Supplementary Information

Size: px
Start display at page:

Download "Supplementary Information"

Transcription

1 Supplementary Information Metabolomics reveals trichloroacetate as a major contributor to trichloroethylene-induced metabolic alterations in mouse urine and serum Zhong-Ze Fang, Kristopher W Krausz, Naoki Tanaka, Fei Li, Aijuan Qu, Jeffrey R. Idle, Frank J Gonzalez 1

2 Supplement table 1: Primer pairs used for qpcr Gene Primer sequence Ppara F 5 -AGTTCGGGAACAAGACGTTG-3 R 5 -CAGTGGGGAGAGAGGACAGA-3 Acot1 F 5 -CTGGCGCATGCAGGATC-3 R 5 -GGCACTTTTCTTGGATAGCTCC-3 Acox1 F 5 -TCGCAGACCCTGAAGAAATC-3 R 5 -CCTGATTCAGCAAGGTAGGG-3 Acadm F 5 -AGCTCTAGACGAAGCCACGA-3 R 5 -GCGAGCAGAAATGAAACTCC-3 Acadl F 5 -TCTTGCGATCAGCTCTTTCA-3 R 5 -GGTACATGTGGGAGTACCCG-3 Ehhadh F 5 -CTATGATCCGCCTCTGCAA-3 R 5 -TGGCTCTAACCGTATGGTCC-3 Acaa1a F 5 -GTGGCATCAGAAATGGGTCT-3 R 5 -CGGGAAGAGATATTCCCAGG-3 Cpt1a F 5 -GCCCATGTTGTACAGCTTCC-3 R 5 -AGTGGCCTCACAGACTCCAG-3 Cpt2 F 5 -ATGCACTACCAGGACAGGCT-3 R 5 -TGGCTGTCATTCAAGAGAGG-3 Cyp4a1 F 5 -GATGGACGCTCTTTACCCAA-3 R 5 -AAGGGTCAAACACCTCTGGA-3 2

3 Supplementary figure 1. Body weight change and food intake in control and TCE-treated mice. The data are given as mean±sem (n=5). body weight (g) TCE-8 TCE Time (day) Food intake (g per 24 h) TCE-8 TCE Time (day) 3

4 Supplementary figure 2. The influence of TCE exposure on alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) activities in serum, and triglyceride (TG) levels in liver. *p<.5, **p<.1, ***p<.1. 4 ** 6 *** ALT(U/L) AST(U/L) 4 2 TCE-8 TCE-16 TCE-8 TCE ALP(U/L) 2 1 TG (mg/g liver) 1 5 TCE-8 TCE-16 Control TCE-8 TCE-16 4

5 5

6 Supplementary figure 3. The influence of DCA exposure on alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) activities in serum, and triglyceride (TG) levels in liver. *p<.5, **p<.1, ***p< ALT (U/L) AST(U/L) 2 1 DCA DCA ** 3 3 ALP(U/L) 2 1 TG (mg/g liver) 2 1 DCA DCA 6

7 Supplementary figure 4. The influence of TCA exposure on alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) activities in serum, and triglyceride (TG) levels in liver. 3 4 ALT (U/L) 2 1 AST(U/L) TCA TCA 2 15 ALP(U/L) TG (mg/g liver) 1 5 TCA TCA 7

8 Supplementary figure 5. Histopathology (H&E staining) of livers from C57BL/6 treated with TCE. (A) TCE-ctrl; (B) TCE-8 mg/kg/day; (C) TCE-16 mg/kg/day; (D) TCE-ctrl; (E) TCE- 8 mg/kg/day; (F) TCE-16 mg/kg/day. 1 X magnification. (A) (B) (C) (D) (E) (F) 8

9 Supplementary figure 6. Histopathology (H&E staining) of livers after exposure of C57BL/6 mice to DCA and TCA. (A) DCA-ctrl; (B) DCA-treat; (C) TCA-ctrl; (D) TCA-treat. (A) (B) (C) (D) 9

10 Supplementary figure 7A. UPLC-ESI-QTOFMS comparison of the authentic standard of hippuric acid with ions derived from urine obtained from C57BL/6 mice. Comparison of retention time Time Comparison of MS/MS fragmentation

11 Supplementary figure 7B. UPLC-ESI-QTOFMS comparison of authentic standard of cinnamoylglycine with ions derived from urine obtained from C57BL/6 mice. Comparison of retention time Time Comparison of MS/MS fragmentation Cinnamoyl-glycine urine sample-c

12 Supplementary figure 7C. UPLC-ESI-QTOFMS comparison of the authentic standard of phenylacetylglycine with ions derived from urine obtained from C57BL/6 mice. Comparison of retention time Time Comparison of MS/MS fragmentation Phenylacetylglycine urine sample-c

13 Supplementary figure 7D. UPLC-ESI-QTOFMS comparison of the authentic standard of hexanoylglycine with ions derived from urine obtained from C57BL/6 mice. Comparison of retention time Time Comparison of MS/MS fragmentation Hexanoyl-glycine urine sample-c

14 Supplementary figure 7E. UPLC-ESI-QTOFMS comparison of the authentic standard of phenylpropionylglycine with ions derived from urine obtained from C57BL/6 mice. Phenylpropionyl-glycine Time

15 Supplementary figure 7F. UPLC-ESI-QTOFMS comparison of authentic standard of pantothenic acid with ions derived from urine obtained from C57BL/6 mice. Comparison of retention time Time Comparison of MS/MS fragmentation Pantothenic acid urine sample-c

16 Supplementary figure 7G. UPLC-ESI-QTOFMS comparison of authentic standard of carnitine with ions derived from urine obtained from C57BL/6 mice. Comparison of retention time Time Comparison of MS/MS fragmentation Carnitine urine sample-c

17 Supplementary figure 7H. UPLC-ESI-QTOFMS comparison of authentic standards of acetylcarnitine with ions derived from urine obtained from C57BL/6 mice. Comparison of retention time Time Comparison of MS/MS fragmentation Acetylcarnitine urine sample-c

18 Supplementary figure 7I. UPLC-ESI-QTOFMS comparison of authentic standard of 1- octadecanoyl-sn-glycero-3-phosphocholine (LPC (18:) with ions derived from serum obtained serum from C57BL/6 mice. Comparison of retention time 1 Serum Time Comparison of MS/MS fragmentation LPC(18:) serum sample-16-5 Serum

19 Supplementary figure 7J. UPLC-ESI-QTOFMS comparison of authentic standard of 1-oleoyl- 2-hydroxy-sn-glycero-3-phosphocholine (LPC(18:1, 9Z) with ions derived from serum obtained from C57BL/6 mice. Comparison serum of retention sample-16-5 time 1 Serum Time Comparison of MS/MS fragmentation LPC(18:1,9Z) serum sample-16-5 Serum

20 Supplementary figure 8. Relative quantitation of PC components altered in serum from mice treated with TCE. The relative abundance (peak area of metabolites/internal standard) is given. The results were given as mean ±SEM. *, p<.5; **, p<.1; ***, p<.1. 5 (MS=81.64,R t =8.4 min) *** *** 4 (MS=834.65,R t =8.29 min) *** *** 8 (MS=76.588,R t =8.47 min) *** ** Relative abundance Relative abundance Relative abundance TCE-8 TCE-16 (MS= ,R t =8.2 min) ** 8 ** TCE-8 2 TCE-16 (MS=88.589,R t =8.4 min) *** *** TCE-8 TCE-16 Relative abundance Relative abundance TCE-8 TCE-16 TCE-8 TCE-16 2

21 Supplementary figure 9. Comparison of the alteration of pantothenic acid and phenylacetylglycine in urine of mice treated with TCA and DCA. Pantothenic acid (µmol/mmol Creatinine) TCA days phenylacetyl-glycine (mmol/mmol Creatinine) TCA days Pantothenic acid (µmol/mmol Creatinine) DCA days phenylacetyl-glycine (mmol/mmol Creatinine) DCA days 21

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Supplemental Information

Supplemental Information Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

CFSE Thy1.2 + CD4 + cells

CFSE Thy1.2 + CD4 + cells Time after immunization (d) IFN-g Spleen Lymph nodes Rbpj +/+ ;OT-II Rbpj -/- ;OT-II Rbpj +/+ ;OT-II Rbpj -/- ;OT-II 2.3.2 22.9 5.6 3 23.3 3. 21.3 32.7 8.7 18.5 11.6 13.5 7 84.2 74.2 85. 83.8 CFSE Thy1.2

More information

Age-related reference ranges

Age-related reference ranges Authoriser: Peter Beresford Page 1 of 6 Age-related reference ranges Alkaline Phosphatase (ALP) IU/L Both less than 14 days 90 273 Both 14 days

More information

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody. ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *

More information

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression) a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Library identifications for Lemnaceae

Library identifications for Lemnaceae Library identifications for Lemnaceae NP-001984 ESI+ NP-001984 present in, enriched in (15.47min) NP-001984 -MS^E CH 3 Moupinamide H NH NP-005512 + NP-016675 ESI- s NP-005512 NP-016675 NP-005512 present

More information

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr. 5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:

More information

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90

More information

Radiation Metabolomics. 1. Identification of Minimally Invasive Urine Biomarkers for Gamma-Radiation Exposure in Mice

Radiation Metabolomics. 1. Identification of Minimally Invasive Urine Biomarkers for Gamma-Radiation Exposure in Mice RADIATION RESEARCH 170, 1 14 (2008) 0033-7587/08 $15.00 2008 by Radiation Research Society. All rights of reproduction in any form reserved. Radiation Metabolomics. 1. Identification of Minimally Invasive

More information

Urinary metabolomics in Fxr -null mice reveals activated adaptive metabolic pathways upon bile acid challenge

Urinary metabolomics in Fxr -null mice reveals activated adaptive metabolic pathways upon bile acid challenge Urinary metabolomics in Fxr -null mice reveals activated adaptive metabolic pathways upon bile acid challenge Joo-Youn Cho, * Tsutomu Matsubara, * Dong Wook Kang, Sung-Hoon Ahn, * Kristopher W. Krausz,

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

Mass Spectrometry based metabolomics

Mass Spectrometry based metabolomics Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (

More information

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the P-gp expression (% of control) 12 1 8 6 4 2 * * Untreated SipA SipA/pSipA WT Supplementary Figure 1. SipA modulates the expression of P-gp in healthy murine intestinal epithelium in vivo. Salmonella Typhimurium

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2017 Supplementary Information Geometrical Confinement Directed Albumin-Based

More information

Inhibitory Effect of Methotrexate on Rheumatoid Arthritis Inflammation and Comprehensive Metabolomics Analysis Using UPLC-Q/TOF-MS

Inhibitory Effect of Methotrexate on Rheumatoid Arthritis Inflammation and Comprehensive Metabolomics Analysis Using UPLC-Q/TOF-MS SUPPLEMENTARY MATERIALS Inhibitory Effect of Methotrexate on Rheumatoid Arthritis Inflammation and Comprehensive Metabolomics Analysis Using UPLC-Q/TOF-MS Zhiqiang Pang 1, Guoqiang Wang 1, Nan Ran 1, Hongqiang

More information

Supplementary Table 1.

Supplementary Table 1. Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA

More information

Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism

Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

DIABETES AND LABORATORY TESTS. Author: Josephine Davis

DIABETES AND LABORATORY TESTS. Author: Josephine Davis DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary

More information

The use of mass spectrometry in lipidomics. Outlines

The use of mass spectrometry in lipidomics. Outlines The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid

More information

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl) a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6

More information

Untargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-120.

Untargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-120. Untargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-0. Thomas J Velenosi, Anzel Hennop, David A Feere, Alvin Tieu, Andrew S Kucey, Polydoros Kyriacou, Laura E McCuaig,

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:

Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author: Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli

More information

Learning Objectives. Disclosures. Self Assessment Questions. Background

Learning Objectives. Disclosures. Self Assessment Questions. Background Association of Hyperuricemia with Liver Dysfunction amongst Adults with Metabolic Disorders in the United States: A Cross Sectional Study Disclosures Dr. Prashant Sakharkar and Dr. Subrata Deb declare(s)

More information

Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F

Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A Expression of representative subunits of the mitochondrial respiratory chain was analyzed by real time

More information

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT

More information

Control 7 d cold 7 d CL

Control 7 d cold 7 d CL Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

More information

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

Supporting information

Supporting information Supporting information A novel lipidomics workflow for improved human plasma identification and quantification using RPLC-MSn methods and isotope dilution strategies Evelyn Rampler 1,2,3, Angela Criscuolo

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

Mass-Spectrometric Analysis of Lipids (Lipidomics)

Mass-Spectrometric Analysis of Lipids (Lipidomics) Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:

More information

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood

More information

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University 1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;

More information

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300 Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness

More information

Effects of Algae Feeding on Mouse Metabolome

Effects of Algae Feeding on Mouse Metabolome Effects of Algae Feeding on Mouse Metaolome Yiwei Ma 1, Wenguang Zhou 2, Paul Chen 2, Pedro E. Urriola 3, Gerald C. Shurson 3, Roger Ruan 2*, Chi Chen 1* 1 Department of Food Science and Nutrition. 2 Department

More information

Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat

Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Supplementary files Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan

More information

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body

More information

Application of LC-MS-based metabolomics method in differentiating septic survivors from non-survivors

Application of LC-MS-based metabolomics method in differentiating septic survivors from non-survivors Analytical and Bioanalytical Chemistry Electronic Supplementary Material Application of LC-MS-based metabolomics method in differentiating septic survivors from non-survivors Zhicheng Liu, Peiyuan Yin,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone

Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China Xi Yuan Hospital of China Academy of Traditional Chinese Medicine Testing Report Sample processing

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain. Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and

More information

Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice

Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Wang et. al. IL-6 in plasma (pg/ml) Rac1/HPRT (% of control) PSD9/HPRT

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION INTEGRATIVE mirna AND GENE EXPRESSION PROFILING ANALYSIS OF HUMAN QUIESCENT HEPATIC STELLATE CELLS Mar Coll 1*, Adil El Taghdouini 2*, Luis Perea 1, Inge Mannaerts 2, Maria Vila-Casadesús

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Agents that inhibit the BSEP and mitochondrial function what do we know? Prepared by Michael D. Aleo, Ph.D. Groton, Investigative Toxicology

Agents that inhibit the BSEP and mitochondrial function what do we know? Prepared by Michael D. Aleo, Ph.D. Groton, Investigative Toxicology Agents that inhibit the BSEP and mitochondrial function what do we know? Prepared by Michael D. Aleo, Ph.D. Groton, Investigative Toxicology Declarations Nonclinical studies All procedures performed on

More information

Excellent References

Excellent References Sweating the small stuff the influence of metabolite extraction and separation on metabolomic studies Andrew D. Patterson, PhD Assistant Professor of Molecular Toxicology Penn State University adp117@psu.edu

More information

DIAGNOSING X-LINKED HYPOPHOSPHATEMIA (XLH) BIOCHEMICAL TESTING CONSIDERATIONS

DIAGNOSING X-LINKED HYPOPHOSPHATEMIA (XLH) BIOCHEMICAL TESTING CONSIDERATIONS DIAGNOSING X-LINKED HYPOPHOSPHATEMIA (XLH) BIOCHEMICAL TESTING CONSIDERATIONS XLH IS CHARACTERIZED BY CHRONIC HYPOPHOSPHATEMIA XLH is a hereditary, progressive, lifelong disorder. In children and adults,

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

Indolepropionic acid and novel lipid metabolites are associated with a lower. risk of type 2 diabetes in the Finnish Diabetes Prevention Study

Indolepropionic acid and novel lipid metabolites are associated with a lower. risk of type 2 diabetes in the Finnish Diabetes Prevention Study 1 Supplementary Material Indolepropionic acid and novel lipid metabolites are associated with a lower risk of type 2 diabetes in the Finnish Diabetes Prevention Study Vanessa D de Mello, Jussi Paananen,

More information

TRACEABILITY and UNCERTAINTY

TRACEABILITY and UNCERTAINTY Cat. No. 0 79 0 90 ACP Acid phosphatase total -naphthyl phosphate NPP Acid phosphatase, non-prostatic -naphthyl phosphate (Inhib.:tartrate) ALB Albumin BCG plus ALB Albumin BCP ALP Alkaline phosphatase

More information

Research Paper Pharmacokinetics of Moxifloxacin in A 5/6th Nephrectomized Rat Model

Research Paper Pharmacokinetics of Moxifloxacin in A 5/6th Nephrectomized Rat Model International Journal of Pharmaceutical Sciences and Nanotechnology Volume 2 Issue 4 January March 2010 Research Paper Pharmacokinetics of Moxifloxacin in A 5/6th Nephrectomized Rat Model * Hariprasath

More information

TRACEABILITY and UNCERTAINTY

TRACEABILITY and UNCERTAINTY ACP Acid phosphatase total 1-naphthyl phosphate NPP Acid phosphatase, non-prostatic 1-naphthyl phosphate (Inhib.:tartrate) ACP-P Acid phosphatase, prostatic 1-naphthyl phosphate (Inhib.:tartrate) ALB Albumin

More information

Protein & Enzyme Lab (BBT 314)

Protein & Enzyme Lab (BBT 314) Protein & Enzyme Lab (BBT 314) Experiment 3 A: Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Bioanalyzer Background: Alanine aminotransferase (glutamate pyruvate transaminase)

More information

Lipidomic Analysis by UPLC-QTOF MS

Lipidomic Analysis by UPLC-QTOF MS Lipidomic Analysis by UPLC-QTOF MS Version: 1 Edited by: Oliver Fiehn Summary Reagents and Materials Protocol Summary:Lipidomic analysis by UPLC-QTOF mass spectrometry Reagents and Materials: Reagent/Material

More information

Metabolite identification in metabolomics: Database and interpretation of MSMS spectra

Metabolite identification in metabolomics: Database and interpretation of MSMS spectra Metabolite identification in metabolomics: Database and interpretation of MSMS spectra Jeevan K. Prasain, PhD Department of Pharmacology and Toxicology, UAB jprasain@uab.edu utline Introduction Putative

More information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

Metabolomic Analysis for Newborn Screening and Diagnosis of Metabolic Disorders

Metabolomic Analysis for Newborn Screening and Diagnosis of Metabolic Disorders Metabolomic Analysis for Newborn Screening and Diagnosis of Metabolic Disorders Mass Spectrometry and Separation Sciences for Laboratory Medicine Chicago October 1-2, 2015 Michael J. Bennett PhD, FRCPath,

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Metabolite identification in metabolomics: Metlin Database and interpretation of MSMS spectra

Metabolite identification in metabolomics: Metlin Database and interpretation of MSMS spectra Metabolite identification in metabolomics: Metlin Database and interpretation of MSMS spectra Jeevan K. Prasain, PhD Department of Pharmacology and Toxicology, UAB jprasain@uab.edu Outline Introduction

More information

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week

More information

A role for Peroxisome Proliferator-Activated Receptor Beta in T cell development

A role for Peroxisome Proliferator-Activated Receptor Beta in T cell development SUPPLEMENTARY INFORMATION A role for Peroxisome Proliferator-Activated Receptor Beta in T cell development Isabelle Mothe-Satney, Joseph Murdaca, Brigitte Sibille, Anne-Sophie Rousseau, Raphaëlle Squillace,

More information

Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of

Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of phosphatidylserine and phosphatidylcholine. The instrinsic

More information

Figure S1A. Blood glucose levels in mice after glucose injection

Figure S1A. Blood glucose levels in mice after glucose injection ## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

Pathophysiology I Liver and Biliary Disease

Pathophysiology I Liver and Biliary Disease Pathophysiology I Liver and Biliary Disease The Liver The liver is located in the right upper portion of the abdominal cavity just beneath the right side of the rib cage. The liver has many functions that

More information

Juxtapid. Juxtapid (lomitapide) Description

Juxtapid. Juxtapid (lomitapide) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 Subject: Juxtapid Page: 1 of 6 Last Review Date: September 20, 2018 Juxtapid Description Juxtapid (lomitapide)

More information

Development of Urinary Biomarkers for Internal Exposure by Cesium-137 Using a Metabolomics Approach in Mice

Development of Urinary Biomarkers for Internal Exposure by Cesium-137 Using a Metabolomics Approach in Mice Development of Urinary Biomarkers for Internal Exposure by Cesium- Using a Metabolomics Approach in Mice Author(s): Maryam Goudarzi, Waylon Weber, Tytus D. Mak, Juijung Chung, Melanie Doyle-Eisele, Dunstana

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures and Figure Legends Supplementary Figure 1 A. HDL-C (mg/dl) 14 12 1 8 6 4 2 Noncarriers HDL Cholesterol **** Carriers B. apoa-i (mg/dl) 325 3 275 25 225 2

More information

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Total Cholesterol A Type of Fat. LDL Bad Cholesterol. HDL Good Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely

More information

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

Supplementary table I. Real-time primers used in the study. The fold change was obtained by Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation

More information

EFFECT OF CULINARY MEDICINAL MUSHROOMS, PLEUROTUS OSTREATUS AND P. CYSTIDIOSUS ON FASTING AND POSTPRANDIAL GLYCAEMIA IN HEALTHY VOLUNTEERS

EFFECT OF CULINARY MEDICINAL MUSHROOMS, PLEUROTUS OSTREATUS AND P. CYSTIDIOSUS ON FASTING AND POSTPRANDIAL GLYCAEMIA IN HEALTHY VOLUNTEERS EFFECT OF CULINARY MEDICINAL MUSHROOMS, PLEUROTUS OSTREATUS AND P. CYSTIDIOSUS ON FASTING AND POSTPRANDIAL GLYCAEMIA IN HEALTHY VOLUNTEERS JAYASURIYA WJABN 1 *, WANIGATUNGE CA 2, FERNANDO GH 2, ABEYTUNGA

More information

Biochemical characterization and 1 H NMR based metabolomics revealed Melicope lunu-ankenda leaf extract a potent antidiabetic

Biochemical characterization and 1 H NMR based metabolomics revealed Melicope lunu-ankenda leaf extract a potent antidiabetic AL-Zuaidy et al. BMC Complementary and Alternative Medicine (2017) 17:359 DOI 10.1186/s12906-017-1849-2 RESEARCH ARTICLE Open Access Biochemical characterization and 1 H NMR based metabolomics revealed

More information

Alarming high levels of transaminases in non insulin dependent diabetes mellitus

Alarming high levels of transaminases in non insulin dependent diabetes mellitus Original article: Alarming high levels of transaminases in non insulin dependent diabetes mellitus *Ekta Chitkara Department of Applied Medical Sciences, Lovely Professional University, Punjab, India *Corresponding

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

International Journal of Pure and Applied Sciences and Technology

International Journal of Pure and Applied Sciences and Technology Int. J. Pure Appl. Sci. Technol., 19(2) (2013), pp. 61-65 International Journal of Pure and Applied Sciences and Technology ISSN 2229-6107 Available online at www.ijopaasat.in Research Paper Biochemical

More information

The Application of UPLC/MS E for the Analysis of Bile Acids in Biological Fluids

The Application of UPLC/MS E for the Analysis of Bile Acids in Biological Fluids The Application of UPLC/MS E for the Analysis of Bile Acids in Biological Fluids Elizabeth J. Want, 1 Muireann Coen, Perrine Masson, Hector C. Keun, Jake T.M. Pearce, Michael D. Reily, Donald Robertson,

More information