ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES. Irina Durbală
|
|
- Maryann Newman
- 5 years ago
- Views:
Transcription
1 ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES Summary Irina Durbală CELL AND MOLECULAR BIOLOGY DEPARTMENT FACULTY OF MEDICINE, OVIDIUS UNIVERSITY CONSTANŢA Class II HLA genes, particularly HLA-DRB1 and DQB1 genes, are well established risk genes for type 1 diabetes mellitus and other autoimmune diseases. In type 1 diabetes mellitus, however, both susceptible and protective alleles have been described, influencing the development of autoimmunity and progression to overt diabetes. This study determines the class II genes in a group of children with type 1 diabetes mellitus registered at the Pediatric Clinic of the Emergency Clinical Hospital Constanţa and their healthy first degree relatives. The method used for the assignment of alleles at HLA-DRB1 and DQB1 loci was molecular genotyping, primarily by the sequence specific oligonucleotide hybridization method, and when required, by the sequence specific primers method. The presence of different alleles in patients and control groups has been analyzed for statistical significance and predisposing and protective alleles have been defined. Keywords: class II HLA genes, type 1 diabetes, predisposing and protective alleles. Introduction Insulin-dependent diabetes mellitus (IDDM), or type 1 diabetes, is a chronic disease characterized by the autoimmune destruction of pancreatic ß-cells and severe insulin deficiency (Gavin et al., 1992). Type 1 diabetes frequently develops in children, adolescents and young adults. Inherited genetic factors influence both susceptibility to and resistance to the disease. Association studies and linkage analysis have been used to identify IDDM susceptibility loci. These are conventionally noted using the abbreviation IDDM and a number, e.g. IDDM1, IDDM2, etc., with the number usually reflecting the order in which such loci were reported. Using the candidate gene approach, association studies provided evidence for the first two susceptibility loci, the HLA region (IDDM1) and the insulin gene (INS) locus (IDDM2). These two loci contribute the great majority of familial clustering; MHC alone is estimated to contribute 41% of the familial clustering of type 1 diabetes of the 48% estimated to be accounted for with all known susceptibility genes (Cox et al., 2001; Steck et al., 2007). 123 The major locus for type 1 diabetes susceptibility is located within the HLA (Human Leukocyte Antigen) region on the short arm of chromosome 6. In this region, HLA class II genes (especially DQ and DR) were shown to have the strongest association with the disease, with both susceptible and protective alleles at the DRB1 and DQB1 loci. Both loci are highly polymorphic, but only few of the alleles are demonstrated to be associated with type 1 diabetes. There were found susceptible alleles encoding for the antigens DR3, DR4, DQ2 and DQ8, and protective alleles encoding for DR2 (DR15), DR6 (DR11), DQ6 and DQ7 (Kelly et al., 2003). Our country has the lowest incidence of type 1 diabetes in Europe (4 ), almost 10 times lower than Finland which has the highest incidence (Karvonen et al., 2000). Since the environmental factors are not so different between various regions in Europe, it appears that this difference in incidence is due to difference in genetic background in European populations. Previous studies reported lower frequencies of diabetogenic alleles in Romanian populations, providing an
2 explanation for the lower incidence of type 1diabetes in Romania (Guja et al., 2004). This work aimed to analyze the distribution of HLA-DRB1 and DQB1 alleles in a group of children with type 1 diabetes from Constanţa County. Materials and methods The subjects included in this study comprise 62 patients with type 1 diabetes registered at the Pediatric Clinic of the Emergency Clinical Hospital Constanţa and 59 healthy subjects, first degree relatives of the patients parents and siblings. All the patients were diagnosed with type 1 diabetes based on the onset with ketoacidosis and/or required insulin treatment from the first month since diagnosis. Genotyping methods. Total genomic DNA was extracted from EDTAanticoagulated venous blood with the QIAmp DNA Blood Mini Kit. HLA genotyping was performed with PCR-based sequence-specific oligonucleotide probe assays, the RELI SSO HLA typing systems from Invitrogen, and the ambiguities were solved with two sequence-specific primers systems, Domino HLA SSP System from Protrans and AllSet Gold SSP System from Invitrogen. The sequence-specific oligonucleotide probe assay was based on oligonucleotide probes corresponding to known polymorphic sequence motifs in second exon of HLA-DRB1 and HLA- DQB1genes immobilized onto a nylon strip. The relevant regions of the HLA genes were amplified with byotinilated primers, denatured and hybridized to the immobilized probe array. a) b) Figure 1. a) Image of a batch of strips after the completion of the RELI SSO HLA-DRB1 assay. 17 amplifications followed by colorimetric detection were run simultaneously. b) Interpretation of the result the strip from the image shows the following specificities: 3, 4, 20, 22, 25, 27, 36, 37, 41, 45, 48, 59, 60 and the genotype assigned by the Pattern Matching Program were DRB1*0401 &
3 After hybridization and wash, strips were incubated with streptavidinhorseradish peroxidase, followed by a chromogenic substrate (figure 1a). The results of the colorimetric reactions were analyzed with the Pattern Matching Program v5.42 from Invitrogen and the HLA-DRB1 and HLA-DQB1alleles were assigned (figure 1b). The sequence-specific primers assays were based on the amplification of the target regions with 20 to 96 primer pairs complementary to known polymorphisms in the target genes. If one. polymorphism is present in the sequence of the gene, the amplicon is synthesized in the corresponding reaction tube. All the 20 to 96 reactions were then analyzed on an agarose gel electrophoresis system, and the presence or absence of the amplicons was demonstrated by ethidium bromide staining on a UV transillumination system (figure 2). The images were digitally captured and analyzed with the UniMatch software for Invitrogen and SCORE software for the Protrans systems, respectively. Figure 2. Image of four amplification reactions migrated simultaneously on a 96-well agarose gel. The targeted gene is HLA-DRB1, and the system used is Protrans HLA-DRB1*03 high resolution. The test employs 19 different pair of primers and a negative control reaction. The first reaction was used to solve the following ambiguous DRB1 result from the SSO assay: DRB1*0301 & 0402 or DRB1*0422 & The positive lanes are 1, 3, 4, 5, 7 and 16 and the *0301 allele was assigned based on the amplification pattern. This solved the ambiguity, and the genotype assigned was DRB1*0301 &
4 Statistical analysis. The study was designed as an association study with affected family-based controls. This control population provide an unbiased estimate of the overall population HLA alleles, under the assumption of zero recombination between the marker an the disease loci. The statistical significance of differences in allele/genotype frequencies between type 1 diabetes cases and controls was assessed using a χ 2 test. Bonferoni correction for multiple comparisons has been applied to p values 0.05 and corrected p values (p c ) 0.05 have been considered statistically significant. Results and discussion The frequencies of the main genotypes, and HLA-DRB1 and DQB1 alleles are presented in tables I, II and III, respectively. As expected, frequency of the high-risk genotype DR3/DR4 was significantly higher in patients than in controls (p c <10 3 ), while the genotypes non-harboring high-risk genes were better represented in controls (p c <0.01). There was no difference between patients and controls where the moderate risk genotype DR4/Y and the mild risk genotype DR3/X were concerned. The frequency of the highrisk genotype in diabetics (30.64%) was close to that found in other studies in Caucasian populations (Erlich et al., 2008). Table I. Frequencies of high-risk, moderate-risk and low-risk genotypes in diabetic patients and controls. Genotype Pacients Controls χ 2 p value p c no. freq. no. freq. DR3/DR4 * DR3/X DR4/Y nondr3/nondr * Association with the disease (either positive or negative) is shown in bold characters. The analysis of the DRB1 alleles frequencies showed DRB1*0301 as a predisposing allele (p c <0.025), but failed to demonstrate DR4 alleles as a predisposing alleles due to the overrepresentation of the DR4 non-transmitted alleles in our control group. DR11 and DRB1*1104 were demonstrated to be protective, being significantly better represented in controls than in patients (p c <0.01). Other known DRB1 protective alleles, such as *1501 and *1401, although having higher frequency in diabetics than in controls, failed to reach statistical significance because of the low number of cases. DQ2 group showed a significantly higher frequency in patients than in controls (p c <0.013) due to a higher representation of DQB1 alleles *0201 and *0202. However, these alleles failed to reach the statistical significance independently, which is a surprising finding since DQB1*0201 in known to be in linkage disequilibrium with DR3 alleles and we expected their representation to parallel that of DR3. The analysis of the haplotypes in controls showed the presence of DQB1*0201 on three untransmitted DRB1*0701/DQB1*0201haplotypes from the control group, and this accounted for a 126
5 slightly higher frequency than expected of DQB1*0201 in controls, which explained the why DQB1*0201 failed to be assigned as a predisposing. DQB1*0302, known also as DQ8, is in linkage disequilibrium with DR4 alleles and, similarly, failed to be assigned as a predisposing allele. We demonstrated DQ7 group and DQB1*0301 (an allele of this group) as being protective for the disease, having significantly higher frequencies in control than in the patients group (p c <10 3 in both cases). Table II. Frequencies of DRB1 alleles and groups of alleles in diabetic patients and controls. /locus Pacients Controls χ 2 p value p c no. freq. no. freq. DRB * * Individual alleles are shown in italic characters Association with the disease (either positive or negative) is shown in bold characters. This paralleled the presence of the DR11 alleles which are in linkage disequilibrium with DQB1*0301, although the later were also found on DR4 haplotypes. DQB1*0602 known to confer dominant protection for type 1 diabetes 127 (Ettinger and Kwok, 2008), failed to be demonstrated as protective in this dataset because of the low number of cases, similar with DRB1*1501 which has been found on the same haplotypes.
6 Table III. Frequencies of DQB1 alleles and groups of alleles in diabetic patients and controls. /locus Pacients Controls χ 2 p value p c no. freq. no. freq. DQB1 DQ2 * DQ DQ DQ DQ DQ * Association with the disease (either positive or negative) is shown in bold characters. Individual alleles are shown in italic characters. Overall, the frequencies of the alleles and genotypes showed concordance with the most recent studies that analyzed HLA-DRB1 and DQB1 alleles in type 1 diabetes. One previous Romanian study demonstrated a lower representation than expected of high-risk DR3/DR4 genotypes (21% compared with over 30% cited by other authors) (Guja et al., 2004; Erlich et al., 2008), but that finding was not reproduced here. We found an overrepresentation of the DR4 alleles not only in patients, but also in controls (39.51% and 25.42% respectively) which represents a deviation from the standard frequency of 16.90% for Caucasian populations (Klitz et al., 2003); this fact explains why the positive association of DR4 alleles with type 1 diabetes could not be demonstrated on this dataset. 128 Conclusion This study demonstrated the positive association of DRB1*0301 allele as well as negative association of DRB1*1104/DQB1*0301 haplotypes with type 1 diabetes. We failed to demonstrate association with the disease for other known susceptible and protective alleles, fact that is probably due, when such polymorphic loci were involved, to the relatively low number of cases analyzed. References Cox, N.J., Wapelhorst, B., Morrison, V.A., Johnson, L., Pinchuk, L., Spielman, R.S., et al.: Seven regions of the genome show evidence of linkage to type 1 diabetes in a consensus analysis of 767 multiplex families. Am. J. Hum. Genet., 69, , 2001 Erlich, H., Valdes, A.M., Noble, J., Carlson, J.A., Varney, M., Concannon, P., et al.: HLA DR-DQ
7 haplotypes and genotypes and type 1 diabetes risk. Diabetes, 57, 4, , 2008 Ettinger, R.A., Kwok, W.W.: A peptide binding motif for HLA-DQA1*0102/ DQB1*0602, the class II MHC molecule associated with dominant protection in insulin-dependent diabetes mellitus. J. Immunol., 160, , 1998 Gavin, J.R., Alberti, K.G., Davidson, M.B., DeFronzo, R.A., Drash, A., Gabbe, S.G., et al.: Report of the expert committee on the diagnosis and classification of diabetes mellitus. Diabetes Care, 26, Supl. 1, S5-S20, 2003 Guja, C., Guja, L., Nutland, S., Rance, H., Sebastien, M., Todd, J.A., Ionescu-Tîrgovişte, C.: Type 1 diabetes genetic susceptibility encoded by HLA DQB1 genes in Romania. J. Cell Mol. Med., 8, 2, , 2004 Karvonen, M., Viik-Kajander, M., Moltchanova, E., Libman, I., LaPorte, R., Tuomilehto, J.: Incidence of childhood type 1 diabetes worldwide. Diabetes Mondiale (DiaMond) Project Group. Diabetes Care, 23, 10, , 2000 Kelly, M.A., Rayner, M.L., Mijovic, C.H., Barnett, A.H.: Molecular aspects of type 1 diabetes. J. Clin. Pathol.: Mol. Pathol., 56, 1-10, 2003 Klitz, W., Maiers, M., Spellman, S., Baxter-Lowe, L.A., Schmeckpeper, B., Williams, T.M., et al.: New HLA haplotype frequency reference standards: high-resolution and large sample typing of HLA DR-DQ haplotypes in a sample of European Americans. Tissue Antigens, 62, 4, , 2003 Steck, A.K., Pugliese, A., Eisenbarth, G.S.: Type 1 diabetes mellitus of man: genetic susceptibility and resistance. In: Eisenbarth GS, editor. Type 1 diabetes: molecular, cellular, and clinical immunology. Online ed. version [cited October 2009]. URL: diabetes/books/type1/type1_ch7.html 129
The Human Major Histocompatibility Complex
The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure
More informationCompleting the CIBMTR Confirmation of HLA Typing Form (Form 2005)
Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005) Stephen Spellman Research Manager NMDP Scientific Services Maria Brown Scientific Services Specialist Data Management Conference 2007 1
More informationORIGINAL ARTICLE Conserved extended haplotypes discriminate HLA-DR3-homozygous Basque patients with type 1 diabetes mellitus and celiac disease
(2006) 7, 550 554 & 2006 Nature Publishing Group All rights reserved 1466-4879/06 $30.00 www.nature.com/gene ORIGINAL ARTICLE Conserved extended haplotypes discriminate HLA-DR3-homozygous Basque patients
More informationDiversity and Frequencies of HLA Class I and Class II Genes of an East African Population
Open Journal of Genetics, 2014, 4, 99-124 Published Online April 2014 in SciRes. http://www.scirp.org/journal/ojgen http://dx.doi.org/10.4236/ojgen.2014.42013 Diversity and Frequencies of HLA Class I and
More informationResearch: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype
Research: Genetics HLA class II gene associations in African American Type 1 diabetes reveal a protective HLA-DRB1*03 haplotype J. M. M. Howson 1,2, M. S. Roy 3, L. Zeitels 1, H. Stevens 1 and J. A. Todd
More informationAbstract RESEARCH ARTICLE
RESEARCH ARTICLE DIABETES/METABOLISM RESEARCH AND REVIEWS Diabetes Metab Res Rev 2004; 20: 322 329. Published online 1 March 2004 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/dmrr.455
More informationFONS Nové sekvenační technologie vklinickédiagnostice?
FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables
More informationRelationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese
HK J Paediatr (new series) 2005;10:20-25 Relationship Between HLA-DMA, DMB Alleles and Type 1 Diabetes in Chinese YM SANG, C YAN, C ZHU, GC NI, YM HU Abstract Key words The Human Leucocyte Antigen (HLA)-DMA
More informationValidation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source
S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. Introduction
More informationCover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/49010 holds various files of this Leiden University dissertation. Author: Heide, A. van der Title: Unravelling narcolepsy : from pathophysiology to measuring
More informationFULL PAPER Genotype effects and epistasis in type 1 diabetes and HLA-DQ trans dimer associations with disease
(2004) 5, 381 388 & 2004 Nature Publishing Group All rights reserved 1466-4879/04 $30.00 www.nature.com/gene FULL PAPER Genotype effects and epistasis in type 1 diabetes and HLA-DQ trans dimer associations
More informationPrediction and Prevention of Type 1 Diabetes
Prediction and Prevention of Type 1 Diabetes Helping to defuse the diabetes The number of people in the world currently with type 1 diabetes is around 17 million and increasing rapidly. Already there are
More informationHistocompatibility Evaluations for HSCT at JHMI. M. Sue Leffell, PhD. Professor of Medicine Laboratory Director
Histocompatibility Evaluations for HSCT at JHMI M. Sue Leffell, PhD Professor of Medicine Laboratory Director JHMI Patient Population Adults Peds NMDP data >20,000 HSCT JHMI HSCT Protocols Bone marrow
More informationPart XI Type 1 Diabetes
Part XI Type 1 Diabetes Introduction Åke Lernmark Epidemiology Type 1 diabetes is increasing worldwide and shows epidemic proportions in several countries or regions [1]. There is evidence to suggest that
More informationEffects of age-at-diagnosis and duration of diabetes on GADA and IA-2A positivity
Effects of age-at-diagnosis and duration of diabetes on GADA and IA-2A positivity Duration of diabetes was inversely correlated with age-at-diagnosis (ρ=-0.13). However, as backward stepwise regression
More informationHLA Class I and II Genotyping by PCR-SSO in Patients with Type-1 Diabetes Mellitus
HLA THE CLASS IRAQI POSTGRADUATE I AND II GENOTYPING MEDICAL JOURNAL HLA Class I and II Genotyping by PCR-SSO in Patients with Type-1 Diabetes Mellitus Ahmed A. Al-Hassan*, Anwar Mohammad*, Batool H. Al-Ghurabi**,
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationDocumentation of Changes to EFI Standards: v 5.6.1
Modified Standard B - PERSONNEL QUALIFICATIONS B1.000 The laboratory must employ one or more individuals who meet the qualifications and fulfil the responsibilities of the Director/Co-Director, Technical
More informationBDC Keystone Genetics Type 1 Diabetes. Immunology of diabetes book with Teaching Slides
BDC Keystone Genetics Type 1 Diabetes www.barbaradaviscenter.org Immunology of diabetes book with Teaching Slides PRACTICAL Trailnet screens relatives and new onset patients for autoantibodies and HLA
More informationDEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS
DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS The definitions below are intended as general concepts. There will be exceptions to these general definitions. These definitions do not imply any specific
More informationHandling Immunogenetic Data Managing and Validating HLA Data
Handling Immunogenetic Data Managing and Validating HLA Data Steven J. Mack PhD Children s Hospital Oakland Research Institute 16 th IHIW & Joint Conference Sunday 3 June, 2012 Overview 1. Master Analytical
More informationSignificance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationHLA Genetic Discrepancy Between Latent Autoimmune Diabetes in Adults and Type 1 Diabetes: LADA China Study No. 6
ORIGINAL ARTICLE HLA Genetic Discrepancy Between Latent Autoimmune Diabetes in Adults and Type 1 Diabetes: LADA China Study No. 6 Shuoming Luo,* Jian Lin,* Zhiguo Xie,* Yufei Xiang, Peilin Zheng, Gan Huang,
More informationType 1 diabetes, an early-onset autoimmune disease. Brief Genetics Report Association of IL4R Haplotypes With Type 1 Diabetes
Brief Genetics Report Association of IL4R Haplotypes With Type 1 Diabetes Daniel B. Mirel, 1 Ana Maria Valdes, 1 Laura C. Lazzeroni, 2 Rebecca L. Reynolds, 1 Henry A. Erlich, 1,3 and Janelle A. Noble 3
More informationType 1 diabetes is an autoimmune disease characterized
ORIGINAL ARTICLE HLA Class I and Genetic Susceptibility to Type Diabetes Results From the Type Diabetes Genetics Consortium Janelle A. Noble, Ana Maria Valdes, Michael D. Varney, 3 Joyce A. Carlson, 4
More informationthe HLA complex Hanna Mustaniemi,
the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important
More informationAllele and Haplotype Frequencies of Human Leukocyte Antigen-A, -B, -C, -DRB1, and -DQB1 From Sequence- Based DNA Typing Data in Koreans
Original Article Diagnostic Immunology Ann Lab Med 2015;35:429-435 http://dx.doi.org/10.3343/alm.2015.35.4.429 ISSN 2234-3806 eissn 2234-3814 Allele and Haplotype Frequencies of Human Leukocyte Antigen-A,
More informationHLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma
HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma Arezou Sayad 1, Mohammad Taghi Akbari 2**, Mahshid Mehdizadeh 3,4, Mohammad Taheri 1, Abbas Hajifathali 3* 1 Department of Medical
More informationHuman Leukocyte Antigens and donor selection
Human Leukocyte Antigens and donor selection Duangtawan Thammanichanond, MD. PhD. Histocompatibility and Immunogenetics Laboratory, Faculty of Medicine Ramathibodi Hospital, Mahidol University Outline
More informationAn association analysis of the HLA gene region in latent autoimmune diabetes in adults
Diabetologia (2007) 50:68 73 DOI 10.1007/s00125-006-0513-z SHORT COMMUNICATION An association analysis of the HLA gene region in latent autoimmune diabetes in adults M. Desai & E. Zeggini & V. A. Horton
More informationDEFINITION OF HIGH RISK TYPE 1 DIABETES HLA-DR AND HLA- DQ TYPES USING ONLY THREE SINGLE NUCLEOTIDE POLYMORPHISMS
Page 1 of 24 Diabetes DEFINITION OF HIGH RISK TYPE 1 DIABETES HLA-DR AND HLA- DQ TYPES USING ONLY THREE SINGLE NUCLEOTIDE POLYMORPHISMS BY Cao Nguyen 1,2, Michael D Varney 3, Leonard C. Harrison 4 and
More informationT ype 1 diabetes is a multifactorial autoimmune
1 REVIEW Molecular aspects of type 1 diabetes M A Kelly, M L Rayner, C H Mijovic, A H Barnett... Type 1 diabetes is a T cell mediated autoimmune disease, characterised by the selective destruction of pancreatic
More informationHLA-DR2 and IKBL+738(C) in Dutch Ulcerative Colitis Patients
HLA-DR2 and IKBL+738(C) in Dutch Ulcerative Colitis Patients Boukje de Vries Student from the VUmc Amsterdam The Netherlands September 2002 January 2003 Supervisors: EG de la Concha, AS Peña, L Fernandez
More informationSupplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles
Supplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles (green) of (A) HLA-A, HLA-B, (C) HLA-C, (D) HLA-DQA1,
More informationRole of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
More informationHLA Class I and Genetic Susceptibility to Type 1 Diabetes: Results from the Type 1 Diabetes Genetics Consortium
Diabetes Publish Ahead of Print, published online August 26, 2010 HLA Class I and Genetic Susceptibility to Type 1 Diabetes: Results from the Type 1 Diabetes Genetics Consortium Janelle A. Noble 1, Ana
More informationHLA-DQA1 and DQB1 Genotyping in Individuals with Family History of Gastritis
ADVANCES IN BIORESEARCH, Vol. 2 [1] June 2011: 40-46 Society of Education, India http://www.soeagra.com/abr.htm ISSN 0976-4585 RESEARCH ARTICLE HLA-DQA1 and DQB1 Genotyping in with Family Nibras S. Al-Ammar
More informationa) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
1 2 APPENDIX Legends to figures 3 4 5 Figure A1: Distribution of perfect SSR along chromosome 1 of V. cholerae (El-Tor N191). a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
More information10/18/2012. A primer in HLA: The who, what, how and why. What?
A primer in HLA: The who, what, how and why What? 1 First recognized in mice during 1930 s and 1940 s. Mouse (murine) experiments with tumors Independent observations were made in humans with leukoagglutinating
More informationHLA and disease association
J Headache Pain (2000) 1:S109 S113 Springer-Verlag 2000 Simonetta Trabace HLA and disease association S. Trabace ( ) Section of Medical Genetics, Department of Experimental Medicine and Pathology, Department
More informationMinimal Requirements for Histocompatibility & Immunogenetics Laboratory
Minimal Requirements for Histocompatibility & Immunogenetics Laboratory The 4 th WBMT Congress and Workshop Riyadh, KSA - January 15-17, 2017 HLA Discovery, 1958 The Nobel Prize in Physiology or Medicine
More informationThe Onset of Diabetes in Three out of Four Sisters: A Japanese Family with Type 1 Diabetes. A Case Report
Endocrine Journal 29, 56 (6), 767-772 The Onset of Diabetes in Three out of Four Sisters: A Japanese Family with Type 1 Diabetes. A Case Report Akio KISHI*, Yumiko KAWABATA**, Satoshi UGI*, Tamaki IWAI*,
More informationDefinition of High-Risk Type 1 Diabetes HLA-DR and HLA-DQ Types Using Only Three Single Nucleotide Polymorphisms
ORIGINAL ARTICLE Definition of High-Risk Type 1 Diabetes HLA-DR and HLA-DQ Types Using Only Three Single Nucleotide Polymorphisms Cao Nguyen, 1,2 Michael D. Varney, 3 Leonard C. Harrison, 4 and Grant Morahan
More informationIndian Journal of Nephrology Indian J Nephrol 2001;11: 88-97
88 Indian Journal of Nephrology Indian J Nephrol 2001;11: 88-97 ARTICLE HLA gene and haplotype frequency in renal transplant recipients and donors of Uttar Pradesh (North India) S Agrawal, AK Singh, RK
More informationDiabetologia 9 Springer-Verlag 1995
Diabetologia (1995) 38:623-628 Diabetologia 9 Springer-Verlag 1995 A new marker in the HLA class I region is associated with the age at onset of IDDM A. G. Demaine, M. L. Hibberd, D. Mangles, B. A. Millward
More informationHOST-PARASITE INTERPLAY
HOST-PARASITE INTERPLAY Adriano Casulli EURLP, ISS (Rome, Italy) HOST-PARASITE INTERPLAY WP3 (parasite virulence vs human immunity) (Parasite) Task 3.1: Genotypic characterization Task 3.6: Transcriptome
More informationHLA-DR, HLA-DQB1 and PTPN22 gene polymorphism: association with age at onset for autoimmune diabetes
Clinical research HLA-DR, HLA-DQB1 and PTPN22 gene polymorphism: association with age at onset for autoimmune diabetes Anna Okruszko, Barbara Szepietowska, Natalia Wawrusiewicz-Kurylonek, Maria Górska,
More informationLUP. Lund University Publications Institutional Repository of Lund University
LUP Lund University Publications Institutional Repository of Lund University This is an author produced version of a paper published in Diabetologia. This paper has been peer-reviewed but does not include
More informationImmunogenetics in SARS: a casecontrol
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES MHL Ng 吳香玲 SH Cheng 鄭淑恆 KM Lau 劉建盟 GM Leung 梁卓偉 US Khoo 邱瑋璇 BCW Zee 徐仲鍈 JJY Sung 沈祖堯 Key Messages 1. Human leukocyte antigen (HLA) genotypes from 102
More informationHuman leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis
Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis H.-Y. Zou, W.-Z. Yu, Z. Wang, J. He and M. Jiao Institute of Clinical Medicine, Urumqi General Hospital, Lanzhou
More informationUse of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing of Patients with Narcolepsy
Original Article Woo HI, et al. Diagnostic Immunology Ann Lab Med 2012;32:57-65 ISSN 2234-3806 eissn 2234-3814 Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing
More informationEvaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationAssociation of HLA-DRB alleles and pulmonary tuberculosis in North Chinese patients
Association of HLA-DRB alleles and pulmonary tuberculosis in North Chinese patients G.L. Shi, X.L. Hu, L. Yang, C.L. Rong, Y.L. Guo and C.X. Song Department of Clinical Immunology Laboratory, Beijing Tuberculosis
More information2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationAntigen Presentation to T lymphocytes
Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are
More informationAZOOSPERMIA Chromosome Y
AZOOSPERMIA Chromosome Y M i c r o d e l e t i o n Ref.: PI EDP003024-40 testspi EDP002024 1. INTRODUCTION In 1976, Tiepolo and Zuffardi reported de novo, microscopically detectable deletions of the distal
More informationAG MHC HLA APC Ii EPR TAP ABC CLIP TCR
!! AG MHC HLA APC Ii EPR TAP ABC CLIP TCR Antigen Major Histocompartibility Complex Human Leukocyte Antigen Antigen Presenting Cell Invariant Chain Endoplasmatic Reticulum Transporters Associated with
More informationHLA and new technologies. Vicky Van Sandt
HLA and new technologies. Vicky Van Sandt Life-threatning malignant and non malignant blood disorders can be cured by hematopoetic stem cell transplantation (HSCT). GVHD is the 2nd most prevalent cause
More informationWhole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis
HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control
More informationHLA Amino Acid Polymorphisms and Kidney Allograft Survival. Supplemental Digital Content
HLA Amino Acid Polymorphisms and Kidney Allograft Survival Supplemental Digital Content Malek Kamoun, MD, PhD a, Keith P. McCullough, MS b, Martin Maiers, MS c, Marcelo A. Fernandez Vina, MD, PhD d, Hongzhe
More informationWHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx
WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,
More informationExtensive studies on polymerase chain reactionsequence-specific. DRB1* allele profiling in non insulin dependent diabetes mellitus (Indian population)
African Journal of Pharmacy and Pharmacology Vol. 6(10), pp. 685-691, 15 March, 2012 Available online at http://www.academicjournals.org/ajpp DOI: 10.5897/AJPP11.052 ISSN 1996-0816 2012 Academic Journals
More informationEffects of Stratification in the Analysis of Affected-Sib-Pair Data: Benefits and Costs
Am. J. Hum. Genet. 66:567 575, 2000 Effects of Stratification in the Analysis of Affected-Sib-Pair Data: Benefits and Costs Suzanne M. Leal and Jurg Ott Laboratory of Statistical Genetics, The Rockefeller
More informationThe MHC and Transplantation Brendan Clark. Transplant Immunology, St James s University Hospital, Leeds, UK
The MHC and Transplantation Brendan Clark Transplant Immunology, St James s University Hospital, Leeds, UK Blood Groups Immunofluorescent staining has revealed blood group substance in the cell membranes
More informationEvidence of at least two type 1 diabetes susceptibility genes in the HLA complex distinct from HLA-DQB1, -DQA1 and DRB1
(2003) 4, 46 53 & 2003 Nature Publishing Group All rights reserved 1466-4879/03 $25.00 www.nature.com/gene Evidence of at least two type 1 diabetes susceptibility genes in the HLA complex distinct from
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationHLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
More informationHLA class I alleles tag HLA-DRB1*1501 haplotypes for differential risk in multiple sclerosis susceptibility
HLA class I alleles tag HLA-DRB1*1501 haplotypes for differential risk in multiple sclerosis susceptibility Michael J. Chao, Martin C. N. M. Barnardo, Matthew R. Lincoln, Sreeram V. Ramagopalan, Blanca
More informationTHE HUMAN LEUKOCYTE antigen (HLA) haplotype
0021-972X/00/$03.00/0 Vol. 85, No. 3 The Journal of Clinical Endocrinology & Metabolism Printed in U.S.A. Copyright 2000 by The Endocrine Society Islet Cell Antibody-Positive Relatives with Human Leukocyte
More informationIMMUNOLOGY. Elementary Knowledge of Major Histocompatibility Complex and HLA Typing
IMMUNOLOGY Elementary Knowledge of Major Histocompatibility Complex and HLA Typing Tapasya Srivastava and Subrata Sinha Department of Biochemistry All India Institute of Medical Sciences New Delhi - 110029
More informationHLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.
www.ebmt.org HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationTargeting the Trimolecular Complex for Immune Intervention. Aaron Michels MD
Targeting the Trimolecular Complex for Immune Intervention Aaron Michels MD Disclosures Research Grant from Novartis. Research Grant from NovoNordisk. Take Home Points Type 1 diabetes is an immunologic
More informationSignificance of the MHC
CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationGenotyping of HLA-class-I by PCR-SSP of Iraqi Breast Cancer Patients
Genotyping of HLA-class-I by PCR-SSP of Iraqi Breast Cancer Patients Ahmed A.Al-Hassan 1 PhD, Nidhal Abdul Muhymen 1 MSc;PhD,Ala'a Ghany Hussien 2 FICMS, Ameera J. Al-Nema 3 MBChB. Abstract Background:
More informationPatients: Adult KPD patients (n 384) were followed longitudinally in a research clinic.
JCEM ONLINE Brief Report Endocrine Research Masked and Overt Autoantibodies Specific to the DPD Epitope of 65-kDa Glutamate Decarboxylase (GAD65- DPD) Are Associated With Preserved -Cell Functional Reserve
More informationHLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
More informationHLA Complex Genetics & Biology
HLA Complex Genetics & Biology M. Tevfik DORAK Environmental & Occupational Health College of Public Health Florida International University Miami, USA http://www.dorak.info Mount Sinai Medical Center
More informationIs affluence a risk factor for bronchial asthma and type 1 diabetes?
Pediatr Allergy Immunol 26: 17: 533 537 DOI: 1.1111/j.1399-338.26.445.x Ó 26 The Authors Journal compilation Ó 26 Blackwell Munksgaard PEDIRIC ALLERGY AND IMMUNOLOGY Is affluence a risk factor for bronchial
More informationDiabetologia. Originals. Will a three-allele model of inheritance explain the HLA data for Type 1 (insulin-dependent) diabetes? D. A.
Diabetologia (1985) 28:122-127 Diabetologia 9 Springer-Verlag 1985 Originals Will a three-allele model of inheritance explain the HLA data for Type 1 (insulin-dependent) diabetes? D. A. Greenberg Wadsworth
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Clinical Transplantation Laboratory (CTL) 3rd Floor Tower Wing Guy's Hospital SE9 1RT Contact: Jeremy Skinner Tel: +44 (0)2071881713 E-Mail:
More informationHLA class II DRB1 and DQB1 allelic polymorphism and sclerosing lymphocytic lobulitis of the breast
J Clin Pathol 1999;52:445 449 445 Department of Histopathology, Southampton University Hospitals, Southampton, UK A C Bateman J M Theaker Wessex Histocompatibility Laboratory, Southampton University Hospitals
More informationAssociation mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
More informationHLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute
HLA Mismatches Professor Steven GE Marsh HLA Mismatches HLA Genes, Structure, Polymorphism HLA Nomenclature HLA Mismatches in HSCT Defining a mismatch HLA Mismatches HLA Genes, Structure, Polymorphism
More informationProfiling HLA motifs by large scale peptide sequencing Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009
Profiling HLA motifs by large scale peptide sequencing 2009 Agilent Innovators Tour David K. Crockett ARUP Laboratories February 10, 2009 HLA Background The human leukocyte antigen system (HLA) is the
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationTHE ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS IN INTRONIC REGIONS OF ISLET CELL AUTOANTIGEN 1 AND TYPE 1 DIABETES MELLITUS.
THE ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS IN INTRONIC REGIONS OF ISLET CELL AUTOANTIGEN 1 AND TYPE 1 DIABETES MELLITUS by Carrie Lynn Blout B.S., Dickinson College, 2004 Submitted to the Graduate
More informationThe Predisposition to Type 1 Diabetes Linked to the Human Leukocyte Antigen Complex Includes at Least One Non Class II Gene
Am. J. Hum. Genet. 64:793 800, 1999 The Predisposition to Type 1 Diabetes Linked to the Human Leukocyte Antigen Complex Includes at Least One Non Class II Gene Benedicte A. Lie, 1 John A. Todd, 5,* Flemming
More informationHLA haplotype A33-B58-Cw10 may modulate radiographic development of bamboo spine in Taiwanese patients with primary ankylosing spondylitis
Disease Markers 26 (2009) 93 96 93 DOI 10.3233/DMA-2009-0619 IOS Press HLA haplotype A33-B58-Cw10 may modulate radiographic development of bamboo spine in Taiwanese patients with primary ankylosing spondylitis
More informationMODULE NO.14: Y-Chromosome Testing
SUBJECT Paper No. and Title Module No. and Title Module Tag FORENSIC SIENCE PAPER No.13: DNA Forensics MODULE No.21: Y-Chromosome Testing FSC_P13_M21 TABLE OF CONTENTS 1. Learning Outcome 2. Introduction:
More informationAdvances in Genetics Endocrine Research. Site: The study was conducted at a university referral center.
JCEM ONLINE Advances in Genetics Endocrine Research HLA Class II Haplotypes Differentiate Between the Adult Autoimmune Polyglandular Syndrome Types II and III B. K. Flesch, N. Matheis, T. Alt, C. Weinstock,
More informationRole of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT
Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Stephen Spellman, MBS Director, Immunobiology and Observational Research Assistant Scientific Director CIBMTR,
More informationHLA-A * L
What is Nomenclature? HLA Nomenclature 3.0 Signifies DNA Subtype Differences outside the coding region (introns) HLA-A * 4 0 01 0 L Steve Spellman Sr. Manager, NMDP Asst. Scientific Director, CIBMTR Locus
More informationAnalysis of HLA-A, HLA-B and HLA-DRB1 alleles in Chinese patients with lung cancer
Analysis of HLA-A, HLA-B and HLA-DRB1 alleles in Chinese patients with lung cancer L. Yang 1, L.J. Wang 3, G.L. Shi 2, L. Ni 3, C.X. Song 2, Z.X. Zhang 3 and S.F. Xu 1 1 Department of Thoracic Surgeon,
More informationMATCHMAKER, MATCHMAKER, MAKE ME A MATCH, FIND ME A MISMATCHED TRANSPLANT TO CATCH
MATCHMAKER, MATCHMAKER, MAKE ME A MATCH, FIND ME A MISMATCHED TRANSPLANT TO CATCH TEJASWINI M. DHAWALE, M.D. HEME FELLOWS CONFERENCE NOVEMBER 08, 2013 CASE PRESENTATION 51 yo M with history of MDS (unilinear
More information25/10/2017. Clinical Relevance of the HLA System in Blood Transfusion. Outline of talk. Major Histocompatibility Complex
Clinical Relevance of the HLA System in Blood Transfusion Dr Colin J Brown PhD FRCPath. October 2017 Outline of talk HLA genes, structure and function HLA and immune complications of transfusion TA-GVHD
More informationHLA complex genes in type 1 diabetes and other autoimmune diseases. Which genes are involved?
Review 93 through extensive genome replication accompanied by chromosome fusions and frequent rearrangements. Genetics 150, 1217 1228 6 Lagercrantz, U. and Lydiate, D. (1996) Comparative genome mapping
More informationCalculation Tables. Olerup SSP Kits without Taq Polymeras
Calculation Tables lerup SSP Kits without Taq Polymeras Table 1: Volumes of the components needed per test for different numbers of when using Master Mix without. The recommended volumes listed below include
More informationDQA1 and DQB1 Promoter diversity and linkage disequilibrium with class II haplotypes in Mexican Mestizo population
(2001) 2, 216 221 2001 Nature Publishing Group All rights reserved 1466-4879/01 $15.00 www.nature.com/gene DQA1 and DQB1 Promoter diversity and linkage disequilibrium with class II haplotypes in Mexican
More informationMolDX: HLA-DQB1*06:02 Testing for Narcolepsy
MolDX: HLA-DQB1*06:02 Testing for Narcolepsy CGS Administrators, LLC Jump to Section... Please Note: This is a Proposed LCD. Proposed LCDs are works in progress and not necessarily a reflection of the
More information