Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes

Size: px
Start display at page:

Download "Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes"

Transcription

1 Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014

2 Outline I. Introduction II. Research route & Results III. Summary

3 Diabetes the Epidemic of the 21st Century 1 out of 10 adults will have diabetes in 2035 Number of people with diabetes in different areas by IDF Region, 2013

4 Diabetes - Endothelial dysfunction Principle mechanisms responsible for endothelial dysfunction in diabetes.

5 PGC-1α PGC 1α, a transcriptional regulator related to energy metabolism, belongs to a small family of coactivators, comprised of PGC 1α, PGC 1β, and the more distant PRC.

6 PGC-1α & Angiogenesis PGC-1α Myocyte HIF-1 VEGF PGC-1α Endothelial cell

7

8 Research Route Diabetes PGC-1α Endothelial dysfunction Over-Expression Knock-Out Migration Transwell assay Scratch assay Notch signaling Tube formation Angiogenesis

9 1. Diabetes induces PGC-1α expression in ECs Figure 1.1. Diabetes induces PGC-1α expression in ECs in vivo both in mice and in humans. (A) Relative PGC 1α mrna abundance in ECs freshly isolated from mouse models of type 1 (STZ) and type 2 (HFD, ob/ob, and db/db) diabetes. NC indicates normal chow. (B) Relative PGC 1α mrna abundance in vasculogenic circulating CD34 + cells and cultured endothelial lprogenitor cells (EPCs) isolated from patients with diabetes, versus matched normal subjects.

10 1. Diabetes induces PGC-1α expression in ECs Figure 1.2. Diabetes, via hyperglycemia, induces PGC-1α expression in ECs. (C) Relative PGC 1α mrna abundance in mouse muscle ECs (MMECs) at the indicated times after changing from hyperglycemia to normal glucose levels. (D) Relative PGC 1α mrna abundance in MMECs in absence or presence of 2 deoxyglucose (2DG) for 24 hr. (E) Relative PGC 1α mrna abundance in mouse heart ECs (MHECs) 2 and 4 hr after exposing cells to hyperglycemia or hyperosmolarity (mannitol).

11 Conclusion Ⅰ Diabetes, likely at least in part via hyperglycemia, induces PGC-1α expression in ECs in vivo.

12 Research Route Diabetes PGC-1α Endothelial dysfunction Over-Expression Knock-Out Migration Transwell assay Scratch assay Notch signaling Tube formation Angiogenesis

13 2. PGC-1α inhibits endothelial migration Figure 2.1. PGC-1α inhibits endothelial migration. (A) Mouse heart ECs (MHECs) were affinity purified from STZ treated mice and cultured to passage 2 (left). The migrated cells were less than those in control, coincident with increased expression of PGC 1α mrna (ih) (right).

14 2. PGC-1α inhibits endothelial migration Figure 2.2. PGC-1α inhibits endothelial migration. Reduced migration of mouse lung ECs (MLECs) isolated from db/db mice toward S1P (B) and cultured Endothelial progenitor cells(epcs) isolated from diabetic patients (C). (D) Reduced migration (left) of MHECs isolated from mice that overexpress PGC 1α (i (right) h)in ECs.

15 2. PGC-1α inhibits endothelial migration Figure 2.3 PGC-1α inhibits endothelial migration. (E G) Stable expression of PGC 1α inhibits migration of HUVECs in scratch assays (E) and in Transwell assays stimulated by 10 ng/ml VEGF (F) or 100 nm S1P (G).

16 2. PGC-1α inhibits endothelial migration Figure 2.4. PGC-1α inhibits endothelial migration. (H) Stable expression of PGC 1α inhibits the tube forming activity of HUVECs.

17 2. PGC-1α inhibits endothelial migration Figure 2.5. PGC-1α inhibits endothelial migration. PGC 1α inhibits cortical F actin (green) polymerization in response to VEGF and S1P (I), mimicking the impaired F actin (red) accumulation to the same stimuli in db/db mouse lung ECs (J). Arrowheads denote lamellipodia. Scale bars are 50mm in (I) and 20mm in (J).

18 2. PGC-1α inhibits endothelial migration VEGF and S1P act through distinct cell surface receptors but converge on at least two intracellular l signaling cascades: the ERK and AKT pathways. Endothelial lcell cytoskeletal l activation occurs in large part in response to Rac/Akt/eNOS signaling. Figure 2.6. PGC-1α inhibits endothelial migration. PGC 1α blocks activation of Akt and enos (but not Erk) by VEGF and S1P ([K], with densitometric quantification at 0 and 5 min in[l]) in human endothelial colony forming cells (ECFCs).

19 Conclusion Ⅱ PGC-1α inhibits endothelial migration and Akt/eNOS proangiogenic pathway.

20 Research Route Diabetes PGC-1α Endothelial dysfunction Over-Expression Knock-Out Migration Transwell assay Scratch assay Notch signaling Tube formation Angiogenesis

21 Notch signaling pathway Notch signaling is increasinglyi recognized as a powerful inhibitor of endothelial l migration and angiogenesis. The Notch cell surface receptor is sequentially cleaved by matrix metalloproteinase and γ secretase, leading to nuclear localization of the Notch intracellular domain (NICD).

22 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.1. PGC-1α activates Notch signaling both in culture and in vivo. (A) Expression of PGC 1α in HUVECs activates Notch signaling, as assessed by western blotting of the Notch intracellular domain (NICD). (B) mrna expression of known Notch target genes in the endothelial compartment of the mouse skeletal muscle from EC specific PGC 1α overexpressing mice, versus controls.

23 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.2. PGC-1α activates Notch signaling to inhibit endothelial migration. (C) Inhibition of Notch signaling with DAPT (2.5mM) rescues inhibition of migration in HUVECs retrovirally transduced with PGC 1α. DAPT, an inhibitor of γ secretase. (D) Inhibition of Notch signaling with DAPT (2.5mM) rescues inhibition of capillary formation in mouse aortic explants from EC specific PGC 1α overexpressing mice.

24 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.3. PGC-1α activates Notch signaling to inhibit endothelial migration. (E) DAPT (2.5 mm) and pan MMP inhibitor GM6001 (25mM) equally inhibited the upregulation of Notch downstream gene mrna expression in HUVECs retrovirally transduced with PGC 1α. GM6001, a pan MMP inhibitor.

25 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.4. PGC-1α activates Notch signaling to inhibit endothelial migration. (F) Increased mrna abundance of ADAMTS10 in the MHECs isolated from EC specific PGC 1α transgenic mice, the endothelial compartment of STZ induced diabetic mouse lung, cultured EPCs from diabetic patients, and human dermal microvascular ECs treated with high glucose for 24 hr. ADAMTS10, an ADAM like MMP.

26 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.5. PGC-1α activates Notch signaling to inhibit endothelial migration. (G) Gene knockdown efficiency by lentiviral transduction of HUVECs with short hairpin RNA targeting ADAMTS10. (H and I) Knockdown of ADAMTS10 with shrna blocked the mrna expression of Notch target genes (H) and reduced the inhibition of endothelial migration toward S1P (I) by retroviral overexpression of PGC 1α in HUVECs.

27 Conclusion Ⅲ PGC-1α inhibits endothelial migration at least in part via activation of Notch signaling.

28 4. Loss of PGC-1α activates EC migration Figure 4.1. Angiogenic stimuli inhibits endothelial PGC-1α expression. (A) Relative PGC 1α mrna abundance in human dermal microvascular ECs stimulated with VEGF (10 ng/ml), S1P (100 nm), or S nitrosoglutathione (GSNO,100mM). GSNO, an NO donor.

29 4. Loss of PGC-1α activates EC migration Figure 4.2. Loss of PGC-1a activates EC migration. (B and C) Isolated MHECs from PGC 1α / (KO) mice are hypermigratory in scratch assays (B) and Transwell migration assays (C). (D) Capillary formation of KO (n = 31) and wild type (WT) (n = 16) mouse aortic explants.

30 4. Loss of PGC-1α activates EC migration Figure 4.3. Loss of PGC-1α inhibits Notch target genes expression. (E) mrna expression of Notch target genes was depressed in ECs isolated from KO mice, versus wild type controls.

31 4. Loss of PGC-1α activates EC migration Figure 4.4. High expression of Rac1 in PGC-1α KO ECs. (F) GTP Rac1 pull down assay in WT and KO MHECs. (G) VEGF (10 ng/ml) induced Transwell migration of KO and WT MHECs, with or without DPI (10mM), L NAME, or Rac inhibitor (NSC23766, 30mM).

32 Conclusion Ⅳ PGC-1α powerfully inhibits Rac/Akt/eNOS signaling and migration in ECs.

33 Research Route Diabetes PGC-1α Endothelial dysfunction Over-Expression Knock-Out Migration Transwell assay Scratch assay Notch signaling Tube formation Angiogenesis

34 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.1. Overexpression of endothelial PGC-1α blunts the formation of new blood vessels. (A) In vivo vasculogenesis assay using mesenchymal progenitor cells and human endothelial colony forming cells (ECFCs) expressing PGC 1α coinjected nude mice versus control vector. Left, sample appearance of the Matrigel plugs. Middle, hematoxylin and eosin staining of plug sections. Right, quantification of vessel density.

35 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.2. Induced expression of PGC-1α in ECs. (B) Schema of Tet off and Tet on tetracycline inducible, endothelial specific PGC 1α transgenic (Tg) mice. (C) mrna abundance of PGC 1α in freshly isolated lung ECs from Tet on mouse versus control.

36 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.3. Transgenic expression of PGC-1α inhibits re-endothelialization. Quantification (D) and representative images (E) of re endothelialization following wire injury of mouse carotid arteries in Tet off transgenic animals.

37 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.4. Transgenic expression of PGC-1α inhibits wound healing. Quantification (F) and representative images (G) of skin wound healing in Tet off transgenic animals.

38 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.5. Transgenic expression of PGC-1α inhibits the rate of blood flow recovery in hindlimb ischemia models. Quantification of blood flow recovery (H) and necrotic toes (I) after induced hindlimb ischemia in Tet on animals.

39 Conclusion Ⅴ Expression of PGC-1α in ECs in vivo mimics multiple aspects of diabetic EC dysfunction.

40 6. Loss of endothelial PGC-1α rescues diabetic endothelial dysfunction Figure 6.1. Loss of endothelial PGC-1α accelerates wound healing in diabetic mice. (A) Skin wound healing in endothelial specific PGC 1α knockout (EC KO) and control mice, either nondiabetic or rendered diabetic by treatment with STZ. (B) Skin wound healing in EC KO and control mice that were fed dhfdf for 12 months.

41 6. Loss of endothelial PGC-1α rescues diabetic endothelial dysfunction Figure 6.2. Loss of endothelial PGC-1α recovers blood flow and decreases the number of necrotic toes. Recovery of blood flow after surgical induction of hindlimb ischemia in type 1 diabetic EC KO mice: (C) representative day 14 laser Doppler perfusion images, (D) quantification of blood perfusion recovery in the ischemic limbs, (E) number of necrotic toes in the ischemic i foot at day 28, and (F) representative appearance of diabetic i mouse ischemic i limbs at day 14.

42 6. Loss of endothelial PGC-1α rescues diabetic endothelial dysfunction Figure 6.3. Loss of endothelial PGC-1α recovers blood flow and decreases the number of necrotic toes. Recovery of blood flow after hind limb ischemia in type 2 diabetic EC KO mice: (G) quantification of blood perfusion recovery in the ischemic limbs and (H) number of necrotic toes in the ischemic foot at day 21.

43 Conclusion Ⅵ Deletion of PGC-1α in ECs in large part rescues numerous aspects of endothelial dysfunction in diabetes.

44 Summary

45 Significance Supporting the notionthatthat induction ofpgc 1α in ECs mediates endothelial dysfunction and vascular complications in diabetes. Identifying an important relationship between angiogenesis and a central regulator of metabolism. Revealing theopposingeffects ofpgc 1α in different cells which Revealing the opposing effects of PGC 1α in different cells which stresses the need for caution in therapies aimed at PGC 1α in this and other contexts.

46

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Supplementary. limb. bars

Supplementary. limb. bars Figure 1. CD163 -/- mice exhibit a similar phenotype ass WT mice in the absence of ischemic injury. a, Laser Doppler analysiss with perfusion quantitation at baseline (n= =10 per group). b, Immunostaining

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

s u p p l e m e n ta ry i n f o r m at i o n

s u p p l e m e n ta ry i n f o r m at i o n Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)

More information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent

More information

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Supplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is

Supplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is Supplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is increased with exposure of HUVEC to 1h FSS, and that

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Manganese superoxide dismutase expression in endothelial progenitor cells accelerates wound healing in diabetic mice

Manganese superoxide dismutase expression in endothelial progenitor cells accelerates wound healing in diabetic mice Research article Manganese superoxide dismutase expression in endothelial progenitor cells accelerates wound healing in diabetic mice Eric J. Marrotte, 1 Dan-Dan Chen, 1,2 Jeffrey S. Hakim, 1 and Alex

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

Signaling Vascular Morphogenesis and Maintenance

Signaling Vascular Morphogenesis and Maintenance Signaling Vascular Morphogenesis and Maintenance Douglas Hanahan Science 277: 48-50, in Perspectives (1997) Blood vessels are constructed by two processes: vasculogenesis, whereby a primitive vascular

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis

Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis Cell Reports, Volume 21 Supplemental Information Differential Effects of EGFL6 on Tumor versus Wound Angiogenesis Kyunghee Noh, Lingegowda S. Mangala, Hee-Dong Han, Ningyan Zhang, Sunila Pradeep, Sherry

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table. Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:

More information

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Peli1 negatively regulates T-cell activation and prevents autoimmunity Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table File Name: Peer Review File Description: Supplementary Table 1 Primers and taqman probes used were the following:

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

Journal Club WS 2012/13 Stefanie Nickl

Journal Club WS 2012/13 Stefanie Nickl Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,

More information

Supplemental Information. Angiocrine Factors Deployed by Tumor Vascular. Niche Induce B Cell Lymphoma Invasiveness. and Chemoresistance

Supplemental Information. Angiocrine Factors Deployed by Tumor Vascular. Niche Induce B Cell Lymphoma Invasiveness. and Chemoresistance Cancer Cell, Volume 25 Supplemental Information Angiocrine Factors Deployed by Tumor Vascular Niche Induce B Cell Lymphoma Invasiveness and Chemoresistance Zhongwei Cao, Bi-Sen Ding, Peipei Guo, Sharrell

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Endothelial HIF-2α regulates murine pathological angiogenesis and revascularization processes

Endothelial HIF-2α regulates murine pathological angiogenesis and revascularization processes Research article Endothelial HIF-2α regulates murine pathological angiogenesis and revascularization processes Nicolas Skuli, 1,2 Amar J. Majmundar, 2,3 Bryan L. Krock, 2 Rickson C. Mesquita, 4 Lijoy K.

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.

SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects. Supplementary Table 1. Characteristics of Subjects. a includes one patient who had an aqueous sample taken from the same eye twice b includes one patients who had an aqueous sample taken from the same

More information

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast

More information

SDF-1/CXCR4 Axis on Endothelial Progenitor Cells Regulates Bone Fracture Healing

SDF-1/CXCR4 Axis on Endothelial Progenitor Cells Regulates Bone Fracture Healing SDF-1/CXCR4 Axis on Endothelial Progenitor Cells Regulates Bone Fracture Healing Yohei Kawakami, M.D., Ph.D. 1,2, Masaaki Ii 3, Tomoyuki Matsumoto, M.D., Ph.D. 1, Astuhiko Kawamoto, M.D., Ph.D. 2, Yutaka

More information

Optimization of Generx (Ad5FGF-4) Clinical Trial Design for Refractory Angina: Interim Results of the Phase 3 ASPIRE Trial

Optimization of Generx (Ad5FGF-4) Clinical Trial Design for Refractory Angina: Interim Results of the Phase 3 ASPIRE Trial Optimization of Generx (Ad5FGF-4) Clinical Trial Design for Refractory Angina: Interim Results of the Phase 3 ASPIRE Trial Gabor M Rubanyi, MD. PhD. Angionetics Inc., San Diego, CA ASGCT, New Orleans,

More information

Endothelial Injury and Repair as a Working Paradigm

Endothelial Injury and Repair as a Working Paradigm Endothelial Injury and Repair as a Working Paradigm A. Linke ESC Meeting 2010 UNIVERSITÄTLEIPZIG H ERZZEN TRUM Physiology of Endothelial Function: Regulation of Vascular Tone L-Arg. L-Arg. Agonists Shear

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,

More information

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal

More information

HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade)

HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade) HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade) 1. Mesenchymal stem cells (MSC) cultured on extracellular matrices with different stiffness exhibit diverse lineage commitment

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting

More information

Angiostasis and Angiogenesis Regulated by Angiopoietin1-Tie2 Receptor System

Angiostasis and Angiogenesis Regulated by Angiopoietin1-Tie2 Receptor System Japan-Mexico Workshop on Pharmacology and Nanobiology Feb. 25, 2009; Universidad Nacional Autönoma de Mëxico, Mexico City Angiostasis and Angiogenesis Regulated by Angiopoietin1-Tie2 Receptor System Shigetomo

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences

More information

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0

More information

DeWitt Daughtry Family Department of Surgery Division of Vascular Surgery University of Miami

DeWitt Daughtry Family Department of Surgery Division of Vascular Surgery University of Miami 31 st Annual Florida Vascular Society Scientific Session Orlando, FL April 26 th, 2018 Intramuscular E-selectin/AAV Gene Therapy Promotes Wound Healing in a Critical Limb Ischemia Mouse Model Punam P.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.

More information

REGENERATIVE MEDICINE

REGENERATIVE MEDICINE REGENERATIVE MEDICINE Quaking Is a Key Regulator of Endothelial Cell Differentiation, Neovascularization, and Angiogenesis AMY COCHRANE, a SOPHIA KELAINI, a MARIANNA TSIFAKI, a JAMES BOJDO, a MARTA VILA-GONZALEZ,

More information

basic research OPEN Minnesota, USA and 4 Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota, USA

basic research OPEN Minnesota, USA and 4 Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota, USA http://www.kidney-international.org & 213 International Society of Nephrology basic research OPEN see commentary on page 234 Adventitial transduction of lentivirus-shrna-vegf-a in arteriovenous fistula

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Supplementary Figures

Supplementary Figures Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Targeting angiogenesis in cancer

Targeting angiogenesis in cancer New Indigo workshop on Antiparasitic and Antitumour drugs IBMC, 9 th September, 2011 Targeting angiogenesis in cancer Raquel Soares Department of Biochemistry Tumor angiogenesis: therapeutic implications

More information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195. pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

More information

ABSTRACT. Professor James M. Hagberg, Ph.D. Department of Kinesiology

ABSTRACT. Professor James M. Hagberg, Ph.D. Department of Kinesiology ABSTRACT Title of Document: EFFECTS OF CARDIOVASCULAR DISEASE AND PHYSICAL INACTIVITY ON THE PARACRINE FUNCTION OF CIRCULATING ANGIOGENIC CELLS. Rian Q. Landers-Ramos, Doctor of Philosophy, 2015 Directed

More information

Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend

Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

Journal Club. 03/04/2012 Lama Nazzal

Journal Club. 03/04/2012 Lama Nazzal Journal Club 03/04/2012 Lama Nazzal NOTCH and the kidneys Is an evolutionarily conserved cell cell communication mechanism. Is a regulator of cell specification, differentiation, and tissue patterning.

More information

Cardioprotection by endogenous fibroblast growth factor 2 in cardiac ischemia-reperfusion injury in vivo

Cardioprotection by endogenous fibroblast growth factor 2 in cardiac ischemia-reperfusion injury in vivo Washington University School of Medicine Digital Commons@Becker Conference Abstracts and Posters Division of Emergency Medicine/Emergency Care Research Section 2011 Cardioprotection by endogenous fibroblast

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

VWF other roles than hemostasis. Summary 1: VWF & hemostasis synthesis 11/4/16. Structure/function relationship & functions kDa.

VWF other roles than hemostasis. Summary 1: VWF & hemostasis synthesis 11/4/16. Structure/function relationship & functions kDa. VWF other roles than hemostasis Len$ng PJ, Casari C et al JTH 2012 Summary 1: VWF & hemostasis synthesis Structure/function relationship & functions (HMWM) 20.000kDa multimerization propeptide FVIII GPIb

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

Journal Club Semmler Lorenz

Journal Club Semmler Lorenz Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Gyn/Obst 1U, Physiopathology of Reproduction and IVF Unit Dept. Surgical Sciences, S. Anna

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces

More information

Financial Disclosures. Bone Marrow Mononuclear Cells. Cell Based Therapies: What Do They Do and Will They Work in CLI?

Financial Disclosures. Bone Marrow Mononuclear Cells. Cell Based Therapies: What Do They Do and Will They Work in CLI? Cell Based Therapies: What Do They Do and Will They Work in CLI? None Financial Disclosures Michael P. Murphy, MD The Vascular and Cardiac Adult Stem Cell Therapy Center Indiana University School of Medicine

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells

CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells Tan YZ et al. J Cell Mol Med. (2014 Mar;18(3):422-33) Denise Traxler-Weidenauer April 2014 Introduction

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

The role of oxygen insufficiency in the onset and development of the vascular complications of diabetes

The role of oxygen insufficiency in the onset and development of the vascular complications of diabetes The role of oxygen insufficiency in the onset and development of the vascular complications of diabetes Rachel M Knott School of Pharmacy & Life Sciences Robert Gordon University, Aberdeen AB10 7GJ, UK

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-08-1-0367 TITLE: Regulatory role of the NF-kB pathway in lymphangiogenesis and breast cancer mestatasis PRINCIPAL INVESTIGATOR: Michael Flister CONTRACTING ORGANIZATION: Southern

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis

Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis Tanja Wagner 1 Introduction 2 Mesenchymal stem cells (MSCs) non-haematopoietic, multipotent stem

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Curcumin induces therapeutic angiogenesis in a diabetic mouse hindlimb ischemia model via modulating the function of endothelial progenitor cells

Curcumin induces therapeutic angiogenesis in a diabetic mouse hindlimb ischemia model via modulating the function of endothelial progenitor cells You et al. Stem Cell Research & Therapy (2017) 8:182 DOI 10.1186/s13287-017-0636-9 RESEARCH Open Access Curcumin induces therapeutic angiogenesis in a diabetic mouse hindlimb ischemia model via modulating

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information