MiR-196a Regulates High Glucose-Induced Mesangial Cell Hypertrophy by Targeting p27 kip1

Transcription

1 569055JLAXXX / Journal of Laboratory AutomationWang et al. research-article2015 Original Report MiR-196a Regulates High Glucose-Induced Mesangial Cell Hypertrophy by Targeting p27 kip1 Journal of Laboratory Automation 2015, Vol. 20(4) Society for Laboratory Automation and Screening DOI: / jala.sagepub.com Xiaoxia Wang 1*, E. Shen 2*, Yanzhe Wang 3, Zhenzhen Jiang 3, Dingkun Gui 3, Dongsheng Cheng 3, Tingfang Chen 3, and Niansong Wang 3 Abstract Glomerular mesangial cell (MC) hypertrophy is regarded as one of the earliest pathological characteristics of diabetic nephropathy (DN), which plays a critical role in the pathogenesis of glomerulosclerosis. This study investigated the role of micrornas (mirnas) in MC hypertrophy due to exposure to high glucose. With a microarray, we screened the differential profiles of mirnas in the renal cortex of DN mice, as verified by reverse transcription PCR with subsequent analysis of bioinformatics. We found mir-196a was downregulated remarkably in DN mice and increased the hypertrophyrelated gene of p27 kip1 in high-enrichment gene ontologies. Furthermore, transfection of the mir-196a mimic greatly inhibited the expression of p27 kip1 with recovery of MC hypertrophic morphology. With flow cytometry, we also found that overexpression of mir-196a significantly reduced the percentage of G 1 phase arrest in the cell cycle. Cotransfection of the mir-196a mimic with a wild type of 3 UTR of the p27 kip1 vector reduced the activity of the luciferase reporter significantly in contrast to the mir-196a mimic with a mutant of the counterpart in HEK293 cell lines, suggesting that mir- 196a directly targets p27 kip1. Finally, knockdown of p27 kip1 with specific small interfering RNA in MCs substantially reversed MC hypertrophy induced by transfection of the mir-196a inhibitor. This study revealed that mir-196a acts as an important molecular regulator in high glucose-induced MC hypertrophy by targeting p27 kip1. Keywords mir-196a, diabetic nephropathy, mesangial cells, hypertrophy, p27 kip1 Introduction Glomerular hypertrophy has been defined as an increase in glomerular size, which is mainly induced by glomerular mesangial cell (MC) hypertrophy and subsequent overexpression and accumulation of extracellular matrix (ECM) proteins. 1 Diabetic nephropathy (DN), which is characterized by sustained albuminuria clinically and excessive deposition of ECM proteins in glomeruli pathologically, is a leading cause of renal failure worldwide. There are three types of constitutive cells endothelial cells, podocytes, and mesangial cells (MCs) among which MCs are regarded as the main source of ECM proteins. MC hypertrophy, a key event occurring at a very early stage of DN, acquires the ability to synthesize ECM proteins responsible for glomerulosclerosis. In vivo studies in both type I and II animal models of DN indicated that glomerular mesangial expansion was induced by ECM accumulation secondary to hyperglycemia-induced MC hypertrophy. 1 A report by Steffes et al. 2 suggested that mesangial expansion plays a central role in the loss of renal function in DN patients clinically. As we know, cell growth is regulated by a variety of proteins, including cyclin-dependent kinase (CDK) and CDK inhibitor in the cell cycle. In the presence of high glucose, MCs arrested in the G 1 phase show a hypertrophic phenotype. p27 kip1, a CDK inhibitor, is regarded as a critical regulator of MC hypertrophy. However, an MC hypertrophy-related mechanism still remains elusive due to its complexity Department of Nephrology, Tong Ren Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, P. R. China 2 Department of Ultrasound in Medicine, Tong Ren Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, P. R. China 3 Department of Nephrology, Shanghai Jiao Tong University Affiliated Sixth People s Hospital, Shanghai, P. R. China *These authors contributed equally to this article. Received November 10, Corresponding Author: Niansong Wang, MD, PhD, Department of Nephrology, Shanghai Jiao Tong University Affiliated Sixth People s Hospital, 600 Yishan Road, Shanghai , P. R. China. wangniansong2014@163.com

2 492 Journal of Laboratory Automation 20(4) MicroRNAs (mirnas) have been identified as negative regulatory elements of their target genes at the posttranscriptional level, which are expressed in a variety of cells or tissues. 8 mirnas show a highly conservative property across mammalian species. Recently, data in the literature strongly proved that the aberration and/or the absence of mirnas play a role in the pathophysiological process of human diseases, such as tumors, diabetic myocardial disease, and so on. Investigations of conditional Dicer knockout mice indicated that mirnas serve as important molecular regulators for the maintenance of normal structure and function in the kidney Emerging evidence has shown that the differential expression of mirnas is involved in the onset and progression of DN, among which mir-377, mir- 21, mir-192, and mir-29 play an important role in DN by promoting expression of collagen and fibronectin in diabetic glomeruli Given the roles of mirnas in DN, in this study, we detected mirna expression levels of renal tissue in DN mouse models. We anticipate finding the clue for mirnas to regulate MC hypertrophy during DN and uncovering the underlying mechanism. Materials and Methods Streptozotocin-Induced Diabetic Animal Models in DBA/2 Mice DBA/2 mice (male, 8 weeks of age, n = 20) were purchased from Shanghai SLAC Laboratory Animal Co. Ltd. (Shanghai, P. R. China; license no. SCXK Hu ). Throughout the whole period of the experiment, mice were given free access to water and standard rodent chow. Type I diabetes was induced in mice (n = 10) with intraperitoneal injections of streptozotocin (STZ; Sigma, St. Louis, MO). According to the protocol established by Gurley et al., 17 STZ was dissolved in 0.05 M sodium citrate buffer (ph 4.5) immediately before injection, and mice were administered two rounds of injections of 50 mg/kg 1 /d STZ for 5 consecutive days first at age 10 weeks and then at age 15 weeks. This pattern of administration of STZ could induce stable hyperglycemia and longitudinal survival. Random plasma glucose >16.7 mm was regarded as indicating the establishment of a diabetic condition. The same amount of sodium citrate buffer was injected in control animals. At the end of experiment (12 weeks after the onset of the diabetic condition), mice were placed in metabolic cages with free access to water and chow individually for 24 h for collection of urine samples to determine urine protein according to the manufacturer s instructions (Mouse Albumin ELISA Quantitation Set; Bethyl Laboratories, Montgomery, TX). Then the mice were sacrificed; the left kidneys were decapsulated, and the the total RNA of renal cortex was subjected to perform the mirna microarray. The right kidneys were fixed in formalin for periodic acid Schiff (PAS) staining. This procedure was approved by the animal control committee of Shanghai Jiao Tong University Affiliated Sixth People s Hospital. Analysis of mirna Microarray and Gene Ontology The mirna microarray assay was performed as described previously. 18 Briefly, total RNA was extracted from the renal cortex by using Trizol reagent (Invitrogen, Carlsbad, CA) followed by measurement of RNA quality and quantity. Then, 5 µg total RNA was subjected to size-fraction in a YM-100 Microcon centrifugal filter (Millipore, Billerica, MA) to obtain small RNAs (<300 nt). The 3 poly (A) tail of small RNAs was labeled with Cy3 and Cy5 fluorescent dye with subsequent hybridization on a µparaflo (LC Sciences, Hangzhou, China) microfluidic chip. After the hybridization, the fluorescent images were collected using a laser scanner (GenePix 4000B; Molecular Devices, Sunnyvale, CA) and digitized using Array-Pro image analysis software (Media Cybernetics, Rockville, MD). Gene ontology (GO) analysis was performed to reveal the mirna-gene regulatory network based on the molecular biological function. GOs with a p value <0.001 and a false discovery rate (FDR) <0.05 were selected to calculate the enrichment degree. A cell growth related network of mirna messenger RNA (mrna) was established based on the mirna degree. RT-PCR of mirnas Differentially expressed mirnas of mir-196a, mir-194, mir-703, mir-762, mir-34a, and mir-320 were randomly verified by stem-loop reverse transcription (RT) and subsequent PCR with U6 as an internal control. The primer sequences for stem-loop RT-PCR are included in Table 1. Cell Culture and Transfection Primary human MCs were purchased from Sciencell (Carlsbad, CA) and cultured in Dulbecco s modified Eagle s medium (DMEM) supplemented with 20% fetal bovine serum (FBS). MCs were subjected to different treatment, including normal glucose (5 mmol/l) plus mannitol (20 mmol/l) as a control, high glucose (25 mmol/l), and transfection with one of the following: mir-196a scramble, mir-196a mimics, mir-196a inhibitor, and specific small interfering RNA (sirna) for p27 kip1 by using Lipofectamine 2000 (Invitrogen). MCs were harvested to observe morphology, analyze the percentage of different phases in the cell cycle, and detect mrna and protein levels of p27 kip1, α-sma, and SM22 48 h after transfection. HEK293 cell lines were cultured in DMEM with 10% FBS for luciferase activity assay.

3 Wang et al. 493 Table 1. Primers Used in Real-Time PCR. mirna Name Sequence (5-3 ) mmu-mir-196a RNA uagguaguuucauguuguuggg MI RT stem-loop primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCAAC Forward primer GCGCTGCCTGTCTACACTTG mmu-mir-194 RNA uguaacagcaacuccaugugga MI RT stem-loop primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCACT Forward primer GCGCCTGGTACAGGCCTGGG mmu-mir-703 RNA aaaaccuucagaaggaaagaa MI RT stem-loop primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCTTT Forward primer GCGCTTAATGCTAATTGTGAT mmu-mir-762 RNA ggggcuggggccgggacagagc MI RT stem-loop primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCTCTG Forward primer GCGCTAGCAGCACAGAAAT mmu-mir-34a RNA uggcagugucuuagcugguugu MI RT stem-loop primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTTCC Forward primer GCGCAACCGTGGCTTTCGAT mmu-mir-320 RNA gccuucucuucccgguucuucc MI RT stem-loop primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGAAGA Forward primer GCGCAACCGTGGCTTTCGAT mmu-u6 RT primer GGGCCATGCTAAATCTTCTC NR_ Forward primer ATGGGTCGAAGTCGTAGCC Reverse primer TTCTCGGCGTCTTCTTTCTCG GAPDH Forward primer GGAGCGAGATCCCTCCAAAAT NM_ Reverse primer GGCTGTTGTCATACTTCTCATGG α-sma Forward primer GTGTTGCCCCTGAAGAGCAT NM_ Reverse primer GCTGGGACATTGAAAGTCTCA SM22 Forward primer AGTGCAGTCCAAAATCGAGAAG NM_ Reverse primer CTTGCTCAGAATCACGCCAT CDKN1B Forward primer AACGTGCGAGTGTCTAACGG NM_ Reverse primer CCCTCTAGGGGTTTGTGATTCT CDKN1B Forward primer TCAAACGTGAGAGTGTCTAACG NM_ Reverse primer CCGGGCCGAAGAGATTTCTG GAPDH Forward primer AGGTCGGTGTGAACGGATTTG NM_ Reverse primer GGGGTCGTTGATGGCAACA Annealing temperatures were 60 C. mirna, micro-rna; RT, reverse transcription. MC Hypertrophy Assay MC morphology was observed under a phase-contrast microscope (Olympus BX-41; Olympus, Tokyo, Japan) 48 h after transfection with the mir-196a mimic (RiboBio, Guangzhou, China). Flow cytometry was also performed to analyze the percentage of MCs in different phases of the cell cycle. We also detected hypertrophic marker genes of α-sma and SM22 in different-treated MCs. 19 Detection of p27 kip1 by Real-Time PCR Total RNA was extracted in cultured MCs by using Trizol reagent (Invitrogen), and 2 µg total RNA was subjected to reverse transcriptional reaction by the reverse transcription kit (Qiagen, Valencia, CA). Real-time PCR was performed with SYBR Premix (Takara, Dalian, China) in a LightCycler (Roche Diagnostics, Indianapolis, IN). Primer sequences of p27 kip1 are shown in Table 1.

4 494 Journal of Laboratory Automation 20(4) Western Blot Analysis MCs were harvested, as mentioned above, in cell culture and transfection, and then lysis buffer was added. After 25 min of centrifuge at 4 C, the supernatants were subjected to a spectrophotometer (Pgeneral, Beijing, China) to measure protein concentration according to the manufacturer s standard protocol (Pierce, Waltham, MA). Then, 45 µg total protein per sample was loaded onto a 12% polyacrylamide gel with the same amount of GAPDH as the internal control. The blot was incubated with a mouse monoclonal anti-p27 kip1 antibody (1:1000; BD Transduction Laboratories, Franklin Lakes, NJ), rabbit anti-sm22, and α-sma (1:200; Santa Cruz Biotechnology, Santa Cruz, CA) overnight at 4 C after gel running, transferring, and blocking experiments. The horseradish peroxidase (HRP) conjugated secondary antibody was added accordingly, followed by incubation with ECL (Pierce), and visualized by exposure to the X-ray. GAPDH was detected with a rabbit polyclonal anti-gapdh antibody (1:200; Santa Cruz Biotechnology) and HRP-conjugated goat anti rabbit antibody (1:1000; Santa Cruz Biotechnology). Exposed films were scanned with a Fluor-S multi-imager (Bio-Rad, Hercules, CA), and intensity was quantified with software (Bio-Rad). Each experiment was repeated three times, and all had identical results. Luciferase Reporter Assay The 3 UTR of human p27 kip1 with a putative target site for the seed sequence of mir-196a was amplified by PCR and cloned into the PGL-4 vector (Promega, Madison, WI) adjacent to the stop codon of luciferase (pgl4 p27 kip1 3 UTR, wild type). A mutant of p27 kip1 3 UTR was generated by the QuikChange II Site-Directed Mutagenesis Kit (Stratagene, Santa Clara, CA) with mutation of CTACC GATGG from a complementary site of the seed sequence of mir-196a. For the reporter assay, the mir-196a mimic was cotransfected with a wild type and a mutant reporter vector, respectively, into HEK293 cell lines. Cells were harvested to measure firefly and Renilla luciferase activities by the dual-luciferase assay kit (Promega) after 48 h of cotransfection. Statistical Analysis All data were expressed as mean ± SD. The Student t test was applied for the comparison between two groups. A p value <0.05 was regarded as statistically significant. Results Differential Expression of mirnas in Kidney from STZ-Induced Diabetic DBA/2 Mice To explore the roles of mirnas in glomerular hypertrophy during DN, we established an STZ-induced type I DN animal model in DBA/2 mice. As noted in Figure 1A,B, STZ caused a remarkable increase in blood glucose (7.02 ± 1.4 vs ± 2.3 mmol/l, p < 0.01; Fig. 1A), and 12 weeks after the onset of diabetes, the amount of proteinuria was significant in STZ-induced DBA/2 mice (3.86 ± 1.54 µg/ml vs ± 15.2 mmol/l, p < 0.01; Fig. 1B). PAS staining showed glomerular expansion significantly in DN mice (Fig. 1C). The results of the mirna microarray in the renal cortex showed that nine mirnas downregulated and seven mirnas upregulated in a volcano map (Fig. 1D). For accuracy, we performed random confirmation by RT-PCT with identical results from the microarray analysis (Fig. 1E). GO Analysis of Differential mirnas To identify the mirna-mrna regulatory network, we subjected significantly differential mirnas to GO analysis (Fig. 2A,B). The results showed that the hypertrophic-related gene of Cdkn1b, coding p27 kip1, was included in high-enriched GO. Therefore, mir-196a might be a potential molecular regulator of p27 kip1, which is involved in the regulation of MC hypertrophy (Fig. 2C). We verified the expression level of p27 kip1 in the renal cortex by quantitative RT-PCR. The result showed that the mrna level of p27 kip1 significantly increased in STZinduced DBA/2 mice (Fig. 2C). MiR-196a Regulates High Glucose-Induced MC Hypertrophy To test the role of mir-196a in the process of MC hypertrophy, we transfected half-confluent human MCs with mir-196a mimic after 24 h of serum starvation. We observed MC hypertrophy under Olympus BX-41 microscope after exposure to high glucose for 48h. Overexpression of mir-196a partially reversed the transformation of the hypertrophic phenotype (Fig. 3A). To determine whether mir-196a functionally regulated MC hypertrophy, we performed flow cytometry to measure the percentage of MCs at different phases of the cell cycle. The result showed that percentage of the G 1 phase of the cell cycle in the MCs increased significantly in the presence of high glucose. The G 1 phase arrest suggested that the MCs failed to smoothly go through the M phase of the cell cycle with sustained protein synthesis, leading to MC hypertrophy. Overexpression of mir-196a decreased G 1 phase cell cycle arrest in the presence of high glucose, while MC transformation of the hypertrophic phenotype recovered partly (Fig. 3B). Furthermore, we performed the expression of CDK inhibitor p27 kip1 and hypertrophic marker genes of α-sma and SM22. The results showed that mir-196a effectively inhibited high glucose-induced p27kip1, α-sma, and SM22 (Fig. 3C,D).

5 Wang et al. 495 Figure 1. Alteration of microrna (mirna) expression in mice with diabetic nephropathy (DN). (A) The blood glucose level in mice. (B) Urinary albuminuria excretion (UAE) increased markedly in DN mice in contrast to the control group. (C) Periodic acid Schiff (PAS) staining showed obvious mesangial expansion in DN mice (left from control group, right from DN mice; original magnification 400). (D) Volcano map for differential mirnas in kidney between diabetic and nondiabetic mice. The left side is for downregulation; the right side is for upregulation. (E) Confirmation of different mirnas showed consistency with data by microarray analysis. All data represent mean ± SD. p < 0.05, p < Student t test was performed to assess the statistical difference. MiR-196a Regulates MCs Hypertrophy by Targeting p27 kip1 Directly As we know, mirnas in general take effect by regulating their target genes at the posttranscriptional level. To further explore the target gene of mir-196a, we performed GO analysis to find that high-enriched GOs contain the gene of Cdkn1b, coding p27 kip1, an inhibitor of CDK. To determine whether mir-196a targets p27 kip1 directly, we constructed a luciferase reporter vector containing either a wild type of p27 kip1 3 UTR or a mutant of p27 kip1 3 UTR, followed by cotransfection with mir-196a mimic into HEK293 cell lines. We found that mir-196a mimic with the wild type of 3 UTR of p27 kip1 inhibited significantly the activity of the luciferase reporter, but mir-196a mimic with a mutant of 3 UTR of p27 kip1 did not, indicating that mir-196a targets p27 kip1 directly (Fig. 4A). To determine whether mir-196a regulates MC hypertrophy by targeting p27 kip1 directly, we transfected specific sirna for p27 kip1 to block the protein level of p27 kip1 in MCs. By analysis of the percentage of different phases of the cell cycle, we found that blockade of p27 kip1 inhibited alteration of the cell cycle due to loss of mir-196a (Fig. 4B). Meanwhile, hypertrophy marker genes of α-sma and SM22 declined accordingly (Fig. 4C,D). Discussion Glomerular hypertrophy occurs at an early stage of DN, which consists mainly of MC hypertrophy and secondary ECM deposition in the mesangial area. MC hypertrophy is regarded as a key event responsible for mesangial expansion, which causes glomerulosclerosis eventually. 2 Cell growth is regulated by the cell cycle related proteins, with activation of CDK required for progression through the

6 496 Journal of Laboratory Automation 20(4) Figure 2. Bioinformatics data of differential micrornas (mirnas) in mice with diabetic nephropathy (DN). (A) Cell cycle related target genes located in the highest gene ontology (GO) for downregulation of mirnas. (B) GO analysis of target genes for upregulation of mirnas. (C) Diagram of mirnatarget gene network (as noted, white circles represent target genes, shaded boxes represent downregulation of mirnas, and white boxes represent upregulation of mirnas; mir-196a target potentially Cdkn1b, coding p27 kip1 ). (D) Messenger RNA (mrna) relative expression levels in the renal cortex. All data represent mean ± SD. p < 0.05; Student t test was performed to assess the statistical difference. whole cell cycle. A series of reports indicated that p27 kip1, an inhibitor of CDK, contributed to MC hypertrophy in the presence of high glucose as a result of G 1 phase arrest of the cell cycle. 7,20 mirnas have been defined as single-strand, small noncoding RNAs of 21 to 25 nt, which have been recognized as potent regulators of gene expression at the posttranscriptional level by binding to the complementary site of 3 UTR of their target genes. Emerging evidence has shown that mirnas act as a key modulator of a variety of biological processes. 8 In this study, our data revealed that 16 mirnas were significantly different in DN mice compared with nondiabetic control mice. Several studies have demonstrated mir- NAs involved in cardiac myocyte and smooth muscle cell hypertrophy. More interestingly, mir-216, 217, 21, 34, and 451 have been recognized as important regulators of MC hypertrophy. 21,22 In this study, the results of bioinformatics of differential mirnas showed that cell growth related genes were located in the high-enrichment GOs. The network of critical mirnas and their target genes was established according to the degree of mirnas. We found that mir-196a downregulated remarkably in DN mice and potentially targeted p27 kip1. Previous studies showed that mir-196a correlated with osteosarcomas and colorectal, breast, and pancreatic tumors. Zhang et al. 23 reported more recently that mir-196a served as a biomarker in patients with focal and segmental glomerulosclerosis, suggesting that mir-196a might be a potent target in human kidney disorders.

7 Wang et al. 497 Figure 3. mir-196a involved in the regulation of mesangial cell (MC) hypertrophy. (A) Morphological change of MCs in different treatments (original magnification 200). (a) MCs cultured in the low-glucose condition, as noted, showing slim spindle-like cells. (b) Hypertrophic phenotype was induced by high glucose in MCs (arrows). (c, d) Transfection of the microrna (mirna) scramble failed to reverse MC hypertrophy, but mir-196a mimics did instead. (B) Overexpression of mir-196a increased the percentage of G2/M in the cell cycle, paralleled by the relative decline in the G 1 phase. (C) Overexpression of mir-196a reduced hypertrophic marker genes of α-sma and SM22 without alteration of messenger RNA (mrna) levels of p27 kip1. (D) Exogenous mir-196a showing an inhibitory effect on the protein levels of p27 kip1 with a similar pattern of expression to SM22 and α-sma. All data are expressed as mean ± SD. p < 0.05 vs. control. p <.05 vs. high glucose, the concentration is 25mmol/L. Student t test was performed to evaluate the statistical difference. Figure 4. mir-196a directly targeted p27 kip1 to regulate mesangial cell (MC) hypertrophy. (A) Luciferase activity decreased significantly after cotransfection of mir-196a mimic with wild type 3 UTR of p27 kip1 in HEK293 cells, but the mutant of 3 UTR of p27 kip1 did not. (B) Blockade of p27 kip1 protein with small interfering RNA (sirna) reversed the G 1 phase arrest, accompanied by the increased percentage of G2/M. (C) Exogenous mir-196a inhibited mrna levels of SM22 and α-sma without alteration of p27 kip1 mrna. (D) Transfection of sirna for p27 kip1 effectively knocked down the expression of p27 kip1 protein. Anti mir-196a cotransfected with sirna for p27 kip1 reduced the levels of hypertrophic marker genes of SM22 and α-sma induced by anti mir-196 transfected alone. All data are expressed as mean ± SD. p < 0.05 vs. control. p <.05 vs. anti mir-196a. Student t test was performed to evaluate the statistical difference.

8 498 Journal of Laboratory Automation 20(4) Our study was designed to determine whether mir-196a is involved in high glucose-induced MC hypertrophy, an early hallmark responsible for glomerulosclerosis during DN. Previous studies showed that high glucose induced a biphasic growth response of MCs. There was a transient proliferation, followed by a sustained inhibition after 48 h of incubation. Thereby we incubated MCs for 48h in the presence of high glucose as described previously. 24 The results showed that overexpression of mir-196a alleviated MC hypertrophy and reduced the percentage of G 1 phase arrest in the cell cycle. Meanwhile, we found that the percentage of M phase MCs increased accordingly. These results indicated that mir-196a functionally regulated MC hypertrophy. In addition, in HEK293 cells, we found that a wild type of the p27 kip1 vector, rather than a mutant of the p27 kip1 vector, reduced luciferase reporter activity after cotransfection with mir-196a, suggesting that mir-196a directly targets p27 kip1. Previous studies 3 6 reported that p27 kip1 was required for the process of MC hypertrophy. Here we showed that the knockdown of p27 kip1 reversed MC hypertrophy induced by the blockade of mir-196a, suggesting that mir-196 functionally regulated MC hypertrophy by targeting p27 kip1 directly. As described previously, MC hypertrophy was regarded as a key event in early stage DN. 1 Hypertrophic phenotype transformation acquired characteristics of myofibroblasts to synthesize the protein of ECM, further accumulate in the glomerular mesangial area, and gradually cause mesangial expansion responsible for glomerulosclerosis. 2 In this study, PAS staining showed that mesangial expansion was significant in STZ-induced DN mice with albuminuria in contrast to that of nondiabetic control mice, which strongly suggests that mir-196a and its target gene p27 kip1 play an important role in the pathogenesis of DN by regulating transformation of the hypertrophic phenotype of MCs. Given the fact that DN is becoming a primary cause of end-stage renal disease with limited effective treatment, it is necessary to explore the mechanism of the onset and progression of DN As a hallmark event, MC hypertrophy caused concerns at a very early stage of DN. Limiting its early growth might have impact on the later progression of DN. This study revealed that mir-196a functionally regulated MC hypertrophy in vitro. For the next step, we will construct a mir-196a lentivirus vector, deliver it into DN mice, and observe the effects of mir-196a on urinary albuminuria excretion and mesangial expansion in vivo to provide new clues for a potentially therapeutic approach. Acknowledgments We are grateful to all members in the Department of Nephrology, Shanghai Jiao Tong University Affiliated Sixth People s Hospital, for their efforts and assistance. Declaration of Conflicting Interests The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. Funding The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by grants , , and from the National Natural Science Foundation of China and grant from the Science and Technology Commission of the Shanghai Non-governmental International Cooperation Project. References 1. Satriano, J. Kidney Growth, Hypertrophy and the Unifying Mechanism of Diabetic Complications. Amino Acids 2007, 2, Steffes, M. W.; Osterby, R.; Chavers, B.; et al. Mesangial Expansion as a Central Mechanism for Loss of Kidney Function in Diabetic Patients. Diabetes 1989, 9, Wolf, G.; Reinking, R.; Zahner, G.; et al. Erk 1,2 Phosphorylates p27(kip1): Functional Evidence for a Role in High Glucose-Induced Hypertrophy of Mesangial Cells. Diabetologia 2003, 46, Wolf, G.; Schanze, A.; Stahl, R. A.; et al. p27(kip1)knockout Mice Are Protected from Diabetic Nephropathy, Evidence forp27(kip1) Haplotype Insufficiency. Kidney Int. 2003, 68, Wolf, G.; Schroeder, R.; Zahner, G.; et al. High Glucose- Induced Hypertrophy of Mesangial Cells Requires p27(kip1), an Inhibitor of Cyclin-Dependent Kinases. Am. J. Pathol. 2001, 158, Wolf, G.; Sharma, K.; Chen, Y.; et al. High Glucose-Induced Proliferation in Mesangial Cells Is Reversed by Autocrine TGF-beta. Kidney Int. 1992, 42, Awazu, M.; Omori, S.; Ishikura, K.; et al. The Lack of Cyclin Kinase Inhibitor p27(kip1) Ameliorates Progression of Diabetic Nephropathy. J. Am. Soc. Nephrol. 2003, 14, Bartel, D. P. MicroRNAs, Genomics, Biogenesis, Mechanism and Function. Cell 2004, 2, Xu, Q.; Sun, Q.; Zhang, J. J.; et al. Downregulation of mir-153 Contributes to Epithelial- Mesenchymal Transition and Tumor Metastasis in Human Epithelial Cancer. Carcinogenesis 2013, 3, Shen, E.; Diao, X.; Wang, X. X.; et al. MicroRNAs Involved in the Mitogen-Activated Protein Kinase Cascades Pathway during Glucose-Induced Cardiomyocyte Hypertrophy. Am. J. Pathol. 2011, 2, Harvey, S. J.; Jarad, G.; Cunningham, J.; et al. Podocyte- Specific Deletion of Dicer Alters Cytoskeletal Dynamics and Causes Glomerular Disease. J. Am. Soc. Nephrol. 2008, 11, Wang, Q.; Wang, Y.; Minto, A. W.; et al. MicroRNA-377 Is Up-Regulated and Can Lead to Increased Fibronectin Production in Diabetic Nephropathy. FASEB J. 2008, 12,

9 Wang et al Saal, S.; Harvey, S. J. MicroRNAs and the Kidney, Coming of Age. Curr. Opin. Nephrol. Hypertens. 2009, 4, Putta, S.; Lanting, L.; Sun, G.; et al. Inhibiting MicroRNA-192 Ameliorates Renal Fibrosis in Diabetic Nephropathy. J. Am. Soc. Nephrol. 2012, 3, Krupa, A.; Jenkins, R.; Luo, D.D.; et al. Loss of MicroRNA-192 Promotes Fibrogenesis in Diabetic Nephropathy. J. Am. Soc. Nephrol. 2010, 3, Wang, B.; Komers, R.; Carew, R.; et al. Suppression of MicroRNA-29 Expression by TGF-β1 Promotes Collagen Expression and Renal Fibrosis. J. Am. Soc. Nephrol. 2012, 2, Gurley, S. B.; Clare, S. E.; Snow, K. P.; et al. Impact of Genetic Background on Nephropathy in Diabetic Mice. Am. J. Physiol. Renal Physiol. 2006, 290, F214 F Cheung, O.; Puri, P.; Eicken, C.; et al. Nonalcoholic Steatohepatitis Is Associated with Altered Hepatic MicroRNA Expression. Hepatology 2008, 6, Mohamed, J. S.; Lopez, M. A.; Boriek, A. M. Mechanical Stretch Up-Regulates MicroRNA-26a and Induces Human Airway Smooth Muscle Hypertrophy by Suppressing Glycogen Synthase Kinase-3β. J. Biol. Chem. 2010, 38, Polyak, K.; Lee, M. H.; Erdjument-Bromage, H.; et al. Cloning of p27kip1, a Cyclin-Dependent Kinase Inhibitor and a Potential Mediator of Extracellular Antimitogenic Signals. Cell 1994, 1, van Rooij, E.; Sutherland, L. B.; Liu, N.; et al. A Signature Pattern of Stress-Responsive MicroRNAs That Can Evoke Cardiac Hypertrophy and Heart Failure. Proc. Natl. Acad. Sci. U. S. A. 2006, 48, Shen, E.; Diao, X.; Wang, X. X.; et al. MicroRNAs Involved in the Mitogen-Activated Protein Kinase Cascades Pathway during Glucose-Induced Cardiomyocyte Hypertrophy. Am. J. Pathol. 2011, 2, Zhang, W.; Zhang, C.; Chen, H.; et al. Evaluation of MicroRNAs mir-196a, mir-30a-5p, and mir-490 as Biomarkers of Disease Activity among Patients with FSGS. Clin. J. Am. Soc. Nephrol. 2014, 9, Zhang, L.; He, S.; Guo, S.; et al. Down-Regulation of mir-34a Alleviates Mesangial Proliferation In Vitro and Glomerular Hypertrophy in Early Diabetic Nephropathy Mice by Targeting GAS1. J. Diabetes Complications 2014, 3, Park, J. T.; Kato, M.; Yuan, H.; et al. FOG2 Protein Down- Regulation by Transforming Growth Factor-β1-Induced MicroRNA-200b/c Leads to Akt Kinase Activation and Glomerular Mesangial Hypertrophy Related to Diabetic Nephropathy. J. Biol. Chem. 2013, 31, Sataranatarajan, K.; Feliers, D.; Mariappan, M. M.; et al. Molecular Events in Matrix Protein Metabolism in the Aging Kidney. Aging Cell. 2012, 6, Dey, N.; Ghosh-Choudhury, N.; Kasinath, B. S.; et al. TGFβ- Stimulated MicroRNA-21 Utilizes PTEN to Orchestrate AKT/mTORC1 Signaling for Mesangial Cell Hypertrophy and Matrix Expansion. PLoS One. 2012, 8,