, 2 Yinghong Cui, 1 Jian H. Li, 1 and
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationAMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationWEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH
MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationFLASH CARDS. Kalat s Book Chapter 10 Alphabetical
FLASH CARDS www.biologicalpsych.com Kalat s Book Chapter 10 Alphabetical AgRP AgRP Agouti-related peptide; synthesized in hypothalamus. Acts as an appetite stimulator. Also decreases metabolism. aldosterone
More informationHHS Public Access Author manuscript Nat Neurosci. Author manuscript; available in PMC 2015 January 01.
Melanocortin 4 receptors in autonomic neurons regulate thermogenesis and glycemia Eric D. Berglund 1,*, Tiemin Liu *, Xingxing Kong 2,*, Jong-Woo Sohn 3, Linh Vong 2, Zhuo Deng 4, Charlotte E. Lee 1, Syann
More information1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
More informationTemperature, Regulation, Thirst, and Hunger
PSYB64 Lecture 6 Temperature, Regulation, Thirst, and Hunger 1. Homeostasis 2. Temperature 3. Thirst 4. Hunger 5. Obesity & Hunger Disorders HOMEOSTASIS Homeostasis: Physiological equilibrium Motivation:
More informationEnergy flow in the organism
I. Parameters of energy metabolism, basal metabolic rate, measurements. II. Control of food intake, hunger and satiety Péter Sántha, 12.02. 2017. Energy flow in the organism NUTRIENTS PHYSICAL WORK HEAT
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationIndex. Page references in bold refer to figures and page references in italic refer to tables.
Page references in bold refer to figures and page references in italic refer to tables. Adrenaline, high-fat response in post-obese 142 Alcohol absorption 11-12 balance equation 17 and obesity 10-11 thermogenesis
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More information9/17/2009. HPER 3970 Dr. Ayers. (courtesy of Dr. Cheatham)
REVIEW: General Principles II What is the RDA? Level of intake for essential nutrients determined on the basis of scientific knowledge to be adequate to meet the known nutrient needs of practically all
More informationNeurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction. Laura Gunter
Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction Laura Gunter The Brain as the Regulatory Center for Appetite The brain is the integration center
More informationFigure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water
More informationHORMONES AND CELL SIGNALLING
HORMONES AND CELL SIGNALLING TYPES OF CELL JUNCTIONS CHEMICAL SIGNALS AND MODES OF ACTION Endocrine system produces chemical messages = hormones that are transported from endocrine gland to target cell
More informationSex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor
Sex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor Haifei Shi Department of Biology, Miami University International Conference on Endocrinology October 22, 14 Arcuate
More informationResveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
More informationNutritional Assessment of the Critically Ill Patient Terry L. Forrette, M.H.S., RRT
Nutritional Assessment of the Critically Ill Patient Sponsored by GE Healthcare Metabolic Rate How Much Fuel Does the Patient Need? Resting Energy Expenditure Basal Energy Expenditure REE or EE BEE Metabolic
More informationSlimLine Setpoint Theory
According to the setpoint theory, there is a control system built into every person dictating how much fat he or she should carry - a kind of thermostat for body fat. Some individuals have a high setting,
More informationFood Intake Regulation & the Clock. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Food Intake Regulation & the Clock Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Circadian disruption affect multiple organ systems: The diagram provides examples of how circadian disruption
More informationEndocrine System Hormones. AP Biology
Endocrine System Hormones 2007-2008 Regulation Why are hormones needed? u chemical messages from one body part to another u communication needed to coordinate whole body u daily homeostasis & regulation
More informationBALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR
The West London Medical Journal 2010 Vol 2 No 4 pp 29-35 BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR Sairah Akbar The topic of obesity is rarely out of the public eye with an increasingly
More informationBehavioral and Motivational mechanisms of Brain. Limbic system and the Hypothalamus
Behavioral and Motivational mechanisms of Brain Limbic system and the Hypothalamus 1 General functions 1. Control of behavior 2. Control level of activities in different parts of brain 3. Motivational
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationSupporting Information
Supporting Information Estall et al. 10.1073/pnas.0912533106 SI Text Generation of Liver-Specific Heterozygous PGC-1 Mice. Liverspecific heterozygous mice were generated by mating female mice with one
More information