ALKA VITA DIABETES TEST
|
|
- Kenneth Watts
- 6 years ago
- Views:
Transcription
1 ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana
2 Study Number: Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O Group 2 -.5% Group 3-1.% Group % Alka Vita Group 5-2. % Glucose (mg/dl) ANIM AL 12-Aug Aug Aug Aug Aug Aug 7-Sep Sep Sep ID HOUR HOUR HOUR HOUR HOURDAY 5 DAY 7 DAY DAY DAY DAY DAY TIME S S S S S MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM
3 Study Number: Date of Study: 11 Aug - 21 Sep 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 ANIMAL ID Triglicerides (mg/dl) 12-Aug 16-Aug 18-Aug 23-Aug 3-Aug 7-Sep 13-Sep 2-Sep TIME 8 HOUR DAY 5 DAY 7 DAY 12 DAY 19 DAY 28 DAY 34 DAY 41 Group 1 - RO H2O Group 2 -.5% Group 3-1.% Group % Group 5-2. % MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM
4 Study Number: Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males 17-Jun- Date of Birth: 4 Group 1 - RO H2O Group 2 -.5% Group 3-1.% Group % Group 5-2. % Cholesterol (mg/dl) 12-Aug 23- Aug 3-Aug 7-Sep 13-Sep 2-Sep ANIMAL ID DAY TIME 8 HOUR 12 DAY 19 DAY 28 DAY 34 DAY MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM
5 Study Number: Date of Study: 11 Aug - 21 Sep 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 ANIMAL ID Body Weight (g) 11-Aug 12-Aug 18-Aug 25-Aug 1-Sep 8-Sep 15-Sep 2-Sep DAY DAY 1 DAY 7 DAY 14 DAY 21 DAY 28 DAY 35 DAY 4 Group 1 - RO H2O Group 2 -.5% Group 3-1.% Group % Group 5-2. % MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM
6
7 PCO-52: Effect of on Cataract 1 % of rats showing cataract PreClinOmics, Inc 1% AV
8 PCO-52: Effect of on Cataract 1% AV Cateract Cateract Left eye Right eye Left eye Right eye A A A Terminated A A C B B B B A Dead B C B B B C B C C A B Grading from A-D, A the lowest, D the highest Observation on week 2, 8 weeks after metformin treatment
9 PCO-61: Effect of on Glucose Start Oral gavaging at week % 1 % 3 Glucose (mg/dl)
10 PCO-61: Effect of on Glucose 4 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 3 Glucose (mg/dl) 2 1 Start Metformin dosing
11 PCO 52: Effect of on Fed Glucose (ZDF obese male rat starting at 11 weeks old; starting n=15) 6 * Glucose (mg/dl) % * P=.93 1 Metformin (5 mg/kg, p.o.)
12 PCO-61: Effect of on Triglyceride 15.5 % 1 % 1 TG (mg/dl)
13 PCO-61: Effect of on Triglyceride 15 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 1 TG (mg/dl) 5 Start Metformin dosing
14 PCO-61: Effect of on Cholesterol Start Oral gavaging at week % 1% 2 CHOL (mg/dl)
15 PCO-61: Effect of on Cholesterol 23 2 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV CHOL (mg/dl) Start Metformin dosing
16 PCO-61: Effect of on Body Weight (B6.V-Lep<OB>/J male mouse, starting at 11 weeks old) Start Oral gavaging at week % 1 % Body Weight (gram)
17 PCO-61: Effect of on Body Weight (B6.V-Lep<OB>/J male mouse, starting at 11 weeks old) 75 7 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV Body Weight (gram) Start Metformin dosing
18 PCO-61: Effect of on Body % HbA1C % 1 % 4 % HbA1C
19 PCO-61: Effect of on Body % HbA1C 6 5 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 4 % HbA1C Start Metformin dosing
20 PCO-61: Effect of on HDL Start Oral gavaging at week % 1 % HDL (mg/dl)
21 PCO-61: Effect of on HDL 25 2 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV HDL (mg/dl) Start Metformin dosing
22 PCO-61: Effect of on AST Start Oral gavaging at week % 1% AST(IU/L)
23 PCO-61: Effect of on AST 7 6 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 5 AST(IU/L) Start Metformin dosing
24 PCO-61: Effect of on ALT Start Oral gavaging at week % 1 % ALT (IU/L)
25 PCO-61: Effect of on ALT 1 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 8 ALT (IU/L) Start Metformin dosing
26 PCO-61: Effect of 1% of on mesenteric fat % Fat (g) % of body weight. Absolute fat weight % change
27 PCO-61: Effect of 1% of on epididimal fat 1. 1% 4 Fat (g) % of body weight. Absolute fat weight % change
PRECLINOMICS: ENZYME ASSAYS AND RODENT MODELS FOR METABOLIC DISEASES
4 PRECLINOMICS: ENZYME ASSAYS AND RODENT MODELS FOR METABOLIC DISEASES Wu-Kuang Yeh and Richard G. Peterson PreClinOmics, Inc., Indianapolis, Indiana I. INTRODUCTION The continuous improvement of human
More information2017 Employee Wellness Health Assessment Report
Employee Wellness National Consortium for Building Healthy Academic Communities (BHAC) Healthier Tennessee Workplace 2017 Employee Wellness Health Assessment Report Blood Pressure 2017 (387 total) (National
More informationOil Palm Phenolics and Diabetes: Lessons from the Nile Rat
Oil Palm Phenolics and Diabetes: Lessons from the Nile Rat Julia Bolsinger, Andrzej Pronczuk, Ravigadevi Sambanthamurthi, KC Hayes Hayes Laboratory and MPOB 5/21/213 The Nile grass rat (Arvicanthis niloticus)
More informationCt=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
More informationBCH 447. Triglyceride Determination in Serum
BCH 447 Triglyceride Determination in Serum Introduction: Triglycerides are esters of fatty acids and are hydrolyzed by lipase to glycerol and free fatty acids. Triglyceride determinations when performed
More informationFig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationINTRODUCTION TO NUTRITIONAL KETOSIS AND CLINICAL APPLICATIONS
INTRODUCTION TO NUTRITIONAL KETOSIS AND CLINICAL APPLICATIONS Jeff S. Volek, Ph.D., R.D. Professor Department of Human Sciences Kinesiology Program Columbus, OH 43210 volek.1@osu.edu LEARNING OBJECTIVES
More informationA COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS
A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS Rosario S. Sagum, Ph.D., Mildred A. Udarbe, MSc., Trinidad P. Trinidad, Ph.D. And
More informationObjectives. Objectives. Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015
Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015 Presentation downloaded from http://ce.unthsc.edu Objectives Understand that the obesity epidemic is also affecting children and adolescents
More informationThe Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk
The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine
More informationLaboratory analysis of the obese child recommendations and discussion. MacKenzi Hillard May 4, 2011
Laboratory analysis of the obese child recommendations and discussion MacKenzi Hillard May 4, 2011 aka: What to do with Fasting Labs The Obesity Epidemic The prevalence of obesity in adolescents has tripled
More informationDirector, Employee Health & Productivity. Coordinator, Employee Health & Productivity
Director, Employee Health & Productivity Coordinator, Employee Health & Productivity Table 2:. ChartE: Female HDL Cholesterol Risk Levels Optimal Borderline High Risk 80% 60% 40% 20% 0% LDL Cholesterol
More informationTriglyceride determination
Triglyceride determination Introduction: - Triglycerides are esters of fatty acids and are hydrolyzed to glycerol and free fatty acids (by lipase) - Triglyceride determinations when performed in conjunction
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationYun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
More information1. PROTOCOL. Comparison Study Summary. Tuality Healthcare 324 SE 9 th Ave. Suite E Hillsboro, OR July 30, 2014
Comparison Study Summary Tuality Healthcare 324 SE 9 th Ave. Suite E Hillsboro, OR 97123 July 30, 2014 1. PROTOCOL This study was conducted on July 24 th, 2014 at Tuality Healthcare, Hillsboro, OR. The
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationBeijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:
Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli
More informationCHALLENGING CASE PRESENTATION Steroid Induced Hyperglycemia
CHALLENGING CASE PRESENTATION Steroid Induced Hyperglycemia Javier Carrasco, MD, PhD Juan Ramón Jiménez Hospital University of Huelva, Spain Case Study: Medical and Social History A 60 years old female
More informationPediatric Obesity: Clinical Decision Tools*
Pediatric Obesity: Clinical Decision Tools* Contributing clinicians from the Be Forever Fit Program at Harbor-UCLA in partnership with UniHealth Foundation: Gangadarshni Chandramohan, MD 1 ; Sudhir Anand,
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationManagement of Gestational Diabetes
Management of Gestational Diabetes A Diabetes risk assessment should be ascertained at the First prenatal visit. Low Risk: Early blood glucose screening is NOT routinely required if most of the following
More informationANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease
ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol
More informationAm I at Risk for Type 2 Diabetes?
NATIONAL DIABETES INFORMATION CLEARINGHOUSE Am I at Risk for Type 2 Diabetes? Taking Steps to Lower Your Risk of Getting Diabetes U.S. Department of Health and Human Services National Institutes of Health
More informationAuthorized Distributor and Co-Packer of ANKASCIN 568-R Ingredients & ANKASCIN 568 Plus+ Finished Products
Authorized Distributor of Ankascin 568-R Ingredients and Authorized Co-Packer of Ankascin 568-Plus Finished Product Capsules Developments of chronic diseases Heart diseases, diabetes, and hypertension
More informationDiabetes Overview. How Food is Digested
Diabetes Overview You are The Teacher, The Coach and the Fan Pathophysiology of Diabetes Complications Know the Numbers Treatment Can Good Control Make a Difference? Can Tight Control Be too Tight? How
More informationARE YOU PRE-DIABETIC?
hclhealthcare.in ARE YOU PRE-DIABETIC? Read on to find out. 1800 103 7070 FOR APPOINTMENT If a blood test shows that a person's blood sugar is higher than normal but not high enough to be called Diabetes,
More informationDevelopment of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors
More informationNormal cholesterol level for men over 50
Normal cholesterol level for men over 50 Understand what your cholesterol levels mean: Total, LDL, for men and 50 mg per dl their respective numbers have to stay over or under a particular level,. 24-4-2017
More informationAm I at Risk for Type 2 Diabetes?
Am I at Risk for Type Diabetes? Taking Steps to Lower Your Risk of Getting Diabetes On this page: What is type diabetes? Can type diabetes be prevented? What are the signs and symptoms of type diabetes?
More information2010 ADA Guidelines: 1. Diagnostic Criteria for DM 2. Categories of increased risk of DM. Gerti Tashko, M.D. DM Journal Club 1/21/2010
2010 ADA Guidelines: 1. Diagnostic Criteria for DM 2. Categories of increased risk of DM Gerti Tashko, M.D. DM Journal Club 1/21/2010 NEW: Diagnosis with A1c 6.5% Cut point of A1c 6.5% diagnoses 33% less
More informationWhat is Diabetes Mellitus?
Normal Glucose Metabolism What is Diabetes Mellitus? When the amount of glucose in the blood increases, After a meal, it triggers the release of the hormone insulin from the pancreas. Insulin stimulates
More informationElevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with
Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti
More informationDr Aftab Ahmad Consultant Diabetologist at Royal Liverpool University Hospital Regional Diabetes Network Lead
Dr Aftab Ahmad Consultant Diabetologist at Royal Liverpool University Hospital Regional Diabetes Network Lead Today s Presentation HbA1c & diagnosing Diabetes What is Impaired Glucose & IGR? Implications
More informationSection 1: 1: Trends. Section 2: 2: Comparisons to to Overall Portland Area Area Results for for
Section 1: 1: Trends 2 Patients in the Diabetes Register 3 Diabetes Type 3 Gender of Patients with Diabetes 4 Age of Patients with Diabetes 4 Duration of Diabetes 5 Weight Control 6 Hemoglobin A1c 7 Blood
More informationVS: BP 165/90, P 98, RR 18, T 37 C; waist circ 38 in, Wt 240 lbs (109 kg), Ht 5'8''
IMC Didactic Case-Diabetes Mellitus Chief Complaint "I was recently diagnosed with diabetes and would like to have my blood sugar tested. I think that my blood sugar is running low because I have the shakes
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationHelpful Hints for Taking Care of Your Diabetes. Farahnaz Joarder, MD and Don Kain, MA, RD,CDE Harold Schnitzer Diabetes Health Center
Helpful Hints for Taking Care of Your Diabetes Farahnaz Joarder, MD and Don Kain, MA, RD,CDE Harold Schnitzer Diabetes Health Center Objectives How big of a problem is diabetes? What is diabetes? How is
More informationSupplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC
Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationClinical Study Assessment of Metformin as an Additional Treatment to Therapeutic Lifestyle Changes in Pediatric Patients with Metabolic Syndrome
Cholesterol Volume 2012, Article ID 961410, 5 pages doi:10.1155/2012/961410 Clinical Study Assessment of Metformin as an Additional Treatment to Therapeutic Lifestyle Changes in Pediatric Patients with
More informationMetabolic Syndrome in Asians
Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly
More informationWhy Screen at 23? What can YOU do?
Why Screen at 23? Every 1 in 2 Asian American adults has diabetes or prediabetes. More than half of Asian Americans did not know they have type 2 diabetes or prediabetes. Asian Americans can develop diabetes
More information2/13/2018. Update on Gestational Diabetes. Disclosure. Objectives. I have no financial conflicts of interest.
Update on Gestational Diabetes Lorie M. Harper, MD, MSCI Department of Obstetrics & Gynecology Division of Maternal-Fetal Medicine 2/18/2018 Disclosure I have no financial conflicts of interest. Objectives
More informationLiver Disease NASH/Fibrosis Model
Liver Disease NASH/Fibrosis Model Please contact: Dipti Deshpande PhD ddeshpande@woodlandpharma.com or Carol Gebert PhD cgebert@woodlandbiosciences.com 617-513-5280 Liver Diseases Comprise a Growing Market
More informationThe National Diabetes Prevention Program in Washington State March 2012
The National Diabetes Prevention Program in Washington State March 2012 Session Objectives 1. Overview of pre-diabetes. 2. Describe the Diabetes Prevention Program (DPP). 3. Eligibility for the DPP. 4.
More informationDisclosures. Diabetes and Obesity Care in Vulnerable Populations. Objectives. New diabetes cases, at long last, begin to fall 3/12/2016
Disclosures Diabetes and Obesity Care in Vulnerable Populations I have nothing to disclose Sarah Kim, MD Assistant Clinical Professor UCSF-SFGH To discuss the following: Objectives 1. Burden of diabetes
More information9/26/2018. Andy Weiler, M.Ed. September 26 th, 2018
Andy Weiler, M.Ed. September 26 th, 2018 1 2 Stay tuned for the answer to our riddle Riddle #2 3 Riddle #2 Riddle #2 4 Riddle #2 The answer: 50%/50% chance to be right Fluids: blood volume, body water,
More informationWIN UTILIZATION REPORT 7/1/2010 TO 6/30/2011
This image cannot currently be displayed. WIN UTILIZATION REPORT 7/1/2010 TO 6/30/2011 EXPERTISE PARTNERSHIP V A L U E October 18, 2011 T R E N D S A N A L Y S I S S T A T I S T I C S P L A N N I N G T
More informationMetabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology
Metabolic Syndrome Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Disclosure No conflict of interest No financial disclosure Does This Patient Have Metabolic Syndrome? 1. Yes 2. No Does This Patient
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationSupplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).
Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between
More informationClient Report Screening Program Results For: Missouri Western State University October 28, 2013
Client Report For: Missouri Western State University October 28, 2013 Executive Summary PROGRAM OVERVIEW From 1/1/2013-9/30/2013, Missouri Western State University participants participated in a screening
More informationNutritional Cases with CKD HEMODIALYSIS
Nutritional Cases with CKD HEMODIALYSIS S. Muge DEGER, MD, FISN Yuksek Ihtisas University Faculty of Medicine, Koru Hospital Department of Nephrology Ankara, TURKEY CASE-1 BC, is a 60- year- old Caucasian
More informationTesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
More informationNOT-FED Study New Obesity Treatment- Fasting, Exercise, Diet
NOT-FED Study New Obesity Treatment- Fasting, Exercise, Diet FASTING 16 hours a day EXCERCISE 150 min a week DIET Low carb NOSM Northern Research Conference, Kenora, 2018 R Minty, T O Driscoll, L Kelly,
More informationKnow Your Number Aggregate Report Single Analysis Compared to National Averages
Know Your Number Aggregate Report Single Analysis Compared to National s Client: Study Population: 2242 Population: 3,000 Date Range: 04/20/07-08/08/07 Version of Report: V6.2 Page 2 Study Population Demographics
More informationLipids Types, Food Sources, Functions
Lipids Types, Food Sources, Functions What Are Lipids? Lipids Diverse group of molecules that are insoluble in water Fats The lipid content of diets and foods 1 Lipids in Body Cells and Tissues Types of
More informationDIABETES. A growing problem
DIABETES A growing problem Countries still grappling with infectious diseases such as tuberculosis, HIV/AIDS and malaria now face a double burden of disease Major social and economic change has brought
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationOrganochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism
Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao
More informationBlood Pressure Measurement (children> 3 yrs)
Blood Pressure Measurement (children> 3 yrs) If initial BP elevated, repeat BP manually 2x and average, then classify Normal BP Systolic and diastolic
More informationThe antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
More informationClinical Study Synopsis
Clinical Study Synopsis This Clinical Study Synopsis is provided for patients and healthcare professionals to increase the transparency of Bayer's clinical research. This document is not intended to replace
More informationHigh intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes
High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes Sophie Cassidy, s.cassidy@ncl.ac.uk 1) Concentric remodelling 1.2 * Eccentricity ratio
More informationCounseling and Long-term Follow up After Gestational Disorders
Counseling and Long-term Follow up After Gestational Disorders Tanya Melnik, MD Assistant Professor, University of Minnesota Sarina Martini, MD Ob/Gyn Resident, PGY4 University of Minnesota Counseling
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationPrevalence of non-alcoholic fatty liver disease in type 2 diabetes mellitus patients in a tertiary care hospital of Bihar
Original Research Article Prevalence of non-alcoholic fatty liver disease in type 2 diabetes mellitus patients in a tertiary care hospital of Bihar Naresh Kumar 1, Jyoti Kumar Dinkar 2*, Chandrakishore
More information2013 Hypertension Measure Group Patient Visit Form
Please complete the form below for 20 or more unique patients meeting patient sample criteria for the measure group for the current reporting year. A majority (11 or more) patients must be Medicare Part
More informationKerri Wade, RN, MSN, PPCNP-BC Children s Mercy APRN Annual Conference October 7, The Children's Mercy Hospital, 2016
12345 Fit-Tastic: A Tool for Combating Childhood Obesity Kerri Wade, RN, MSN, PPCNP-BC Children s Mercy APRN Annual Conference October 7, 2016 The Children's Mercy Hospital, 2016 Disclosure I am a nurse
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationFigure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution
Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution of A: total cholesterol (TC); B: low-density lipoprotein
More informationTypes of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline
INTRODUCTION TO BIOSTATISTICS FOR GRADUATE AND MEDICAL STUDENTS Files for today (June 27) Lecture and Homework Descriptive Statistics and Graphically Visualizing Data Lecture #2 (1 file) PPT presentation
More informationInternational Journal of Research in Pharmacology & Pharmacotherapeutics
International Journal of Research in Pharmacology & Pharmacotherapeutics ISSN Print: 2278-2648 IJRPP Vol.3 Issue 4 Oct-Dec-2014 ISSN Online: 2278-2656 Journal Home page: Research article Open Access Anti-diabetic
More informationYour Guide to Managing and Understanding Your Cholesterol Levels
Your Guide to Managing and Understanding Your Cholesterol Levels Our goal at Bon Secours is to help you be well. Our experienced Heart Team includes cardiologists, cardiovascular surgeons, electrophysiologists,
More informationMetabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
More informationPrediabetes 101. What is it and what can I do about it? Intermountainhealthcare.org/diabetes
Prediabetes 101 What is it and what can I do about it? Patient Education Intermountainhealthcare.org/diabetes What do you already know about prediabetes? Fact or Fiction? There are often no symptoms of
More informationMetabolic Syndrome. Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah
Metabolic Syndrome Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah Objectives Be able to outline the pathophysiology of the metabolic syndrome Be able to list diagnostic criteria for
More informationBiochemistry Adult Reference Ranges
Certified correct on 28/06/2016 Biochemistry Adult Reference Ranges Test Reference range Units Reference range from Traceable to standard reference material Albumin 35 50 g/l Pathology IRMM ERM-DA470k/IFCC
More informationUpdate On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown
More informationBariatric Surgery vs. Intensive Medical Therapy in Obese Diabetic Patients: 3-Year Outcomes
Bariatric Surgery vs. Intensive Medical Therapy in Obese Diabetic Patients: 3-Year Outcomes Results of the STAMPEDE Trial Philip R Schauer, Deepak L Bhatt, John P Kirwan, Kathy Wolski, Stacy A Brethauer,
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More information1- THE USE OF EARLY-AGE FEED RESTRICTION AND/OR POTASSIUM CHLORIDE FOR ALLEVIATING THE ADVERSE EFFECTS OF HEAT STRESS ON BROILER CHICKS: 1.
1- THE USE OF EARLY-AGE FEED RESTRICTION AND/OR POTASSIUM CHLORIDE FOR ALLEVIATING THE ADVERSE EFFECTS OF HEAT STRESS ON BROILER CHICKS: 1. EFFECTS ON BROILER PERFORMANCE, CARCASS TRAITS AND ECONOMIC EFFICIENCY.
More informationRagaglitazar Lowers Glucose, Triglycerides In Type 2 Patients. (Investigational Diabetes Drug).: An Article From: Internal Medicine News [HTML]
Ragaglitazar Lowers Glucose, Triglycerides In Type 2 Patients. (Investigational Diabetes Drug).: An Article From: Internal Medicine News [HTML] [Digital] If searching for the book Ragaglitazar lowers glucose,
More informationOverweight and Obesity in Older Persons: Impact Upon Health and Mortality Outcomes
Overweight and Obesity in Older Persons: Impact Upon Health and Mortality Outcomes Gordon L Jensen, MD, PhD Senior Associate Dean for Research Professor of Medicine and Nutrition Objectives Health outcomes
More informationReduced 10-year Risk of CHD in Patients who Participated in Communitybased DPP: The DEPLOY Pilot Study
Diabetes Care Publish Ahead of Print, published online December 23, 2008 Reduced 10-year CHD Risk: DEPLOY Pilot Study Reduced 10-year Risk of CHD in Patients who Participated in Communitybased DPP: The
More informationEvaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
More informationWELL-WOMAN EXAM REVEALS RISK. Katie Jones, MPH, CHES Iowa Department of Public Health Erin Hinderaker, MS, RD, LD Des Moines University
WELL-WOMAN EXAM REVEALS RISK Katie Jones, MPH, CHES Iowa Department of Public Health Erin Hinderaker, MS, RD, LD Des Moines University Disclaimer The information provided in this presentation is for informational
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationInsulin Sensitivity and Secretion in Youth: From Normal to Diabetes
Insulin Sensitivity and Secretion in Youth: From Normal to Diabetes Silva A. Arslanian MD Richard L. Day Professor of Pediatrics 1 year Jubilee, The Queen Silvia Children s Hospital Gothenburg, Sweden
More information6/10/2016. Hui-Chun Hsu
Hui-Chun Hsu PhD, RN, CDE Chief, Department of Diabetes Management Lee s Endocrinology Clinic Pingtung, Taiwan Disclosure to Participants Conflict of Interest (COI) and Financial Relationship Disclosures:
More informationUse of Target Values in EQA
Use of Target Values in EQA Dr. Anja Kessler Bonn, Germany 1 External Quality Assessment Example: Progesterone 580 participants Measurement principles: Luminescence detection Radioactivity detection Fluorescence
More informationLearning Objectives. Disclosures. Self Assessment Questions. Background
Association of Hyperuricemia with Liver Dysfunction amongst Adults with Metabolic Disorders in the United States: A Cross Sectional Study Disclosures Dr. Prashant Sakharkar and Dr. Subrata Deb declare(s)
More informationEffects of Rosiglitazone and Metformin as monotherapy and in combination on high fructose diet induced hyperglycemia and dyslipidaemia in rats
Original Research Article Effects of Rosiglitazone and Metformin as monotherapy and in combination on high fructose diet induced hyperglycemia and dyslipidaemia in rats Sushil Sharma*, Amol Khanapure 1Department
More informationCase Presentation. Rafael Bitzur The Bert W Strassburger Lipid Center Sheba Medical Center Tel Hashomer
Case Presentation Rafael Bitzur The Bert W Strassburger Lipid Center Sheba Medical Center Tel Hashomer Case Presentation 50 YO man NSTEMI treated with PCI 1 month ago Medical History: Obesity: BMI 32,
More informationMEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.
MEMORANDUM Originating Department Chemical Pathology Issued By: Issued To: Subject: Details: Dr. Shari Srinivasan All Laboratory Service Users Change in Chemical Pathology Analysers Dear Colleague, As
More information