ALKA VITA DIABETES TEST

Size: px
Start display at page:

Download "ALKA VITA DIABETES TEST"

Transcription

1 ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana

2 Study Number: Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O Group 2 -.5% Group 3-1.% Group % Alka Vita Group 5-2. % Glucose (mg/dl) ANIM AL 12-Aug Aug Aug Aug Aug Aug 7-Sep Sep Sep ID HOUR HOUR HOUR HOUR HOURDAY 5 DAY 7 DAY DAY DAY DAY DAY TIME S S S S S MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM

3 Study Number: Date of Study: 11 Aug - 21 Sep 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 ANIMAL ID Triglicerides (mg/dl) 12-Aug 16-Aug 18-Aug 23-Aug 3-Aug 7-Sep 13-Sep 2-Sep TIME 8 HOUR DAY 5 DAY 7 DAY 12 DAY 19 DAY 28 DAY 34 DAY 41 Group 1 - RO H2O Group 2 -.5% Group 3-1.% Group % Group 5-2. % MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM

4 Study Number: Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males 17-Jun- Date of Birth: 4 Group 1 - RO H2O Group 2 -.5% Group 3-1.% Group % Group 5-2. % Cholesterol (mg/dl) 12-Aug 23- Aug 3-Aug 7-Sep 13-Sep 2-Sep ANIMAL ID DAY TIME 8 HOUR 12 DAY 19 DAY 28 DAY 34 DAY MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM

5 Study Number: Date of Study: 11 Aug - 21 Sep 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 ANIMAL ID Body Weight (g) 11-Aug 12-Aug 18-Aug 25-Aug 1-Sep 8-Sep 15-Sep 2-Sep DAY DAY 1 DAY 7 DAY 14 DAY 21 DAY 28 DAY 35 DAY 4 Group 1 - RO H2O Group 2 -.5% Group 3-1.% Group % Group 5-2. % MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM MEAN ST DEV SEM

6

7 PCO-52: Effect of on Cataract 1 % of rats showing cataract PreClinOmics, Inc 1% AV

8 PCO-52: Effect of on Cataract 1% AV Cateract Cateract Left eye Right eye Left eye Right eye A A A Terminated A A C B B B B A Dead B C B B B C B C C A B Grading from A-D, A the lowest, D the highest Observation on week 2, 8 weeks after metformin treatment

9 PCO-61: Effect of on Glucose Start Oral gavaging at week % 1 % 3 Glucose (mg/dl)

10 PCO-61: Effect of on Glucose 4 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 3 Glucose (mg/dl) 2 1 Start Metformin dosing

11 PCO 52: Effect of on Fed Glucose (ZDF obese male rat starting at 11 weeks old; starting n=15) 6 * Glucose (mg/dl) % * P=.93 1 Metformin (5 mg/kg, p.o.)

12 PCO-61: Effect of on Triglyceride 15.5 % 1 % 1 TG (mg/dl)

13 PCO-61: Effect of on Triglyceride 15 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 1 TG (mg/dl) 5 Start Metformin dosing

14 PCO-61: Effect of on Cholesterol Start Oral gavaging at week % 1% 2 CHOL (mg/dl)

15 PCO-61: Effect of on Cholesterol 23 2 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV CHOL (mg/dl) Start Metformin dosing

16 PCO-61: Effect of on Body Weight (B6.V-Lep<OB>/J male mouse, starting at 11 weeks old) Start Oral gavaging at week % 1 % Body Weight (gram)

17 PCO-61: Effect of on Body Weight (B6.V-Lep<OB>/J male mouse, starting at 11 weeks old) 75 7 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV Body Weight (gram) Start Metformin dosing

18 PCO-61: Effect of on Body % HbA1C % 1 % 4 % HbA1C

19 PCO-61: Effect of on Body % HbA1C 6 5 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 4 % HbA1C Start Metformin dosing

20 PCO-61: Effect of on HDL Start Oral gavaging at week % 1 % HDL (mg/dl)

21 PCO-61: Effect of on HDL 25 2 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV HDL (mg/dl) Start Metformin dosing

22 PCO-61: Effect of on AST Start Oral gavaging at week % 1% AST(IU/L)

23 PCO-61: Effect of on AST 7 6 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 5 AST(IU/L) Start Metformin dosing

24 PCO-61: Effect of on ALT Start Oral gavaging at week % 1 % ALT (IU/L)

25 PCO-61: Effect of on ALT 1 Metformin(5 mg/kg)/h2o Metformin(5 mg/kg)/.5% AV 8 ALT (IU/L) Start Metformin dosing

26 PCO-61: Effect of 1% of on mesenteric fat % Fat (g) % of body weight. Absolute fat weight % change

27 PCO-61: Effect of 1% of on epididimal fat 1. 1% 4 Fat (g) % of body weight. Absolute fat weight % change

PRECLINOMICS: ENZYME ASSAYS AND RODENT MODELS FOR METABOLIC DISEASES

PRECLINOMICS: ENZYME ASSAYS AND RODENT MODELS FOR METABOLIC DISEASES 4 PRECLINOMICS: ENZYME ASSAYS AND RODENT MODELS FOR METABOLIC DISEASES Wu-Kuang Yeh and Richard G. Peterson PreClinOmics, Inc., Indianapolis, Indiana I. INTRODUCTION The continuous improvement of human

More information

2017 Employee Wellness Health Assessment Report

2017 Employee Wellness Health Assessment Report Employee Wellness National Consortium for Building Healthy Academic Communities (BHAC) Healthier Tennessee Workplace 2017 Employee Wellness Health Assessment Report Blood Pressure 2017 (387 total) (National

More information

Oil Palm Phenolics and Diabetes: Lessons from the Nile Rat

Oil Palm Phenolics and Diabetes: Lessons from the Nile Rat Oil Palm Phenolics and Diabetes: Lessons from the Nile Rat Julia Bolsinger, Andrzej Pronczuk, Ravigadevi Sambanthamurthi, KC Hayes Hayes Laboratory and MPOB 5/21/213 The Nile grass rat (Arvicanthis niloticus)

More information

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl) a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6

More information

BCH 447. Triglyceride Determination in Serum

BCH 447. Triglyceride Determination in Serum BCH 447 Triglyceride Determination in Serum Introduction: Triglycerides are esters of fatty acids and are hydrolyzed by lipase to glycerol and free fatty acids. Triglyceride determinations when performed

More information

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

INTRODUCTION TO NUTRITIONAL KETOSIS AND CLINICAL APPLICATIONS

INTRODUCTION TO NUTRITIONAL KETOSIS AND CLINICAL APPLICATIONS INTRODUCTION TO NUTRITIONAL KETOSIS AND CLINICAL APPLICATIONS Jeff S. Volek, Ph.D., R.D. Professor Department of Human Sciences Kinesiology Program Columbus, OH 43210 volek.1@osu.edu LEARNING OBJECTIVES

More information

A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS

A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS Rosario S. Sagum, Ph.D., Mildred A. Udarbe, MSc., Trinidad P. Trinidad, Ph.D. And

More information

Objectives. Objectives. Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015

Objectives. Objectives. Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015 Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015 Presentation downloaded from http://ce.unthsc.edu Objectives Understand that the obesity epidemic is also affecting children and adolescents

More information

The Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk

The Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine

More information

Laboratory analysis of the obese child recommendations and discussion. MacKenzi Hillard May 4, 2011

Laboratory analysis of the obese child recommendations and discussion. MacKenzi Hillard May 4, 2011 Laboratory analysis of the obese child recommendations and discussion MacKenzi Hillard May 4, 2011 aka: What to do with Fasting Labs The Obesity Epidemic The prevalence of obesity in adolescents has tripled

More information

Director, Employee Health & Productivity. Coordinator, Employee Health & Productivity

Director, Employee Health & Productivity. Coordinator, Employee Health & Productivity Director, Employee Health & Productivity Coordinator, Employee Health & Productivity Table 2:. ChartE: Female HDL Cholesterol Risk Levels Optimal Borderline High Risk 80% 60% 40% 20% 0% LDL Cholesterol

More information

Triglyceride determination

Triglyceride determination Triglyceride determination Introduction: - Triglycerides are esters of fatty acids and are hydrolyzed to glycerol and free fatty acids (by lipase) - Triglyceride determinations when performed in conjunction

More information

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

The role of apolipoprotein D in lipid metabolism and metabolic syndrome UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated

More information

Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019

Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019 Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,

More information

1. PROTOCOL. Comparison Study Summary. Tuality Healthcare 324 SE 9 th Ave. Suite E Hillsboro, OR July 30, 2014

1. PROTOCOL. Comparison Study Summary. Tuality Healthcare 324 SE 9 th Ave. Suite E Hillsboro, OR July 30, 2014 Comparison Study Summary Tuality Healthcare 324 SE 9 th Ave. Suite E Hillsboro, OR 97123 July 30, 2014 1. PROTOCOL This study was conducted on July 24 th, 2014 at Tuality Healthcare, Hillsboro, OR. The

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:

Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author: Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli

More information

CHALLENGING CASE PRESENTATION Steroid Induced Hyperglycemia

CHALLENGING CASE PRESENTATION Steroid Induced Hyperglycemia CHALLENGING CASE PRESENTATION Steroid Induced Hyperglycemia Javier Carrasco, MD, PhD Juan Ramón Jiménez Hospital University of Huelva, Spain Case Study: Medical and Social History A 60 years old female

More information

Pediatric Obesity: Clinical Decision Tools*

Pediatric Obesity: Clinical Decision Tools* Pediatric Obesity: Clinical Decision Tools* Contributing clinicians from the Be Forever Fit Program at Harbor-UCLA in partnership with UniHealth Foundation: Gangadarshni Chandramohan, MD 1 ; Sudhir Anand,

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Management of Gestational Diabetes

Management of Gestational Diabetes Management of Gestational Diabetes A Diabetes risk assessment should be ascertained at the First prenatal visit. Low Risk: Early blood glucose screening is NOT routinely required if most of the following

More information

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol

More information

Am I at Risk for Type 2 Diabetes?

Am I at Risk for Type 2 Diabetes? NATIONAL DIABETES INFORMATION CLEARINGHOUSE Am I at Risk for Type 2 Diabetes? Taking Steps to Lower Your Risk of Getting Diabetes U.S. Department of Health and Human Services National Institutes of Health

More information

Authorized Distributor and Co-Packer of ANKASCIN 568-R Ingredients & ANKASCIN 568 Plus+ Finished Products

Authorized Distributor and Co-Packer of ANKASCIN 568-R Ingredients & ANKASCIN 568 Plus+ Finished Products Authorized Distributor of Ankascin 568-R Ingredients and Authorized Co-Packer of Ankascin 568-Plus Finished Product Capsules Developments of chronic diseases Heart diseases, diabetes, and hypertension

More information

Diabetes Overview. How Food is Digested

Diabetes Overview. How Food is Digested Diabetes Overview You are The Teacher, The Coach and the Fan Pathophysiology of Diabetes Complications Know the Numbers Treatment Can Good Control Make a Difference? Can Tight Control Be too Tight? How

More information

ARE YOU PRE-DIABETIC?

ARE YOU PRE-DIABETIC? hclhealthcare.in ARE YOU PRE-DIABETIC? Read on to find out. 1800 103 7070 FOR APPOINTMENT If a blood test shows that a person's blood sugar is higher than normal but not high enough to be called Diabetes,

More information

Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia

Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors

More information

Normal cholesterol level for men over 50

Normal cholesterol level for men over 50 Normal cholesterol level for men over 50 Understand what your cholesterol levels mean: Total, LDL, for men and 50 mg per dl their respective numbers have to stay over or under a particular level,. 24-4-2017

More information

Am I at Risk for Type 2 Diabetes?

Am I at Risk for Type 2 Diabetes? Am I at Risk for Type Diabetes? Taking Steps to Lower Your Risk of Getting Diabetes On this page: What is type diabetes? Can type diabetes be prevented? What are the signs and symptoms of type diabetes?

More information

2010 ADA Guidelines: 1. Diagnostic Criteria for DM 2. Categories of increased risk of DM. Gerti Tashko, M.D. DM Journal Club 1/21/2010

2010 ADA Guidelines: 1. Diagnostic Criteria for DM 2. Categories of increased risk of DM. Gerti Tashko, M.D. DM Journal Club 1/21/2010 2010 ADA Guidelines: 1. Diagnostic Criteria for DM 2. Categories of increased risk of DM Gerti Tashko, M.D. DM Journal Club 1/21/2010 NEW: Diagnosis with A1c 6.5% Cut point of A1c 6.5% diagnoses 33% less

More information

What is Diabetes Mellitus?

What is Diabetes Mellitus? Normal Glucose Metabolism What is Diabetes Mellitus? When the amount of glucose in the blood increases, After a meal, it triggers the release of the hormone insulin from the pancreas. Insulin stimulates

More information

Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with

Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti

More information

Dr Aftab Ahmad Consultant Diabetologist at Royal Liverpool University Hospital Regional Diabetes Network Lead

Dr Aftab Ahmad Consultant Diabetologist at Royal Liverpool University Hospital Regional Diabetes Network Lead Dr Aftab Ahmad Consultant Diabetologist at Royal Liverpool University Hospital Regional Diabetes Network Lead Today s Presentation HbA1c & diagnosing Diabetes What is Impaired Glucose & IGR? Implications

More information

Section 1: 1: Trends. Section 2: 2: Comparisons to to Overall Portland Area Area Results for for

Section 1: 1: Trends. Section 2: 2: Comparisons to to Overall Portland Area Area Results for for Section 1: 1: Trends 2 Patients in the Diabetes Register 3 Diabetes Type 3 Gender of Patients with Diabetes 4 Age of Patients with Diabetes 4 Duration of Diabetes 5 Weight Control 6 Hemoglobin A1c 7 Blood

More information

VS: BP 165/90, P 98, RR 18, T 37 C; waist circ 38 in, Wt 240 lbs (109 kg), Ht 5'8''

VS: BP 165/90, P 98, RR 18, T 37 C; waist circ 38 in, Wt 240 lbs (109 kg), Ht 5'8'' IMC Didactic Case-Diabetes Mellitus Chief Complaint "I was recently diagnosed with diabetes and would like to have my blood sugar tested. I think that my blood sugar is running low because I have the shakes

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Helpful Hints for Taking Care of Your Diabetes. Farahnaz Joarder, MD and Don Kain, MA, RD,CDE Harold Schnitzer Diabetes Health Center

Helpful Hints for Taking Care of Your Diabetes. Farahnaz Joarder, MD and Don Kain, MA, RD,CDE Harold Schnitzer Diabetes Health Center Helpful Hints for Taking Care of Your Diabetes Farahnaz Joarder, MD and Don Kain, MA, RD,CDE Harold Schnitzer Diabetes Health Center Objectives How big of a problem is diabetes? What is diabetes? How is

More information

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

ROUTINE LAB STUDIES. Routine Clinic Lab Studies ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not

More information

Clinical Study Assessment of Metformin as an Additional Treatment to Therapeutic Lifestyle Changes in Pediatric Patients with Metabolic Syndrome

Clinical Study Assessment of Metformin as an Additional Treatment to Therapeutic Lifestyle Changes in Pediatric Patients with Metabolic Syndrome Cholesterol Volume 2012, Article ID 961410, 5 pages doi:10.1155/2012/961410 Clinical Study Assessment of Metformin as an Additional Treatment to Therapeutic Lifestyle Changes in Pediatric Patients with

More information

Metabolic Syndrome in Asians

Metabolic Syndrome in Asians Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly

More information

Why Screen at 23? What can YOU do?

Why Screen at 23? What can YOU do? Why Screen at 23? Every 1 in 2 Asian American adults has diabetes or prediabetes. More than half of Asian Americans did not know they have type 2 diabetes or prediabetes. Asian Americans can develop diabetes

More information

2/13/2018. Update on Gestational Diabetes. Disclosure. Objectives. I have no financial conflicts of interest.

2/13/2018. Update on Gestational Diabetes. Disclosure. Objectives. I have no financial conflicts of interest. Update on Gestational Diabetes Lorie M. Harper, MD, MSCI Department of Obstetrics & Gynecology Division of Maternal-Fetal Medicine 2/18/2018 Disclosure I have no financial conflicts of interest. Objectives

More information

Liver Disease NASH/Fibrosis Model

Liver Disease NASH/Fibrosis Model Liver Disease NASH/Fibrosis Model Please contact: Dipti Deshpande PhD ddeshpande@woodlandpharma.com or Carol Gebert PhD cgebert@woodlandbiosciences.com 617-513-5280 Liver Diseases Comprise a Growing Market

More information

The National Diabetes Prevention Program in Washington State March 2012

The National Diabetes Prevention Program in Washington State March 2012 The National Diabetes Prevention Program in Washington State March 2012 Session Objectives 1. Overview of pre-diabetes. 2. Describe the Diabetes Prevention Program (DPP). 3. Eligibility for the DPP. 4.

More information

Disclosures. Diabetes and Obesity Care in Vulnerable Populations. Objectives. New diabetes cases, at long last, begin to fall 3/12/2016

Disclosures. Diabetes and Obesity Care in Vulnerable Populations. Objectives. New diabetes cases, at long last, begin to fall 3/12/2016 Disclosures Diabetes and Obesity Care in Vulnerable Populations I have nothing to disclose Sarah Kim, MD Assistant Clinical Professor UCSF-SFGH To discuss the following: Objectives 1. Burden of diabetes

More information

9/26/2018. Andy Weiler, M.Ed. September 26 th, 2018

9/26/2018. Andy Weiler, M.Ed. September 26 th, 2018 Andy Weiler, M.Ed. September 26 th, 2018 1 2 Stay tuned for the answer to our riddle Riddle #2 3 Riddle #2 Riddle #2 4 Riddle #2 The answer: 50%/50% chance to be right Fluids: blood volume, body water,

More information

WIN UTILIZATION REPORT 7/1/2010 TO 6/30/2011

WIN UTILIZATION REPORT 7/1/2010 TO 6/30/2011 This image cannot currently be displayed. WIN UTILIZATION REPORT 7/1/2010 TO 6/30/2011 EXPERTISE PARTNERSHIP V A L U E October 18, 2011 T R E N D S A N A L Y S I S S T A T I S T I C S P L A N N I N G T

More information

Metabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology

Metabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Metabolic Syndrome Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Disclosure No conflict of interest No financial disclosure Does This Patient Have Metabolic Syndrome? 1. Yes 2. No Does This Patient

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU).

Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). Supplementary Table 1. Blood glucose levels in male Zucker fa/fa rat during 1 month treatment with either vehicle or Chinese medicine (JCU). JCU (4g/kg) n=7 Vehicle (water 10 ml/kg) n=5 P value (between

More information

Client Report Screening Program Results For: Missouri Western State University October 28, 2013

Client Report Screening Program Results For: Missouri Western State University October 28, 2013 Client Report For: Missouri Western State University October 28, 2013 Executive Summary PROGRAM OVERVIEW From 1/1/2013-9/30/2013, Missouri Western State University participants participated in a screening

More information

Nutritional Cases with CKD HEMODIALYSIS

Nutritional Cases with CKD HEMODIALYSIS Nutritional Cases with CKD HEMODIALYSIS S. Muge DEGER, MD, FISN Yuksek Ihtisas University Faculty of Medicine, Koru Hospital Department of Nephrology Ankara, TURKEY CASE-1 BC, is a 60- year- old Caucasian

More information

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin

More information

NOT-FED Study New Obesity Treatment- Fasting, Exercise, Diet

NOT-FED Study New Obesity Treatment- Fasting, Exercise, Diet NOT-FED Study New Obesity Treatment- Fasting, Exercise, Diet FASTING 16 hours a day EXCERCISE 150 min a week DIET Low carb NOSM Northern Research Conference, Kenora, 2018 R Minty, T O Driscoll, L Kelly,

More information

Know Your Number Aggregate Report Single Analysis Compared to National Averages

Know Your Number Aggregate Report Single Analysis Compared to National Averages Know Your Number Aggregate Report Single Analysis Compared to National s Client: Study Population: 2242 Population: 3,000 Date Range: 04/20/07-08/08/07 Version of Report: V6.2 Page 2 Study Population Demographics

More information

Lipids Types, Food Sources, Functions

Lipids Types, Food Sources, Functions Lipids Types, Food Sources, Functions What Are Lipids? Lipids Diverse group of molecules that are insoluble in water Fats The lipid content of diets and foods 1 Lipids in Body Cells and Tissues Types of

More information

DIABETES. A growing problem

DIABETES. A growing problem DIABETES A growing problem Countries still grappling with infectious diseases such as tuberculosis, HIV/AIDS and malaria now face a double burden of disease Major social and economic change has brought

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism

Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao

More information

Blood Pressure Measurement (children> 3 yrs)

Blood Pressure Measurement (children> 3 yrs) Blood Pressure Measurement (children> 3 yrs) If initial BP elevated, repeat BP manually 2x and average, then classify Normal BP Systolic and diastolic

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

Clinical Study Synopsis

Clinical Study Synopsis Clinical Study Synopsis This Clinical Study Synopsis is provided for patients and healthcare professionals to increase the transparency of Bayer's clinical research. This document is not intended to replace

More information

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes

High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes Sophie Cassidy, s.cassidy@ncl.ac.uk 1) Concentric remodelling 1.2 * Eccentricity ratio

More information

Counseling and Long-term Follow up After Gestational Disorders

Counseling and Long-term Follow up After Gestational Disorders Counseling and Long-term Follow up After Gestational Disorders Tanya Melnik, MD Assistant Professor, University of Minnesota Sarina Martini, MD Ob/Gyn Resident, PGY4 University of Minnesota Counseling

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Prevalence of non-alcoholic fatty liver disease in type 2 diabetes mellitus patients in a tertiary care hospital of Bihar

Prevalence of non-alcoholic fatty liver disease in type 2 diabetes mellitus patients in a tertiary care hospital of Bihar Original Research Article Prevalence of non-alcoholic fatty liver disease in type 2 diabetes mellitus patients in a tertiary care hospital of Bihar Naresh Kumar 1, Jyoti Kumar Dinkar 2*, Chandrakishore

More information

2013 Hypertension Measure Group Patient Visit Form

2013 Hypertension Measure Group Patient Visit Form Please complete the form below for 20 or more unique patients meeting patient sample criteria for the measure group for the current reporting year. A majority (11 or more) patients must be Medicare Part

More information

Kerri Wade, RN, MSN, PPCNP-BC Children s Mercy APRN Annual Conference October 7, The Children's Mercy Hospital, 2016

Kerri Wade, RN, MSN, PPCNP-BC Children s Mercy APRN Annual Conference October 7, The Children's Mercy Hospital, 2016 12345 Fit-Tastic: A Tool for Combating Childhood Obesity Kerri Wade, RN, MSN, PPCNP-BC Children s Mercy APRN Annual Conference October 7, 2016 The Children's Mercy Hospital, 2016 Disclosure I am a nurse

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution

Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution of A: total cholesterol (TC); B: low-density lipoprotein

More information

Types of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline

Types of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline INTRODUCTION TO BIOSTATISTICS FOR GRADUATE AND MEDICAL STUDENTS Files for today (June 27) Lecture and Homework Descriptive Statistics and Graphically Visualizing Data Lecture #2 (1 file) PPT presentation

More information

International Journal of Research in Pharmacology & Pharmacotherapeutics

International Journal of Research in Pharmacology & Pharmacotherapeutics International Journal of Research in Pharmacology & Pharmacotherapeutics ISSN Print: 2278-2648 IJRPP Vol.3 Issue 4 Oct-Dec-2014 ISSN Online: 2278-2656 Journal Home page: Research article Open Access Anti-diabetic

More information

Your Guide to Managing and Understanding Your Cholesterol Levels

Your Guide to Managing and Understanding Your Cholesterol Levels Your Guide to Managing and Understanding Your Cholesterol Levels Our goal at Bon Secours is to help you be well. Our experienced Heart Team includes cardiologists, cardiovascular surgeons, electrophysiologists,

More information

Metabolic defects underlying dyslipidemia in abdominal obesity

Metabolic defects underlying dyslipidemia in abdominal obesity Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/

More information

Prediabetes 101. What is it and what can I do about it? Intermountainhealthcare.org/diabetes

Prediabetes 101. What is it and what can I do about it? Intermountainhealthcare.org/diabetes Prediabetes 101 What is it and what can I do about it? Patient Education Intermountainhealthcare.org/diabetes What do you already know about prediabetes? Fact or Fiction? There are often no symptoms of

More information

Metabolic Syndrome. Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah

Metabolic Syndrome. Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah Metabolic Syndrome Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah Objectives Be able to outline the pathophysiology of the metabolic syndrome Be able to list diagnostic criteria for

More information

Biochemistry Adult Reference Ranges

Biochemistry Adult Reference Ranges Certified correct on 28/06/2016 Biochemistry Adult Reference Ranges Test Reference range Units Reference range from Traceable to standard reference material Albumin 35 50 g/l Pathology IRMM ERM-DA470k/IFCC

More information

Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?

Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown

More information

Bariatric Surgery vs. Intensive Medical Therapy in Obese Diabetic Patients: 3-Year Outcomes

Bariatric Surgery vs. Intensive Medical Therapy in Obese Diabetic Patients: 3-Year Outcomes Bariatric Surgery vs. Intensive Medical Therapy in Obese Diabetic Patients: 3-Year Outcomes Results of the STAMPEDE Trial Philip R Schauer, Deepak L Bhatt, John P Kirwan, Kathy Wolski, Stacy A Brethauer,

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

1- THE USE OF EARLY-AGE FEED RESTRICTION AND/OR POTASSIUM CHLORIDE FOR ALLEVIATING THE ADVERSE EFFECTS OF HEAT STRESS ON BROILER CHICKS: 1.

1- THE USE OF EARLY-AGE FEED RESTRICTION AND/OR POTASSIUM CHLORIDE FOR ALLEVIATING THE ADVERSE EFFECTS OF HEAT STRESS ON BROILER CHICKS: 1. 1- THE USE OF EARLY-AGE FEED RESTRICTION AND/OR POTASSIUM CHLORIDE FOR ALLEVIATING THE ADVERSE EFFECTS OF HEAT STRESS ON BROILER CHICKS: 1. EFFECTS ON BROILER PERFORMANCE, CARCASS TRAITS AND ECONOMIC EFFICIENCY.

More information

Ragaglitazar Lowers Glucose, Triglycerides In Type 2 Patients. (Investigational Diabetes Drug).: An Article From: Internal Medicine News [HTML]

Ragaglitazar Lowers Glucose, Triglycerides In Type 2 Patients. (Investigational Diabetes Drug).: An Article From: Internal Medicine News [HTML] Ragaglitazar Lowers Glucose, Triglycerides In Type 2 Patients. (Investigational Diabetes Drug).: An Article From: Internal Medicine News [HTML] [Digital] If searching for the book Ragaglitazar lowers glucose,

More information

Overweight and Obesity in Older Persons: Impact Upon Health and Mortality Outcomes

Overweight and Obesity in Older Persons: Impact Upon Health and Mortality Outcomes Overweight and Obesity in Older Persons: Impact Upon Health and Mortality Outcomes Gordon L Jensen, MD, PhD Senior Associate Dean for Research Professor of Medicine and Nutrition Objectives Health outcomes

More information

Reduced 10-year Risk of CHD in Patients who Participated in Communitybased DPP: The DEPLOY Pilot Study

Reduced 10-year Risk of CHD in Patients who Participated in Communitybased DPP: The DEPLOY Pilot Study Diabetes Care Publish Ahead of Print, published online December 23, 2008 Reduced 10-year CHD Risk: DEPLOY Pilot Study Reduced 10-year Risk of CHD in Patients who Participated in Communitybased DPP: The

More information

Evaluation of new MiniCollect Z Serum (Separator) Tubes

Evaluation of new MiniCollect Z Serum (Separator) Tubes Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube

More information

WELL-WOMAN EXAM REVEALS RISK. Katie Jones, MPH, CHES Iowa Department of Public Health Erin Hinderaker, MS, RD, LD Des Moines University

WELL-WOMAN EXAM REVEALS RISK. Katie Jones, MPH, CHES Iowa Department of Public Health Erin Hinderaker, MS, RD, LD Des Moines University WELL-WOMAN EXAM REVEALS RISK Katie Jones, MPH, CHES Iowa Department of Public Health Erin Hinderaker, MS, RD, LD Des Moines University Disclaimer The information provided in this presentation is for informational

More information

NASH Bench to Bedside

NASH Bench to Bedside NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent

More information

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H. U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,

More information

Insulin Sensitivity and Secretion in Youth: From Normal to Diabetes

Insulin Sensitivity and Secretion in Youth: From Normal to Diabetes Insulin Sensitivity and Secretion in Youth: From Normal to Diabetes Silva A. Arslanian MD Richard L. Day Professor of Pediatrics 1 year Jubilee, The Queen Silvia Children s Hospital Gothenburg, Sweden

More information

6/10/2016. Hui-Chun Hsu

6/10/2016. Hui-Chun Hsu Hui-Chun Hsu PhD, RN, CDE Chief, Department of Diabetes Management Lee s Endocrinology Clinic Pingtung, Taiwan Disclosure to Participants Conflict of Interest (COI) and Financial Relationship Disclosures:

More information

Use of Target Values in EQA

Use of Target Values in EQA Use of Target Values in EQA Dr. Anja Kessler Bonn, Germany 1 External Quality Assessment Example: Progesterone 580 participants Measurement principles: Luminescence detection Radioactivity detection Fluorescence

More information

Learning Objectives. Disclosures. Self Assessment Questions. Background

Learning Objectives. Disclosures. Self Assessment Questions. Background Association of Hyperuricemia with Liver Dysfunction amongst Adults with Metabolic Disorders in the United States: A Cross Sectional Study Disclosures Dr. Prashant Sakharkar and Dr. Subrata Deb declare(s)

More information

Effects of Rosiglitazone and Metformin as monotherapy and in combination on high fructose diet induced hyperglycemia and dyslipidaemia in rats

Effects of Rosiglitazone and Metformin as monotherapy and in combination on high fructose diet induced hyperglycemia and dyslipidaemia in rats Original Research Article Effects of Rosiglitazone and Metformin as monotherapy and in combination on high fructose diet induced hyperglycemia and dyslipidaemia in rats Sushil Sharma*, Amol Khanapure 1Department

More information

Case Presentation. Rafael Bitzur The Bert W Strassburger Lipid Center Sheba Medical Center Tel Hashomer

Case Presentation. Rafael Bitzur The Bert W Strassburger Lipid Center Sheba Medical Center Tel Hashomer Case Presentation Rafael Bitzur The Bert W Strassburger Lipid Center Sheba Medical Center Tel Hashomer Case Presentation 50 YO man NSTEMI treated with PCI 1 month ago Medical History: Obesity: BMI 32,

More information

MEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.

MEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently. MEMORANDUM Originating Department Chemical Pathology Issued By: Issued To: Subject: Details: Dr. Shari Srinivasan All Laboratory Service Users Change in Chemical Pathology Analysers Dear Colleague, As

More information