Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
|
|
- Darleen Garrison
- 5 years ago
- Views:
Transcription
1 Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014
2 Outline I. Introduction II. Research route & Results III. Summary
3 Diabetes the Epidemic of the 21st Century 1 out of 10 adults will have diabetes in 2035 Number of people with diabetes in different areas by IDF Region, 2013
4 Diabetes - Endothelial dysfunction Principle mechanisms responsible for endothelial dysfunction in diabetes.
5 PGC-1α PGC 1α, a transcriptional regulator related to energy metabolism, belongs to a small family of coactivators, comprised of PGC 1α, PGC 1β, and the more distant PRC.
6 PGC-1α & Angiogenesis PGC-1α Myocyte HIF-1 VEGF PGC-1α Endothelial cell
7
8 Research Route Diabetes PGC-1α Endothelial dysfunction Over-Expression Knock-Out Migration Transwell assay Scratch assay Notch signaling Tube formation Angiogenesis
9 1. Diabetes induces PGC-1α expression in ECs Figure 1.1. Diabetes induces PGC-1α expression in ECs in vivo both in mice and in humans. (A) Relative PGC 1α mrna abundance in ECs freshly isolated from mouse models of type 1 (STZ) and type 2 (HFD, ob/ob, and db/db) diabetes. NC indicates normal chow. (B) Relative PGC 1α mrna abundance in vasculogenic circulating CD34 + cells and cultured endothelial lprogenitor cells (EPCs) isolated from patients with diabetes, versus matched normal subjects.
10 1. Diabetes induces PGC-1α expression in ECs Figure 1.2. Diabetes, via hyperglycemia, induces PGC-1α expression in ECs. (C) Relative PGC 1α mrna abundance in mouse muscle ECs (MMECs) at the indicated times after changing from hyperglycemia to normal glucose levels. (D) Relative PGC 1α mrna abundance in MMECs in absence or presence of 2 deoxyglucose (2DG) for 24 hr. (E) Relative PGC 1α mrna abundance in mouse heart ECs (MHECs) 2 and 4 hr after exposing cells to hyperglycemia or hyperosmolarity (mannitol).
11 Conclusion Ⅰ Diabetes, likely at least in part via hyperglycemia, induces PGC-1α expression in ECs in vivo.
12 Research Route Diabetes PGC-1α Endothelial dysfunction Over-Expression Knock-Out Migration Transwell assay Scratch assay Notch signaling Tube formation Angiogenesis
13 2. PGC-1α inhibits endothelial migration Figure 2.1. PGC-1α inhibits endothelial migration. (A) Mouse heart ECs (MHECs) were affinity purified from STZ treated mice and cultured to passage 2 (left). The migrated cells were less than those in control, coincident with increased expression of PGC 1α mrna (ih) (right).
14 2. PGC-1α inhibits endothelial migration Figure 2.2. PGC-1α inhibits endothelial migration. Reduced migration of mouse lung ECs (MLECs) isolated from db/db mice toward S1P (B) and cultured Endothelial progenitor cells(epcs) isolated from diabetic patients (C). (D) Reduced migration (left) of MHECs isolated from mice that overexpress PGC 1α (i (right) h)in ECs.
15 2. PGC-1α inhibits endothelial migration Figure 2.3 PGC-1α inhibits endothelial migration. (E G) Stable expression of PGC 1α inhibits migration of HUVECs in scratch assays (E) and in Transwell assays stimulated by 10 ng/ml VEGF (F) or 100 nm S1P (G).
16 2. PGC-1α inhibits endothelial migration Figure 2.4. PGC-1α inhibits endothelial migration. (H) Stable expression of PGC 1α inhibits the tube forming activity of HUVECs.
17 2. PGC-1α inhibits endothelial migration Figure 2.5. PGC-1α inhibits endothelial migration. PGC 1α inhibits cortical F actin (green) polymerization in response to VEGF and S1P (I), mimicking the impaired F actin (red) accumulation to the same stimuli in db/db mouse lung ECs (J). Arrowheads denote lamellipodia. Scale bars are 50mm in (I) and 20mm in (J).
18 2. PGC-1α inhibits endothelial migration VEGF and S1P act through distinct cell surface receptors but converge on at least two intracellular l signaling cascades: the ERK and AKT pathways. Endothelial lcell cytoskeletal l activation occurs in large part in response to Rac/Akt/eNOS signaling. Figure 2.6. PGC-1α inhibits endothelial migration. PGC 1α blocks activation of Akt and enos (but not Erk) by VEGF and S1P ([K], with densitometric quantification at 0 and 5 min in[l]) in human endothelial colony forming cells (ECFCs).
19 Conclusion Ⅱ PGC-1α inhibits endothelial migration and Akt/eNOS proangiogenic pathway.
20 Research Route Diabetes PGC-1α Endothelial dysfunction Over-Expression Knock-Out Migration Transwell assay Scratch assay Notch signaling Tube formation Angiogenesis
21 Notch signaling pathway Notch signaling is increasinglyi recognized as a powerful inhibitor of endothelial l migration and angiogenesis. The Notch cell surface receptor is sequentially cleaved by matrix metalloproteinase and γ secretase, leading to nuclear localization of the Notch intracellular domain (NICD).
22 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.1. PGC-1α activates Notch signaling both in culture and in vivo. (A) Expression of PGC 1α in HUVECs activates Notch signaling, as assessed by western blotting of the Notch intracellular domain (NICD). (B) mrna expression of known Notch target genes in the endothelial compartment of the mouse skeletal muscle from EC specific PGC 1α overexpressing mice, versus controls.
23 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.2. PGC-1α activates Notch signaling to inhibit endothelial migration. (C) Inhibition of Notch signaling with DAPT (2.5mM) rescues inhibition of migration in HUVECs retrovirally transduced with PGC 1α. DAPT, an inhibitor of γ secretase. (D) Inhibition of Notch signaling with DAPT (2.5mM) rescues inhibition of capillary formation in mouse aortic explants from EC specific PGC 1α overexpressing mice.
24 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.3. PGC-1α activates Notch signaling to inhibit endothelial migration. (E) DAPT (2.5 mm) and pan MMP inhibitor GM6001 (25mM) equally inhibited the upregulation of Notch downstream gene mrna expression in HUVECs retrovirally transduced with PGC 1α. GM6001, a pan MMP inhibitor.
25 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.4. PGC-1α activates Notch signaling to inhibit endothelial migration. (F) Increased mrna abundance of ADAMTS10 in the MHECs isolated from EC specific PGC 1α transgenic mice, the endothelial compartment of STZ induced diabetic mouse lung, cultured EPCs from diabetic patients, and human dermal microvascular ECs treated with high glucose for 24 hr. ADAMTS10, an ADAM like MMP.
26 3. PGC-1α activates Notch signaling to inhibit endothelial migration Figure 3.5. PGC-1α activates Notch signaling to inhibit endothelial migration. (G) Gene knockdown efficiency by lentiviral transduction of HUVECs with short hairpin RNA targeting ADAMTS10. (H and I) Knockdown of ADAMTS10 with shrna blocked the mrna expression of Notch target genes (H) and reduced the inhibition of endothelial migration toward S1P (I) by retroviral overexpression of PGC 1α in HUVECs.
27 Conclusion Ⅲ PGC-1α inhibits endothelial migration at least in part via activation of Notch signaling.
28 4. Loss of PGC-1α activates EC migration Figure 4.1. Angiogenic stimuli inhibits endothelial PGC-1α expression. (A) Relative PGC 1α mrna abundance in human dermal microvascular ECs stimulated with VEGF (10 ng/ml), S1P (100 nm), or S nitrosoglutathione (GSNO,100mM). GSNO, an NO donor.
29 4. Loss of PGC-1α activates EC migration Figure 4.2. Loss of PGC-1a activates EC migration. (B and C) Isolated MHECs from PGC 1α / (KO) mice are hypermigratory in scratch assays (B) and Transwell migration assays (C). (D) Capillary formation of KO (n = 31) and wild type (WT) (n = 16) mouse aortic explants.
30 4. Loss of PGC-1α activates EC migration Figure 4.3. Loss of PGC-1α inhibits Notch target genes expression. (E) mrna expression of Notch target genes was depressed in ECs isolated from KO mice, versus wild type controls.
31 4. Loss of PGC-1α activates EC migration Figure 4.4. High expression of Rac1 in PGC-1α KO ECs. (F) GTP Rac1 pull down assay in WT and KO MHECs. (G) VEGF (10 ng/ml) induced Transwell migration of KO and WT MHECs, with or without DPI (10mM), L NAME, or Rac inhibitor (NSC23766, 30mM).
32 Conclusion Ⅳ PGC-1α powerfully inhibits Rac/Akt/eNOS signaling and migration in ECs.
33 Research Route Diabetes PGC-1α Endothelial dysfunction Over-Expression Knock-Out Migration Transwell assay Scratch assay Notch signaling Tube formation Angiogenesis
34 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.1. Overexpression of endothelial PGC-1α blunts the formation of new blood vessels. (A) In vivo vasculogenesis assay using mesenchymal progenitor cells and human endothelial colony forming cells (ECFCs) expressing PGC 1α coinjected nude mice versus control vector. Left, sample appearance of the Matrigel plugs. Middle, hematoxylin and eosin staining of plug sections. Right, quantification of vessel density.
35 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.2. Induced expression of PGC-1α in ECs. (B) Schema of Tet off and Tet on tetracycline inducible, endothelial specific PGC 1α transgenic (Tg) mice. (C) mrna abundance of PGC 1α in freshly isolated lung ECs from Tet on mouse versus control.
36 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.3. Transgenic expression of PGC-1α inhibits re-endothelialization. Quantification (D) and representative images (E) of re endothelialization following wire injury of mouse carotid arteries in Tet off transgenic animals.
37 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.4. Transgenic expression of PGC-1α inhibits wound healing. Quantification (F) and representative images (G) of skin wound healing in Tet off transgenic animals.
38 5. Endothelial PGC-1α inhibits angiogenesis in vivo Figure 5.5. Transgenic expression of PGC-1α inhibits the rate of blood flow recovery in hindlimb ischemia models. Quantification of blood flow recovery (H) and necrotic toes (I) after induced hindlimb ischemia in Tet on animals.
39 Conclusion Ⅴ Expression of PGC-1α in ECs in vivo mimics multiple aspects of diabetic EC dysfunction.
40 6. Loss of endothelial PGC-1α rescues diabetic endothelial dysfunction Figure 6.1. Loss of endothelial PGC-1α accelerates wound healing in diabetic mice. (A) Skin wound healing in endothelial specific PGC 1α knockout (EC KO) and control mice, either nondiabetic or rendered diabetic by treatment with STZ. (B) Skin wound healing in EC KO and control mice that were fed dhfdf for 12 months.
41 6. Loss of endothelial PGC-1α rescues diabetic endothelial dysfunction Figure 6.2. Loss of endothelial PGC-1α recovers blood flow and decreases the number of necrotic toes. Recovery of blood flow after surgical induction of hindlimb ischemia in type 1 diabetic EC KO mice: (C) representative day 14 laser Doppler perfusion images, (D) quantification of blood perfusion recovery in the ischemic limbs, (E) number of necrotic toes in the ischemic i foot at day 28, and (F) representative appearance of diabetic i mouse ischemic i limbs at day 14.
42 6. Loss of endothelial PGC-1α rescues diabetic endothelial dysfunction Figure 6.3. Loss of endothelial PGC-1α recovers blood flow and decreases the number of necrotic toes. Recovery of blood flow after hind limb ischemia in type 2 diabetic EC KO mice: (G) quantification of blood perfusion recovery in the ischemic limbs and (H) number of necrotic toes in the ischemic foot at day 21.
43 Conclusion Ⅵ Deletion of PGC-1α in ECs in large part rescues numerous aspects of endothelial dysfunction in diabetes.
44 Summary
45 Significance Supporting the notionthatthat induction ofpgc 1α in ECs mediates endothelial dysfunction and vascular complications in diabetes. Identifying an important relationship between angiogenesis and a central regulator of metabolism. Revealing theopposingeffects ofpgc 1α in different cells which Revealing the opposing effects of PGC 1α in different cells which stresses the need for caution in therapies aimed at PGC 1α in this and other contexts.
46
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplementary. limb. bars
Figure 1. CD163 -/- mice exhibit a similar phenotype ass WT mice in the absence of ischemic injury. a, Laser Doppler analysiss with perfusion quantitation at baseline (n= =10 per group). b, Immunostaining
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informations u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
More informationSupplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationReduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
More informationSupplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationSupplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is
Supplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is increased with exposure of HUVEC to 1h FSS, and that
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationManganese superoxide dismutase expression in endothelial progenitor cells accelerates wound healing in diabetic mice
Research article Manganese superoxide dismutase expression in endothelial progenitor cells accelerates wound healing in diabetic mice Eric J. Marrotte, 1 Dan-Dan Chen, 1,2 Jeffrey S. Hakim, 1 and Alex
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationSignaling Vascular Morphogenesis and Maintenance
Signaling Vascular Morphogenesis and Maintenance Douglas Hanahan Science 277: 48-50, in Perspectives (1997) Blood vessels are constructed by two processes: vasculogenesis, whereby a primitive vascular
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationSupplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis
Cell Reports, Volume 21 Supplemental Information Differential Effects of EGFL6 on Tumor versus Wound Angiogenesis Kyunghee Noh, Lingegowda S. Mangala, Hee-Dong Han, Ningyan Zhang, Sunila Pradeep, Sherry
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table File Name: Peer Review File Description: Supplementary Table 1 Primers and taqman probes used were the following:
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationJournal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
More informationSupplemental Information. Angiocrine Factors Deployed by Tumor Vascular. Niche Induce B Cell Lymphoma Invasiveness. and Chemoresistance
Cancer Cell, Volume 25 Supplemental Information Angiocrine Factors Deployed by Tumor Vascular Niche Induce B Cell Lymphoma Invasiveness and Chemoresistance Zhongwei Cao, Bi-Sen Ding, Peipei Guo, Sharrell
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationEndothelial HIF-2α regulates murine pathological angiogenesis and revascularization processes
Research article Endothelial HIF-2α regulates murine pathological angiogenesis and revascularization processes Nicolas Skuli, 1,2 Amar J. Majmundar, 2,3 Bryan L. Krock, 2 Rickson C. Mesquita, 4 Lijoy K.
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.
Supplementary Table 1. Characteristics of Subjects. a includes one patient who had an aqueous sample taken from the same eye twice b includes one patients who had an aqueous sample taken from the same
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationSDF-1/CXCR4 Axis on Endothelial Progenitor Cells Regulates Bone Fracture Healing
SDF-1/CXCR4 Axis on Endothelial Progenitor Cells Regulates Bone Fracture Healing Yohei Kawakami, M.D., Ph.D. 1,2, Masaaki Ii 3, Tomoyuki Matsumoto, M.D., Ph.D. 1, Astuhiko Kawamoto, M.D., Ph.D. 2, Yutaka
More informationOptimization of Generx (Ad5FGF-4) Clinical Trial Design for Refractory Angina: Interim Results of the Phase 3 ASPIRE Trial
Optimization of Generx (Ad5FGF-4) Clinical Trial Design for Refractory Angina: Interim Results of the Phase 3 ASPIRE Trial Gabor M Rubanyi, MD. PhD. Angionetics Inc., San Diego, CA ASGCT, New Orleans,
More informationEndothelial Injury and Repair as a Working Paradigm
Endothelial Injury and Repair as a Working Paradigm A. Linke ESC Meeting 2010 UNIVERSITÄTLEIPZIG H ERZZEN TRUM Physiology of Endothelial Function: Regulation of Vascular Tone L-Arg. L-Arg. Agonists Shear
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
More informationA Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
More informationHOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade)
HOMEWORK RUBRICS MECHANOTRANSDUCTION UNIT: HOMEWORK #1 (20 pts towards your grade) 1. Mesenchymal stem cells (MSC) cultured on extracellular matrices with different stiffness exhibit diverse lineage commitment
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
More informationAngiostasis and Angiogenesis Regulated by Angiopoietin1-Tie2 Receptor System
Japan-Mexico Workshop on Pharmacology and Nanobiology Feb. 25, 2009; Universidad Nacional Autönoma de Mëxico, Mexico City Angiostasis and Angiogenesis Regulated by Angiopoietin1-Tie2 Receptor System Shigetomo
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationIntroduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
More informationCellular Physiology and Biochemistry
Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0
More informationDeWitt Daughtry Family Department of Surgery Division of Vascular Surgery University of Miami
31 st Annual Florida Vascular Society Scientific Session Orlando, FL April 26 th, 2018 Intramuscular E-selectin/AAV Gene Therapy Promotes Wound Healing in a Critical Limb Ischemia Mouse Model Punam P.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
More informationREGENERATIVE MEDICINE
REGENERATIVE MEDICINE Quaking Is a Key Regulator of Endothelial Cell Differentiation, Neovascularization, and Angiogenesis AMY COCHRANE, a SOPHIA KELAINI, a MARIANNA TSIFAKI, a JAMES BOJDO, a MARTA VILA-GONZALEZ,
More informationbasic research OPEN Minnesota, USA and 4 Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota, USA
http://www.kidney-international.org & 213 International Society of Nephrology basic research OPEN see commentary on page 234 Adventitial transduction of lentivirus-shrna-vegf-a in arteriovenous fistula
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationSupplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationSupplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationTargeting angiogenesis in cancer
New Indigo workshop on Antiparasitic and Antitumour drugs IBMC, 9 th September, 2011 Targeting angiogenesis in cancer Raquel Soares Department of Biochemistry Tumor angiogenesis: therapeutic implications
More informationA263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
More informationABSTRACT. Professor James M. Hagberg, Ph.D. Department of Kinesiology
ABSTRACT Title of Document: EFFECTS OF CARDIOVASCULAR DISEASE AND PHYSICAL INACTIVITY ON THE PARACRINE FUNCTION OF CIRCULATING ANGIOGENIC CELLS. Rian Q. Landers-Ramos, Doctor of Philosophy, 2015 Directed
More informationMacrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationIn vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)
In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%
More informationJournal Club. 03/04/2012 Lama Nazzal
Journal Club 03/04/2012 Lama Nazzal NOTCH and the kidneys Is an evolutionarily conserved cell cell communication mechanism. Is a regulator of cell specification, differentiation, and tissue patterning.
More informationCardioprotection by endogenous fibroblast growth factor 2 in cardiac ischemia-reperfusion injury in vivo
Washington University School of Medicine Digital Commons@Becker Conference Abstracts and Posters Division of Emergency Medicine/Emergency Care Research Section 2011 Cardioprotection by endogenous fibroblast
More informationF-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
More informationVWF other roles than hemostasis. Summary 1: VWF & hemostasis synthesis 11/4/16. Structure/function relationship & functions kDa.
VWF other roles than hemostasis Len$ng PJ, Casari C et al JTH 2012 Summary 1: VWF & hemostasis synthesis Structure/function relationship & functions (HMWM) 20.000kDa multimerization propeptide FVIII GPIb
More informationSupplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
More informationJournal Club Semmler Lorenz
Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationStem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD
Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Gyn/Obst 1U, Physiopathology of Reproduction and IVF Unit Dept. Surgical Sciences, S. Anna
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationFinancial Disclosures. Bone Marrow Mononuclear Cells. Cell Based Therapies: What Do They Do and Will They Work in CLI?
Cell Based Therapies: What Do They Do and Will They Work in CLI? None Financial Disclosures Michael P. Murphy, MD The Vascular and Cardiac Adult Stem Cell Therapy Center Indiana University School of Medicine
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationCD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells
CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells Tan YZ et al. J Cell Mol Med. (2014 Mar;18(3):422-33) Denise Traxler-Weidenauer April 2014 Introduction
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationThe role of oxygen insufficiency in the onset and development of the vascular complications of diabetes
The role of oxygen insufficiency in the onset and development of the vascular complications of diabetes Rachel M Knott School of Pharmacy & Life Sciences Robert Gordon University, Aberdeen AB10 7GJ, UK
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-08-1-0367 TITLE: Regulatory role of the NF-kB pathway in lymphangiogenesis and breast cancer mestatasis PRINCIPAL INVESTIGATOR: Michael Flister CONTRACTING ORGANIZATION: Southern
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationMesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis
Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis Tanja Wagner 1 Introduction 2 Mesenchymal stem cells (MSCs) non-haematopoietic, multipotent stem
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationCurcumin induces therapeutic angiogenesis in a diabetic mouse hindlimb ischemia model via modulating the function of endothelial progenitor cells
You et al. Stem Cell Research & Therapy (2017) 8:182 DOI 10.1186/s13287-017-0636-9 RESEARCH Open Access Curcumin induces therapeutic angiogenesis in a diabetic mouse hindlimb ischemia model via modulating
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More information