Boosts Following Priming with gp120 DNA

Size: px
Start display at page:

Download "Boosts Following Priming with gp120 DNA"

Transcription

1 Neutralizing Antibody Responses Induced with V3-scaffold Protein Boosts Following Priming with gp120 DNA Susan Zolla-Pazner NYU School of Medicine

2 Problems with Whole Env Immunogens Poor induction of Abs with broad anti-viral functions Sequence and antigenic diversity Conformational masking of critical epitopes Evolution to escape the effects of Abs Inability as a vaccine to induce long-lived lived Ab responses (Ab responses remain detectable <6 months)

3 Advantages of Focusing the Ab Response on Selected Epitopes Abs will be induced only to epitopes that are targeted by known neutralizing Abs, thus increasing the proportion of functional Abs induced. This approach may circumvent the problem of the shortlived Ab response induced by whole Env vaccines. Recombinant, rationally-designed immunogens targeting shared structures could induce broader responses than any single Env. R bi t it ff ld i f b t i l Recombinant epitope-scaffold immunogens of bacterial origin are easier and cheaper to produce than mammalian cell-derived Env monomers and trimers.

4 Conserved Features of V3 that Make It a Target for Cross-clade NAbs V3 loop is invariant in length: 35 amino acids. Only ~1/3 of the residues are highly variable; the other positions permit only conservative changes. There are conserved structures in the V3 crown. V3-specific Abs display both neutralizing and ADCC anti-viral activities.

5 Two-thirds of the 35 Residues in V3 are Conserved Zolla-Pazner and Cardozo, Nat. Rev. Immunol., 2010

6 The V3 Crown Has a Conserved Structure A Hydrophilic face of circlet Band Arch Hydrophobic face of circlet Almond et al.,arhr Jiang et al., Nature Struct. Mol. Biol., 2010

7 Design of Recombinant V3-scaffold Immunogen Example: V3-Cholera Toxin B M. Totrov et al., Virology, 2010.

8 Examples of Rationally Designed and Synthesized V3-CTB Immunogens V3 B -CTB V3 C -CTB V3 H -CTB V CTB V CTB

9 Immunization Protocol Clade C gp120 DNA prime V3-CTB protein boost* P1 P2 P3 B1 B2 6 weeks 6 weeks 4 weeks Pre-bleed *V3-CTBs were used, alone or in double combinations. In all, 14 different boosts were tested. 2 weeks Post-boost

10 Neutralizing Ab Responses TZM.bl assay vs. Tier 1A and Tier 1B pseudoviruses Clade B and C Tier 2 Standard Panels Responders: O 1/5 O2/5 O O O 3/5 4/5 5/ : : : >1:10, Data generated by Michael Seaman

11 50% Neutralizing Ab Responses vs. Tier 1 Viruses Clade C Clade B Clade B Clade B Clade AG Clade C Clade C Clade B Clade B Clade B Clade C MW SF162.LS Bx08.16 BaL.26 T TV SS BZ ZM109F.PB4 CTBwt <10 ND ND ND <10 <10 ND H ND <10 ND <10 B ND <10 ND < ND ND 2219 ND <10 ND <10 C B+2219 <10 <10 H+3074 C+H B+3074 ND ND ND <10 ND C+2219 <10 B+H ND ND ND ND C+3074 Responder: 1/5 2/5 3/5 4/5 5/5 1: : : >1: 10,000

12 50% Neutralizing Ab Responses vs. Tier 2 Viruses Clade C Clade B Clade C Clade C Clade C Clade B Clade B Du WITO ZM135M.PL10a CAP E8 ZM233M.PB6 QH RHPA CTBwt <10 <10 <10 <10 <10 H <10 <10 <10 <10 <10 <10 <10 B <10 <10 <10 <10 <10 < <10 <10 <10 <10 < <10 <10 <10 <10 <10 <10 C <10 <10 <10 <10 <10 B+2219 <10 <10 <10 <10 <10 <10 <10 H+3074 <10 <10 <10 <10 <10 <10 <10 C+H <10 <10 <10 <10 <10 <10 B+3074 < <10 <10 <10 <10 <10 <10 C+2219 <10 <10 <10 <10 B+H <10 <10 <10 C+3074 <10 <10 <10 <10 <10 Responder: 1/5 2/5 3/5 4/5 5/5 1: : : >1: 10,000

13 Induction of Cross-clade Neutralizing Abs to Tier 1B and Tier 2 Viruses Clade B Clade C Clade C Immune sera Pre-bleed pool Clade C Clade AG Clade B Reciprocal titer

14 Neutralizing Abs are Detectable 60 Weeks after the Last Boost ns. Bx08 ralization ation vs eutraliza % Neutr % Ne Post 3 rd Prime Post 1 st Boost Post 2 nd Boost Weeks Weeks

15 Conclusions Neutralizing Abs were induced vs. 9/9 Tier 1A and Tier 1B pseudoviruses assay with GMT 50 values reaching 1:21,000. Neutralizing Abs were induced vs. 6/14 pseudoviruses from the clade B and clade C standard panels with GMT 50 values reaching 1:58. Cross-clade neutralization was achieved against viruses from clades A, AG, B, and C. Neutralizing Abs were detectable >1 year after the last Neutralizing Abs were detectable >1 year after the last boost.

16 Take Home Message A prime/boost vaccine regimen using a DNA prime and rationally-designed V3-scaffold protein boosts: focuses the Ab response on the selected epitope induces cross-clade neutralizing Abs to Tier 1 and Tier 2 viruses elicits neutralizing Abs. A vaccine can focus the Ab response on selected epitopes. This approach can be (is being) applied to other HIV epitopes, including V2.

17

18 Collaborators NYU School of Medicine Mirek Gorny Sandy Sharpe Cohen Connie Williams Xiang-Peng Kong Xunqing Jiang Tim Cardozo David Almond James Swetnam Valicia Burke Xunqing Jiang Higuang Li Jared Sampson Brett Spurrier April Killikelly University of Massachusetts School of Medicine Shan Lu Shixia Wang Molsoft, Inc. Max Totrov Ruben Abagyan Harvard Medical School Michael Seaman NYU Medical Center

19 ACKNOWLEDGMENTS

Recombinant Baculovirus Derived HIV-1 Virus-Like Particles Elicit Potent Neutralizing Antibody Responses

Recombinant Baculovirus Derived HIV-1 Virus-Like Particles Elicit Potent Neutralizing Antibody Responses Recombinant Baculovirus Derived HIV-1 Virus-Like Particles Elicit Potent Neutralizing Antibody Responses Weimin Liu University of Alabama at Birmingham Introduction and Rationale Virus-like particles (VLPs)

More information

Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies

Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies Virus Panels for Assessing Vaccine-Elicited Neutralizing Antibodies Michael Seaman, Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Harvard Medical School J. Virol.

More information

Crystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen

Crystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen Crystal structure of the neutralizing antibody HK20 in complex with its gp41 antigen David Lutje Hulsik Unit for Virus Host Cell Interaction UMI 3265 University Joseph Fourier-EMBL-CNRS, Grenoble Env catalyzed

More information

HIV/AIDS: vaccines and alternate strategies for treatment and prevention

HIV/AIDS: vaccines and alternate strategies for treatment and prevention Ann. N.Y. Acad. Sci. ISSN 0077-8923 ANNALS OF THE NEW YORK ACADEMY OF SCIENCES Online Meeting Report HIV/AIDS: vaccines and alternate strategies for treatment and prevention Yegor Voronin 1 and Sanjay

More information

Novel Heterologous Prime-Boost Vaccine Strategies for HIV. Dan Barouch April 18, 2012

Novel Heterologous Prime-Boost Vaccine Strategies for HIV. Dan Barouch April 18, 2012 Novel Heterologous Prime-Boost Vaccine Strategies for HIV Dan Barouch April 18, 2012 Desired Features of a Next Generation HIV-1 Vaccine Candidate The RV1 study suggests that an HIV-1 vaccine is possible

More information

Tiered Categorization of a Diverse Panel of HIV-1 Env Pseudoviruses for Assessment of Neutralizing Antibodies

Tiered Categorization of a Diverse Panel of HIV-1 Env Pseudoviruses for Assessment of Neutralizing Antibodies JOURNAL OF VIROLOGY, Feb. 2010, p. 1439 1452 Vol. 84, No. 3 0022-538X/10/$12.00 doi:10.1128/jvi.02108-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Tiered Categorization of

More information

HIV Neutralization Assays: p24 PBMC Assays as Compared with the Pseudovirus (TZM-bl) Assay Using Multiple HIV-1 Subtypes

HIV Neutralization Assays: p24 PBMC Assays as Compared with the Pseudovirus (TZM-bl) Assay Using Multiple HIV-1 Subtypes HIV Neutralization Assays: p24 PBMC Assays as Compared with the Pseudovirus (TZM-bl) Assay Using Multiple HIV-1 Subtypes Vicky Polonis The USMHRP: Walter Reed Institute of Research and The Henry M. Jackson

More information

AIDSVaccine2010 Atlanta, Georgia Willy Bogers. NIH HIVRad Grant nr 5P01AI066287

AIDSVaccine2010 Atlanta, Georgia Willy Bogers. NIH HIVRad Grant nr 5P01AI066287 HIV-1 envelope-cd4 receptor complexes elicit broad T- and B- cell immune responses as well as cross-reactive neutralizing antibodies in Rhesus macaques NIH HIVRad Grant nr 5P01AI066287 AIDSVaccine2010

More information

HIV and Challenges of Vaccine Development

HIV and Challenges of Vaccine Development Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health HIV and Challenges of Vaccine Development Richard A. Koup, MD INTEREST

More information

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial

More information

Virology 405 (2010) Contents lists available at ScienceDirect. Virology. journal homepage:

Virology 405 (2010) Contents lists available at ScienceDirect. Virology. journal homepage: Virology 405 (2010) 513 523 Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/yviro Structure-guided design and immunological characterization of immunogens presenting

More information

GOVX-B11: A Clade B HIV Vaccine for the Developed World

GOVX-B11: A Clade B HIV Vaccine for the Developed World GeoVax Labs, Inc. 19 Lake Park Drive Suite 3 Atlanta, GA 3 (678) 384-72 GOVX-B11: A Clade B HIV Vaccine for the Developed World Executive summary: GOVX-B11 is a Clade B HIV vaccine targeted for use in

More information

University of Massachusetts Medical School Michael Vaine University of Massachusetts Medical School

University of Massachusetts Medical School Michael Vaine University of Massachusetts Medical School University of Massachusetts Medical School escholarship@umms GSBS Student Publications Graduate School of Biomedical Sciences 8-23-2008 Improved induction of antibodies against key neutralizing epitopes

More information

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Antibody Responses After Analytic Treatment Interruption in Human Immunodeficiency Virus-1- Infected Individuals on Early Initiated Antiretroviral Therapy The Harvard community has made this article openly

More information

Bispecific Fusion Antibodies. Exhibit 100% Breadth and Picomolar Potency. Craig Pace, PhD

Bispecific Fusion Antibodies. Exhibit 100% Breadth and Picomolar Potency. Craig Pace, PhD The Aaron Diamond AIDS Research Center Affiliate of The Rockefeller University Bispecific Fusion Antibodies PG9 Ibalizumab & VRC Ibalizumab Exhibit % Breadth and Picomolar Potency Craig Pace, PhD AIDS

More information

Supporting Information

Supporting Information Supporting Information Guan et al. 10.1073/pnas.1217609110 Fig. S1. Three patterns of reactivity for CD4-induced (CD4i) mabs. The following representative ELISAs show three patterns of reactivity for CD4i

More information

EMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV. (Summary of the recommendations from an Enterprise Working Group)

EMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV. (Summary of the recommendations from an Enterprise Working Group) AIDS Vaccine 07, Seattle, August 20-23, 2007 EMERGING ISSUES IN THE HUMORAL IMMUNE RESPONSE TO HIV (Summary of the recommendations from an Enterprise Working Group) The Working Group Reston, Virginia,

More information

CD4 T Cell Decline Is Not Associated With Amino Acid Changes in HIV-1 gp120

CD4 T Cell Decline Is Not Associated With Amino Acid Changes in HIV-1 gp120 CD4 T Cell Decline Is Not Associated With Amino Acid Changes in HIV-1 gp120 Colin Wikholm and Isai Lopez BIOL 368: Bioinformatics Laboratory Department of Biology Loyola Marymount University November 15,

More information

HIV Anti-HIV Neutralizing Antibodies

HIV Anti-HIV Neutralizing Antibodies ,**/ The Japanese Society for AIDS Research The Journal of AIDS Research : HIV HIV Anti-HIV Neutralizing Antibodies * Junji SHIBATA and Shuzo MATSUSHITA * Division of Clinical Retrovirology and Infectious

More information

Supplementary information. Early development of broad neutralizing antibodies in HIV-1 infected infants

Supplementary information. Early development of broad neutralizing antibodies in HIV-1 infected infants Supplementary information Early development of broad neutralizing antibodies in HIV-1 infected infants Leslie Goo, Vrasha Chohan, Ruth Nduati, Julie Overbaugh Supplementary Figure 1. Neutralization profile

More information

Global Panel of HIV-1 Env Reference Strains for Standardized Assessments of Vaccine- Elicited Neutralizing Antibodies

Global Panel of HIV-1 Env Reference Strains for Standardized Assessments of Vaccine- Elicited Neutralizing Antibodies JVI Accepts, published online ahead of print on 18 December 2013 J. Virol. doi:10.1128/jvi.02853-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Global Panel of HIV-1 Env

More information

Molecular Evolution of Broadly Neutralizing Llama Antibodies to the CD4-Binding Site of HIV-1

Molecular Evolution of Broadly Neutralizing Llama Antibodies to the CD4-Binding Site of HIV-1 Molecular Evolution of Broadly Neutralizing Llama Antibodies to the CD4-Binding Site of HIV-1 The Harvard community has made this article openly available. Please share how this access benefits you. Your

More information

Min Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention. June 18, 2015 NIBSC

Min Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention. June 18, 2015 NIBSC Workshop on Immunoassay Standardization for Universal Flu Vaccines Min Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention June 18, 2015 NIBSC 1 Multiple Immune Mechanisms Contribute

More information

A Path to an HIV Vaccine: GSID Consortium Activities. Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009

A Path to an HIV Vaccine: GSID Consortium Activities. Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009 A Path to an HIV Vaccine: GSID Consortium Activities Faruk Sinangil, PhD 4th Annual CAVD Meeting Miami, FL December 1-4, 2009 Project Goals Acquire and disseminate information that will contribute to the

More information

HVTN P5 Vaccine Trials

HVTN P5 Vaccine Trials HVTN P5 Vaccine Trials Erica Andersen-Nissen, PhD Director, Cape Town HVTN Immunology Laboratory Considerations for a Pan-African HIV Vaccine Development Agenda Kigali, Rwanda 16-17 March 2015 HVTN Mission

More information

Identification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist

Identification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist Identification of Mutation(s) in the HIV 1 gp41 Subunit Associated with Neutralization Resistance Miah Blomquist What is HIV 1? HIV-1 is an epidemic that affects over 34 million people worldwide. HIV-1

More information

Hemagglutinin-stalk specific antibodies: How to induce them and how to measure them

Hemagglutinin-stalk specific antibodies: How to induce them and how to measure them Immunodominant head domain Stalk domain Hemagglutinin-stalk specific antibodies: How to induce them and how to measure them Florian Krammer Icahn School of Medicine at Mount Sinai May 5 th 2014 2 nd WHO

More information

ALVAC -HIV and AIDSVAX B/E Prime-Boost HIV-1 Preventive Vaccine Regimen. Results of the Thai HIV Vaccine Trial, RV144

ALVAC -HIV and AIDSVAX B/E Prime-Boost HIV-1 Preventive Vaccine Regimen. Results of the Thai HIV Vaccine Trial, RV144 ALVAC -HIV and AIDSVAX B/E Prime-Boost HIV-1 Preventive Vaccine Regimen Results of the Thai HIV Vaccine Trial, RV144 SupachaiRerks-Ngarm, PunneePittisutthithum, SorachaiNitayaphan, JaranitKaewkungwal,

More information

Novel Vaccine Products for Planned Phase I Immunogenicity Studies in Infants

Novel Vaccine Products for Planned Phase I Immunogenicity Studies in Infants Office of AIDS Research Novel Vaccine Products for Planned Phase I Immunogenicity Studies in Infants L. Jean Patterson, PhD Office of AIDS Research, NIH February 7, 2017 Office of AIDS Research OAR Responsibilities

More information

Immunotypes of a Quaternary Site of HIV-1 Vulnerability and Their Recognition by Antibodies

Immunotypes of a Quaternary Site of HIV-1 Vulnerability and Their Recognition by Antibodies JOURNAL OF VIROLOGY, May 2011, p. 4578 4585 Vol. 85, No. 9 0022-538X/11/$12.00 doi:10.1128/jvi.02585-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Immunotypes of a Quaternary

More information

Challenges in Designing HIV Env Immunogens for Developing a Vaccine

Challenges in Designing HIV Env Immunogens for Developing a Vaccine b514_chapter-13.qxd 12/4/2007 3:39 PM Page 327 Chapter 13 Challenges in Designing HIV Env Immunogens for Developing a Vaccine Indresh K. Srivastava* and R. Holland Cheng Summary HIV continues to be a major

More information

NIH Public Access Author Manuscript Nat Med. Author manuscript; available in PMC 2010 September 1.

NIH Public Access Author Manuscript Nat Med. Author manuscript; available in PMC 2010 September 1. NIH Public Access Author Manuscript Published in final edited form as: Nat Med. 2010 March ; 16(3): 319 323. doi:10.1038/nm.2089. Mosaic HIV-1 Vaccines Expand the Breadth and Depth of Cellular Immune Responses

More information

Broad and Potent Neutralizing Antibodies from an African Donor Reveal a New HIV-1 Vaccine Target

Broad and Potent Neutralizing Antibodies from an African Donor Reveal a New HIV-1 Vaccine Target Broad and Potent Neutralizing Antibodies from an African Donor Reveal a New HIV-1 Vaccine Target Laura M. Walker, 1 * Sanjay K. Phogat, 2 * Po-Ying Chan-Hui, 3 Denise Wagner, 2 Pham Phung, 4 Julie L. Goss,

More information

Characterization of Envelope-Specific Antibody Response Elicited by HIV-1 Vaccines: A Dissertation

Characterization of Envelope-Specific Antibody Response Elicited by HIV-1 Vaccines: A Dissertation University of Massachusetts Medical School escholarship@umms GSBS Dissertations and Theses Graduate School of Biomedical Sciences 1-6-2015 Characterization of Envelope-Specific Antibody Response Elicited

More information

Structural Insights into HIV-1 Neutralization by Broadly Neutralizing Antibodies PG9 and PG16

Structural Insights into HIV-1 Neutralization by Broadly Neutralizing Antibodies PG9 and PG16 Structural Insights into HIV-1 Neutralization by Broadly Neutralizing Antibodies PG9 and PG16 Robert Pejchal, Laura M. Walker, Robyn L. Stanfield, Wayne C. Koff, Sanjay K. Phogat, Pascal Poignard, Dennis

More information

Immunogenicity of ALVAC HIV (vcp1521) and AIDSVAX B/E Prime Boost Vaccination in RV144, Thai Phase III HIV Vaccine Trial

Immunogenicity of ALVAC HIV (vcp1521) and AIDSVAX B/E Prime Boost Vaccination in RV144, Thai Phase III HIV Vaccine Trial Immunogenicity of ALVAC HIV (vcp1521) and AIDSVAX B/E Prime Boost Vaccination in RV144, Thai Phase III HIV Vaccine Trial M. de Souza, R. Trichavaroj, A. Schuetz, W. Chuenarom, Y. Phuang ngern, S. Jongrakthaitae,

More information

HEPATITIS B: are escape mutants of concern?

HEPATITIS B: are escape mutants of concern? VACCINATION: AN EVOLUTIONARY ENGINE FOR SPECIES? Fondation Mérieux Conference Centre Veyrier-du-Lac, France November 25-27, 2013 HEPATITIS B: are escape mutants of concern? Alessandro ZANETTI Department

More information

Increasing Neutralisation resistance in HIV-1 Clade C over the course of the southern African Epidemic. Cecilia Rademeyer 26 October 2014

Increasing Neutralisation resistance in HIV-1 Clade C over the course of the southern African Epidemic. Cecilia Rademeyer 26 October 2014 Increasing Neutralisation resistance in HIV-1 Clade C over the course of the southern African Epidemic. Cecilia Rademeyer 26 October 2014 HIV-1 Transmission and Antigenic Drift Individual Selection Transmission

More information

University of Massachusetts Medical School Matthew R. Costa University of Massachusetts Medical School

University of Massachusetts Medical School Matthew R. Costa University of Massachusetts Medical School University of Massachusetts Medical School escholarship@umms GSBS Dissertations and Theses Graduate School of Biomedical Sciences 10-12-2016 FC Receptor-Mediated Activities of Env-Specific Monoclonal Antibodies

More information

Are we targeting the right HIV determinants?

Are we targeting the right HIV determinants? QuickTime et un décompresseur TIFF (non compressé) sont requis pour visionner cette image. AIDS Vaccine 2009 October 22 nd 2009 - Paris Are we targeting the right HIV determinants? Françoise BARRÉ-SINOUSSI

More information

NASDAQ:NVAX Novavax, Inc. All rights reserved.

NASDAQ:NVAX Novavax, Inc. All rights reserved. Novavax vaccine induced improved immune responses against homologous and drifted A(H3N2) viruses in older adults compared to egg-based, high-dose, influenza vaccine World Vaccine Congress April 4, 2018

More information

Magnitude and Breadth of a Nonprotective Neutralizing Antibody Response in an Efficacy Trial of a Candidate HIV-1 gp120 Vaccine

Magnitude and Breadth of a Nonprotective Neutralizing Antibody Response in an Efficacy Trial of a Candidate HIV-1 gp120 Vaccine MAJOR ARTICLE Magnitude and Breadth of a Nonprotective Neutralizing Antibody Response in an Efficacy Trial of a Candidate HIV-1 gp120 Vaccine Peter Gilbert, 1 Maggie Wang, 1 Terri Wrin, 2 Chris Petropoulos,

More information

DNA Immunization for HIV Vaccine Development

DNA Immunization for HIV Vaccine Development University of Massachusetts Medical School escholarship@umms GSBS Student Publications Graduate School of Biomedical Sciences 2-25-2014 DNA Immunization for HIV Vaccine Development Yuxin Chen University

More information

HIV-specific humoral responses benefit from stronger prime in phase Ib clinical trial

HIV-specific humoral responses benefit from stronger prime in phase Ib clinical trial The Journal of Clinical Investigation Clinical Medicine HIV-specific humoral responses benefit from stronger prime in phase Ib clinical trial Pierre-Alexandre Bart, 1,2,11 Yunda Huang, 3,11 Shelly T. Karuna,

More information

Press conference abstracts Vaccine and Antibody Research Monday, 22 October 2018

Press conference abstracts Vaccine and Antibody Research Monday, 22 October 2018 Press conference abstracts Vaccine and Antibody Research Monday, 22 October 2018 OA02.05LB Vaccine-induced Gene Signature Correlates with Protection against Acquisition in Three Independent Vaccine Efficacy

More information

Glycosylation of the ENV Spike of Primate Immunodeficiency Viruses and Antibody Neutralization

Glycosylation of the ENV Spike of Primate Immunodeficiency Viruses and Antibody Neutralization Current HIV Research, 2004, 2, 243-254 243 Glycosylation of the ENV Spike of Primate Immunodeficiency Viruses and Antibody Neutralization Cheryl A. Pikora *1,2 1 Department of Infectious Diseases, Children

More information

HIV: RV 144 prime boost HIV vaccine efficacy study

HIV: RV 144 prime boost HIV vaccine efficacy study HIV: RV 144 prime boost HIV vaccine efficacy study Nelson L. Michael, M.D., Ph.D Colonel, Medical Corps, U.S. Army Director US Military HIV Research Program (MHRP) Walter Reed Army Institute of Research

More information

Supplementary appendix

Supplementary appendix Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Barouch DH, Tomaka FL Wegmann F, et al. Evaluation

More information

Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a Case Study

Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a Case Study Note: I have added some clarifying comments to the slides -- please click on Comments under View to see them. Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a

More information

Antigenic and Immunogenic Study of Membrane-Proximal External Region-Grafted gp120 Antigens by a DNA Prime-Protein Boost Immunization Strategy

Antigenic and Immunogenic Study of Membrane-Proximal External Region-Grafted gp120 Antigens by a DNA Prime-Protein Boost Immunization Strategy JOURNAL OF VIROLOGY, Apr. 2007, p. 4272 4285 Vol. 81, No. 8 0022-538X/07/$08.00 0 doi:10.1128/jvi.02536-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Antigenic and Immunogenic

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 27 with the sole aim of making

More information

4/14/2016. HIV Vaccines and Immunoprotection: Where Are We? Learning Objectives. After attending this presentation, participants will be able to:

4/14/2016. HIV Vaccines and Immunoprotection: Where Are We? Learning Objectives. After attending this presentation, participants will be able to: HIV Vaccines and Immunoprotection: Where Are We? Mark J. Mulligan, MD, FIDSA Distinguished Professor of Medicine Emory University School of Medicine Atlanta, Georgia FINAL: 04/01/16 Atlanta, Georgia: Friday,

More information

Identification of broadly neutralizing antibody epitopes in the HIV-1 envelope glycoprotein using evolutionary models

Identification of broadly neutralizing antibody epitopes in the HIV-1 envelope glycoprotein using evolutionary models Lacerda et al. Virology Journal 2013, 10:347 RESEARCH Open Access Identification of broadly neutralizing antibody epitopes in the HIV-1 envelope glycoprotein using evolutionary models Miguel Lacerda 1,2,

More information

Nonsynonymous Amino Acid Mutations in gp120 Binding Sites are Related to Progression of HIV-1

Nonsynonymous Amino Acid Mutations in gp120 Binding Sites are Related to Progression of HIV-1 Nonsynonymous Amino Acid Mutations in gp120 Binding Sites are Related to Progression of HIV-1 Matthew Allegretti and Anindita Varshneya BIOL 368: Bioinformatics Laboratory Loyola Marymount University November

More information

Zheng, BJ; Du, LY; Zhao, GY; Lin, YP; Sui, HY; Chan, C; Ma, S; Guan, Y; Yuen, KY. Citation Hong Kong Medical Journal, 2008, v. 14 suppl. 4, p.

Zheng, BJ; Du, LY; Zhao, GY; Lin, YP; Sui, HY; Chan, C; Ma, S; Guan, Y; Yuen, KY. Citation Hong Kong Medical Journal, 2008, v. 14 suppl. 4, p. Title Studies of SARS virus vaccines Author(s) Zheng, BJ; Du, LY; Zhao, GY; Lin, YP; Sui, HY; Chan, C; Ma, S; Guan, Y; Yuen, KY Citation Hong Kong Medical Journal, 2008, v. 14 suppl. 4, p. 39-43 Issued

More information

Progress on new vaccine strategies against chronic viral infections

Progress on new vaccine strategies against chronic viral infections Progress on new vaccine strategies against chronic viral infections Jay A. Berzofsky,, Masaki Terabe, Igor M. Belyakov J Clin Invest. 2004;114(4):450-462. https://doi.org/10.1172/jci22674. Review Among

More information

TITLE: Influenza A (H7N9) virus evolution: Which genetic mutations are antigenically important?

TITLE: Influenza A (H7N9) virus evolution: Which genetic mutations are antigenically important? TITLE: Influenza A (H7N9) virus evolution: Which genetic mutations are antigenically important? AUTHORS: Joshua G. Petrie 1, Adam S. Lauring 2,3 AFFILIATIONS: 1 Department of Epidemiology, University of

More information

Trial Collaborators Start Date* Sites Stage HVTN BMGF IPPOX EuroVacc GSID. HVTN DAIDS GSK Sanofi Jun 2017

Trial Collaborators Start Date* Sites Stage HVTN BMGF IPPOX EuroVacc GSID. HVTN DAIDS GSK Sanofi Jun 2017 Ongoing s:, In, Health/AESI Contact(s) 096/EV04 106 107 108 110 A phase 1 double blind placebo-controlled clinical trial to evaluate the safety and to compare the priming ability of NYVAC alone versus

More information

2005 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.

2005 LANDES BIOSCIENCE. DO NOT DISTRIBUTE. [Human Vaccines 1:2, 45-60; March/April 2005]; 2005 Landes Bioscience Review Role of Neutralizing Antibodies in Protective Immunity Against HIV Indresh K. Srivastava* Jeffrey B. Ulmer Susan W. Barnett

More information

Regional Clustering of Shared Neutralization Determinants on Primary Isolates of Clade C Human Immunodeficiency Virus Type 1 from South Africa

Regional Clustering of Shared Neutralization Determinants on Primary Isolates of Clade C Human Immunodeficiency Virus Type 1 from South Africa JOURNAL OF VIROLOGY, Mar. 2002, p. 2233 2244 Vol. 76, No. 5 0022-538X/02/$04.00 0 DOI: 10.1128/JVI.76.5.2233 2244.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Regional Clustering

More information

Clinical Trials of Pandemic Vaccines: Key Issues. John Treanor University of Rochester Rochester, NY

Clinical Trials of Pandemic Vaccines: Key Issues. John Treanor University of Rochester Rochester, NY Clinical Trials of Pandemic Vaccines: Key Issues John Treanor University of Rochester Rochester, NY Inactivated vaccine approach Proven technology Used successfully in 1957 and 1968 Abundant efficacy data

More information

HIV cure: current status and implications for the future

HIV cure: current status and implications for the future HIV cure: current status and implications for the future Carolyn Williamson, PhD Head of Medical Virology, Faculty Health Sciences, University of Cape Town CAPRISA Research Associate, Centre of Excellence

More information

Dissecting the Neutralizing Antibody Specificities of Broadly Neutralizing Sera from Human Immunodeficiency Virus Type 1-Infected Donors

Dissecting the Neutralizing Antibody Specificities of Broadly Neutralizing Sera from Human Immunodeficiency Virus Type 1-Infected Donors JOURNAL OF VIROLOGY, June 2007, p. 6548 6562 Vol. 81, No. 12 0022-538X/07/$08.00 0 doi:10.1128/jvi.02749-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Dissecting the Neutralizing

More information

An AIDS vaccine: Why is it so difficult?

An AIDS vaccine: Why is it so difficult? An AIDS vaccine: Why is it so difficult? Jaap Goudsmit, MD, PhD Professor of Poverty-related Communicable Diseases, AMC Chairman of the Board CPCD CSO, Crucell Holland BV An AIDS vaccine: Why is it so

More information

P G K R P E W M G W L K P R G G A V N Y A R P L Q G R V T M T R D V Y S D T A F

P G K R P E W M G W L K P R G G A V N Y A R P L Q G R V T M T R D V Y S D T A F Supplementary Figure 1 VRC01 45-08-110497H 45-08-212510H 45-08-511533H 45-08-541880H Q V Q L V Q S G G Q M K K P G E S M R I S C R A S G Y E F I D C T L N W I R L A CAGGTGCAGCTGGTGCAGTCTGGGGGTCAGATGAAGAAGCCTGGCGAGTCGATGAGAATTTCTTGTCGGGCTTCTGGATATGAATTTATTGATTGTACGCTAAATTGGATTCGTCTGGCC

More information

Re-engineering HA as a strategy to develop universal influenza vaccines

Re-engineering HA as a strategy to develop universal influenza vaccines WHO Integrated Meeting on Development & Clinical Trials of Influenza Vaccines Re-engineering HA as a strategy to develop universal influenza vaccines Harry Kleanthous, Ph.D. Discovery Research January

More information

Canadian Immunization Conference 2018 Dec 4

Canadian Immunization Conference 2018 Dec 4 Enveloped Virus-Like Particle (evlp) Cytomegalovirus (CMV) Vaccine is immunogenic and safe: preliminary results of a First-in-Humans Canadian Immunization Network (CIRN) Clinical Trials Network (CTN) -

More information

HIV Vaccines: Basic Science

HIV Vaccines: Basic Science Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health HIV Vaccines: Basic Science Richard A. Koup, MD 6 th INTEREST Workshop

More information

UNIVERSAL INFLUENZA VIRUS VACCINES Adolfo García Sastre. Icahn School of Medicine at Mount Sinai, New York

UNIVERSAL INFLUENZA VIRUS VACCINES Adolfo García Sastre. Icahn School of Medicine at Mount Sinai, New York UNIVERSAL INFLUENZA VIRUS VACCINES Adolfo García Sastre Icahn School of Medicine at Mount Sinai, New York INFLUENZA VIRUSES PAx B EPIDEMIOLOGY OF HUMAN INFLUENZA VIRUSES A H1N1 H3N2 1968 H2N2 1957 H1N1

More information

Development of a Universal T Cell Vaccine. Tomáš Hanke Weatherall Institute of Molecular Medicine University of Oxford United Kingdom

Development of a Universal T Cell Vaccine. Tomáš Hanke Weatherall Institute of Molecular Medicine University of Oxford United Kingdom Development of a Universal T Cell Vaccine Tomáš Hanke Weatherall Institute of Molecular Medicine University of Oxford United Kingdom Development of HIV-1 vaccines Induction of cell-mediated responses Immunogens

More information

Increased Functional Stability and Homogeneity of Viral Envelope Spikes through Directed Evolution

Increased Functional Stability and Homogeneity of Viral Envelope Spikes through Directed Evolution Increased Functional Stability and Homogeneity of Viral Envelope Spikes through Directed Evolution Daniel P. Leaman, Michael B. Zwick* Department of Immunology and Microbial Science, The Scripps Research

More information

How Vaccines Work. Jerry Sadoff MD Crucell Vaccine Institute

How Vaccines Work. Jerry Sadoff MD Crucell Vaccine Institute How Vaccines Work Jerry Sadoff MD Crucell Vaccine Institute Questions you will be able to answer at the end of this session How do Vaccines Work? How do we develop vaccines? How do we manufacture vaccines?

More information

Downloaded by on April 28, 2018 https://pubs.acs.org Publication Date: April 24, 1984 doi: /bk

Downloaded by on April 28, 2018 https://pubs.acs.org Publication Date: April 24, 1984 doi: /bk 1 Virus-Receptor Interactions BERNARD N. FIELDS Department of Microbiology and Molecular Genetics, Harvard Medical School, and Department of Medicine (Infectious Disease), Brigham and Women's Hospital,

More information

24 26 January 2013, Hong Kong SAR, CHINA. TITLE from VIEW and SLIDE MASTER February 27, 2013

24 26 January 2013, Hong Kong SAR, CHINA. TITLE from VIEW and SLIDE MASTER February 27, 2013 The first WHO integrated meeting on development and clinical trials of influenza vaccines that induce broadly protective and long-lasting immune responses 24 26 January 2013, Hong Kong SAR, CHINA 1 TITLE

More information

on April 26, 2018 by guest

on April 26, 2018 by guest JVI Accepted Manuscript Posted Online 20 July 2016 J. Virol. doi:10.1128/jvi.00853-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 Induction of heterologous

More information

DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED

DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED Viv Peut Kent Laboratory, University of Melbourne, Australia WHY ENVELOPE? Env subject to both humoral and cellular immune responses Perhaps

More information

Combinatorial Vaccines for AIDS and other Infectious Diseases

Combinatorial Vaccines for AIDS and other Infectious Diseases Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Department of Health and Human Services Combinatorial Vaccines for AIDS

More information

YUMI YAMAGUCHI-KABATA AND TAKASHI GOJOBORI* Center for Information Biology, National Institute of Genetics, Mishima , Japan

YUMI YAMAGUCHI-KABATA AND TAKASHI GOJOBORI* Center for Information Biology, National Institute of Genetics, Mishima , Japan JOURNAL OF VIROLOGY, May 2000, p. 4335 4350 Vol. 74, No. 9 0022-538X/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Reevaluation of Amino Acid Variability of the Human

More information

HIV-1 glycan density drives the persistence of the mannose patch within an infected. Running title: Longitudinal persistence of the HIV mannose patch

HIV-1 glycan density drives the persistence of the mannose patch within an infected. Running title: Longitudinal persistence of the HIV mannose patch JVI Accepted Manuscript Posted Online 5 October 2016 J. Virol. doi:10.1128/jvi.01542-16 Copyright 2016 Coss et al. This is an open-access article distributed under the terms of the Creative Commons Attribution

More information

Research Online. Edith Cowan University. Constantinos K. Wibmer. Jinal N. Bhiman. Elin S. Gray Edith Cowan University,

Research Online. Edith Cowan University. Constantinos K. Wibmer. Jinal N. Bhiman. Elin S. Gray Edith Cowan University, Edith Cowan University Research Online ECU Publications 2013 2013 Viral Escape From HIV-1 Neutralizing Antibodies Drives Increased Plasma Neutralization Breadth through Sequential Recognition Of Multiple

More information

Broadly protective influenza vaccines for pandemic preparedness. Suresh Mittal Department of Comparative Pathobiology Purdue University

Broadly protective influenza vaccines for pandemic preparedness. Suresh Mittal Department of Comparative Pathobiology Purdue University Broadly protective influenza vaccines for pandemic preparedness Suresh Mittal Department of Comparative Pathobiology Purdue University Influenza A Virus Orthomyxovirus Consist of s/s (-) sense RNA 8 segments

More information

NK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections

NK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections NK mediated Antibody Dependent Cellular Cytotoxicity in HIV infections Amy Chung Dr. Ivan Stratov Prof. Stephen Kent ADCC process consists of Target cell QuickTime and a TIFF (Uncompressed) FcγR decompressor

More information

From Antibody to Vaccine a Tale of Structural Biology and Epitope Scaffolds

From Antibody to Vaccine a Tale of Structural Biology and Epitope Scaffolds Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Department of Health and Human Services From Antibody to Vaccine a Tale

More information

Spike Trimer RNA. dsdna

Spike Trimer RNA. dsdna Spike Trimer RNA dsdna Spike Trimer RNA Spike trimer subunits xxx gp120: receptor and coreceptor binding xxxxxxx gp41: membrane anchoring and target cell fusion dsdna Spike Trimer HIV gp120 binds to host

More information

Innate and Cellular Immunology Control of Infection by Cell-mediated Immunity

Innate and Cellular Immunology Control of Infection by Cell-mediated Immunity Innate & adaptive Immunity Innate and Cellular Immunology Control of Infection by Cell-mediated Immunity Helen Horton PhD Seattle Biomedical Research Institute Depts of Global Health & Medicine, UW Cellular

More information

Prevention of infection 2 : immunisation. How infection influences the host : viruses. Peter

Prevention of infection 2 : immunisation. How infection influences the host : viruses. Peter Prevention of infection 2 : immunisation How infection influences the host : viruses Peter Balfe, p.balfe@bham.ac.uk @pbalfeuk Let s have some LO s just for fun 1. Define the Immune response to viruses,

More information

A global approach to HIV-1 vaccine development

A global approach to HIV-1 vaccine development A global approach to HIV-1 vaccine development The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published Version Accessed

More information

Gene Vaccine Dr. Sina Soleimani

Gene Vaccine Dr. Sina Soleimani Gene Vaccine Dr. Sina Soleimani Human Viral Vaccines Quality Control Laboratory (HVVQC) Titles 1. A short Introduction of Vaccine History 2. First Lineage of Vaccines 3. Second Lineage of Vaccines 3. New

More information

Professor Andrew McMichael

Professor Andrew McMichael BHIVA AUTUMN CONFERENCE 2011 Including CHIVA Parallel Sessions Professor Andrew McMichael University of Oxford 17 18 November 2011, Queen Elizabeth II Conference Centre, London BHIVA AUTUMN CONFERENCE

More information

Supplementary Information for. Heavy chain-only IgG2b-llama antibody effects near-pan HIV-1 neutralization by

Supplementary Information for. Heavy chain-only IgG2b-llama antibody effects near-pan HIV-1 neutralization by Supplementary Information for Heavy chain-only IgG2b-llama antibody effects near-pan HIV-1 neutralization by recognizing a CD4-induced epitope that includes elements of co-receptor- and CD4-binding sites

More information

Should There be Further Efficacy Testing of T-T cell Based Vaccines that do not Induce Broadly Neutralizing Antibodies?

Should There be Further Efficacy Testing of T-T cell Based Vaccines that do not Induce Broadly Neutralizing Antibodies? Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Department of Health and Human Services Should There be Further Efficacy

More information

Antibody Dependent Cellular Cytotxic activity: Past and Future. Guido Ferrari, M.D. Duke University Medical Center

Antibody Dependent Cellular Cytotxic activity: Past and Future. Guido Ferrari, M.D. Duke University Medical Center Antibody Dependent Cellular Cytotxic activity: Past and Future Guido Ferrari, M.D. Duke University Medical Center Mechanism of Antibody Dependent Cellular Cytotoxicity (ADCC) ADCC Effector Cells (NK, monocytes/macrophages,

More information

Emerging Viruses. Part IIb Follow Up from Part I Vaccines and Inhibitors

Emerging Viruses. Part IIb Follow Up from Part I Vaccines and Inhibitors Emerging Viruses Part IIb Follow Up from Part I Vaccines and Inhibitors Cellular Responses to Viral Invasion: Restriction Factors Cells fight viral infection using a series of restriction factors Restriction

More information

Lynn Morris. "Plan B"- bnabs for HIV prevention

Lynn Morris. Plan B- bnabs for HIV prevention "Plan B"- bnabs for HIV prevention Lynn Morris National Institute for Communicable Diseases, a division of the National Health Laboratory Service (NHLS) of South Africa, University of the Witwatersrand,

More information

SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS:

SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS: SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS: POSSIBILITIES OF SEROLOGICAL DIAGNOSIS TYPES OF SEROLOGICAL REACTIONS SEROLOGICAL REACTIONS Ag-Ab reactions used for the detection of unknown Ag or Ab, in vitro

More information

FMD Vaccine Strain Selection

FMD Vaccine Strain Selection FMD Vaccine Strain Selection David Paton, Pirbright, UK New Delhi, 13-15 February 2012 Conclusions Vaccine match is one component of vaccine efficacy Vaccine quality may compensate for imperfect match

More information

Carbohydrate-based strategies of antiviral therapeutics

Carbohydrate-based strategies of antiviral therapeutics Carbohydrate-based strategies of antiviral therapeutics Prof. Jan Balzarini Rega Institute for Medical Research B-3000 Leuven, Belgium VII Jornadas de la Sociedad Espanola de Química Terapéutica, Sitges,

More information

HIV Vaccine Clinical Trials at CIDRZ

HIV Vaccine Clinical Trials at CIDRZ HIV Vaccine Clinical Trials at CIDRZ Developing a Safe and Effective Vaccine for Prevention of HIV Infections Globally Christine Namakobo Senior Research Nurse Matero Clinical Research Site State of Global

More information