Title: Receptor Activator of Nuclear Factor-κB (RANKL) and Risk of Type 2 Diabetes Mellitus
|
|
- Marshall Wilkerson
- 6 years ago
- Views:
Transcription
1 1 Title: Receptor Activator of Nuclear Factor-κB (RANKL) and Risk of Type 2 Diabetes Mellitus Authors: Stefan Kiechl, Jürgen Wittmann, Andrea Giaccari, Michael Knoflach, Peter Willeit, Aline Bozec, Alexander Moschen, Giovanna Muscogiuri, Gian Pio Sorice, Trayana Kireva, Monika Summerer, Stefan Wirtz, Julia Luther, Dirk Mielenz, Ulrike Billmeier, Georg Egger, Agnes Mayr, Friedrich Oberhollenzer, Florian Kronenberg, Michael Orthofer, Josef Penninger, James B. Meigs, Enzo Bonora, Herbert Tilg, Johann Willeit, Georg Schett
2 2 Supplementary Text Association between soluble RANKL concentration and insulin resistance In subjects free of diabetes, 1990 soluble RANKL concentrations (n = 844) showed weak associations with insulin resistance as estimated by HOMA-IR or the inverse of Gutt s ISI 0,120 : age- and sex-adjusted partial correlation coefficients r = (P = 0.016) and r = (P = 0.011), respectively. Concentration of soluble RANKL was higher in individuals with four or more components of the metabolic syndrome. In particular, mean concentration of soluble RANKL was 1.15, 1.10, 1.61 and 1.64 pmol L 1 in subjects with zero to two, three, four and five components (1990; P = 0.008) and 1.15, 1.18, 1.63 and 2.13 pmol L 1 (1995; P < 0.001), respectively. There was a tendency to an inverse correlation between RANKL and ß-cell secretory capacity as estimated by Sluiter s index, but this correlation fell short of significance. Risk prediction In order to assess the potential usefulness of soluble RANKL as a risk predictor for T2DM, we estimated its effect on model discrimination and calibration and on risk classification. Discriminative accuracy of the prediction models, i.e. the ability to correctly classify subjects into one of two categories, was calculated with the C statistic, which is analogous to the area under the receiver-operating-characteristic curve (AUC) (larger values indicate better discrimination). Comparison of AUCs based on models including and not including RANKL was performed according to the method of DeLong. 1 Findings remained robust when applying the algorithms proposed by Hanley. 2 To assess model calibration or how closely the predicted probabilities reflect actual risk, we computed the Hosmer-Lemeshow calibration statistics comparing observed and predicted risk in decile categories of predicted risk (higher P values indicate better calibration). 3 Finally, we calculated the net reclassification improvement. 4 Results are as follows. Addition of RANKL to the model already including age, gender, period of follow-up, body mass index and fasting glucose concentration resulted in a significantly higher AUC
3 3 (0.858 [ ] to [ ], ΔAUC [ ], P = 0.011), indicating a significant gain in model discrimination. There was a highly significant improvement in the likelihood function ( 2 Log-likelihood, 26.3, P < 0.001), but only a marginal gain in model calibration (P value of the Hosmer-Lemeshow calibration statistics comparing observed and predicted risk in decile categories of predicted risk: and 0.616). Finally, consideration of soluble RANKL resulted in a more accurate classification of subjects. A total of nine of the 78 subjects with incident T2DM were correctly reclassified from <2.50, and % categories to the 10.0% category, whereas only three were erroneously down-graded from the high to low-to-medium risk groups. The net reclassification improvement for subjects who developed T2DM or remained free of T2DM was 6.4% and 2.5%, respectively, yielding a global NRI of 9.0% (P = 0.083). ROCs for an analysis restricted to individuals with fasting glucose concentrations equal to or greater than 100 mg dl 1 again indicated that the model including RANKL provides a better fit (AUC [ ] versus [ ], ΔAUC [ ] P = ). The global NRI in this group was 20.2% (P = ). A total of 71 of the 78 incident cases of diabetes occurred in this subgroup. Measurement of soluble RANKL in previous studies While OPG measurement in numerous studies yielded largely comparable serum concentrations and consistent association with risk factors, diabetes and cardiovascular disease, the same was not true for soluble RANKL. Median concentrations of free soluble RANKL in samples of the general community varied from around 0.05 pmol L 1 (Framingham or Tromso) to more than 8 pmol L 1 (EPIC controls, 8.43) 5 9 [for transformation of pg to pmol a molecular weight of 35 kda for soluble RANKL was assumed]. The proportions of individuals with no RANKL detectable ranged from 0% to more than 60%. Reasons for these discrepant findings and distinct association patterns are not entirely clear, but several issues may be of relevance. (a) Concentrations of free soluble RANKL were shown to be unaffected by sample storage of up to ten years when blood specimens were immediately frozen, stored at 80 ºC
4 4 and assayed shortly after thawing (no thawing and re-freezing cycle). However, less stringent storage conditions have been proposed to substantially affect RANKL concentrations. 10 Quality of blood specimens may account in part for the discrepancy observed. (b) Two groups of assays measure either free (biologically active) soluble RANKL or total soluble RANKL, i.e. also the larger amount of RANKL complexed to OPG. There is no doubt that these parameters have a distinct meaning. Not all manufacturers provide detailed information in this regard. Moreover, not all assays were licensed for human application (mouse assay). (c) The various assays used in previous studies differed substantially in their lower detection limit. Problems with the detection limit have recently been resolved by the development of new generation assays like the one applied in the current evaluation (Biomedica; lower detection limit 0.08 pmol L 1 ). 10 (d) Sources and clearance of soluble RANKL may be subject to change. Owing to a lack of associations between soluble RANKL concentration and bone mineral density as well as genetic polymorphisms linked to bone mineral density, the skeletal system is unlikely to be a major source.
5 5 Supplementary Table 1: Baseline characteristics in the Bruneck study population according to tertile groups of soluble RANKL (n = 844). Characteristic a Tertile group for RANKL (pmol L 1 ) Low Medium High [ ] [ ] [ ] P value b Age, years 58.9± ± ± Male sex, n (%) 147 (52.1) 141 (51.6) 137 (47.4) Social status, n (%) Low 189 (67.0) 163 (59.7) 165 (57.1) Middle 51 (18.1) 62 (22.7) 69 (23.9) High 42 (14.9) 48 (17.6) 55 (19.0) Alcohol consumption, n (%) g d (75.2) 206 (75.5) 240 (83.0) > 50 g d 1 70 (24.8) 67 (24.5) 49 (17.0) Cigarette smoking, n (%) 88 (31.2) 59 (21.6) 63 (21.8) Physical activity, score 4.22± ± ± T2DM family history, n (%) 82 (29.1) 78 (28.6) 88 (30.4) Body mass index, kg m ± ± ± Waist-to-hip ratio, cm cm ± ± ± HbA1c, % 5.45± ± ± Fasting glucose, mg dl ± ± ± h glucose, mg dl 1 c 93 [75 118] 93 [76 114] 91 [75 112] High-sensitivity CRP, mg L 1 c 1.2 [ ] 1.3 [ ] 1.1 [ ] Osteoprotegerin, pmol L ± ± ± T2DM, type two diabetes; CRP, C-reactive protein; RANKL, receptor activator of NF-κB. a Values presented are means ± standard deviation or numbers (percentages). b P values for difference in variable levels between individuals with and without incident T2DM were calculated with logistic regression analysis or general linear models with adjustment for age and sex. c Variables with a skewed distribution were log e -transformed for statistical analysis.
6 6 Supplementary Table 2: Baseline characteristics in the total study population (left column) and in participants with and without incident T2DM ( ). Characteristic a Total (n = 844) Incident T2DM No (n = 766) Yes (n = 78) P Value b Age, years 58.1± ± ± Male sex, n (%) 425 (50.4) 386 (50.4) 39 (50.0) Social status, n (%) Low 517 (61.3) 459 (59.9) 58 (74.4) Middle 182 (21.6) 172 (22.5) 10 (12.8) High 145 (17.2) 135 (17.6) 10 (12.8) Alcohol consumption, n (%) g d (78.0) 602 (78.6) 56 (71.8) > 50 g d (22.0) 164 (21.4) 22 (28.2) Cigarette smoking, n (%) 210 (24.9) 192 (25.1) 18 (23.1) Physical activity, score 4.36± ± ± T2DM family history, n (%) 248 (29.4) 224 (29.2) 24 (30.8) Body mass index, kg m ± ± ±4.5 <0.001 Waist-to-hip ratio, cm cm ± ± ± HbA1c, % 5.41± ± ±0.44 <0.001 Fasting glucose, mg dl ± ± ±10.1 < h glucose, mg dl 1 c 92 [75 114] 90 [73 110] 127 [ ] < ± ± ±52.5 High-sensitivity CRP, mg L 1 c 1.2 [ ] 1.2 [ ] 2.0 [ ] < ± ± ±8.95 Soluble RANKL, pmol L 1 c 1.1 [ ] 1.0 [ ] 1.1 [ ] < ± ± ±2.25 Osteoprotegerin, pmol L ± ± ± T2DM, type two diabetes; CRP, C-reactive protein; RANKL, receptor activator of NF-κB. a Values presented are means ± standard deviation or numbers (percentages). For variables with a skewed distribution both medians [inter-quartile range] and means ± standard deviation are shown to enable comparisons with previous studies. b P values for difference in variable levels between individuals with and without incident T2DM were calculated with Chi- Square or Fisher s exact test or with independent-samples T test. c Variables with a skewed distribution were log e -transformed for statistical analysis.
7 7 Supplementary Table 3: Association of soluble RANKL concentration with T2DM in various subgroups (Bruneck Study, ). OR (95%CI) for a one Subgroup n of cases Person -years Incidence rate (95%CI) s.d. unit higher RANKL concentration P value for interaction Sex Male ( ) 1.95 ( ) Female ( ) 1.87 ( ) Age <60 years ( ) 1.69 ( ) years ( ) 2.00 ( ) Social class Low ( ) 1.79 ( ) High ( ) 2.14 ( ) Body mass index <25 kg m ( ) 1.50 ( ) kg m ( ) 2.08 ( ) Smoking status Current smoker ( ) 1.82 ( ) Never/ex-smoker ( ) 1.85 ( ) Waist hip ratio < ( ) 1.72 ( ) ( ) 1.94 ( ) Physical activity Low (score 4) ( ) 1.74 ( ) High (score >4) ( ) 2.26 ( ) Alcohol consumption No/low alcohol ( ) 1.77 ( ) Modest/high alcohol ( ) 2.25 ( ) Fasting glucose <100 mg dl ( ) 1.56 ( ) mg dl ( ) 1.91 ( ) C-reactive protein <3 mg L ( ) 1.87 ( ) mg L ( ) 2.06 ( ) Time period ( ) 1.85 ( ) ( ) 1.63 ( ) ( ) 2.30 ( ) Odds ratios and 95% confidence intervals (95%CI) derived from pooled logistic regression analysis and calculated for a one s.d. unit higher concentration of loge-transformed soluble RANKL. Analyses were adjusted for age, sex, period of follow-up, social status, cigarette smoking, alcohol consumption, physical activity, family history for diabetes, body mass index and waist-to-hip ratio.
8 8 Supplementary Table 4: Association between baseline concentrations of markers of inflammation, endothelial activation, bone metabolism and T2DM risk in the Bruneck Study (n = 844, ). Characteristic a No (n = 766) Incident T2DM Yes (n = 78) Logistic regression Models b Odds ratio (95%CI) P Value c C-reactive protein, mg L [ ] 2.0 [ ] 1.36 ( ) Fibrinogen, mg dl [ ] 265 [ ] 1.05 ( ) IL-6, pg ml [ ] 4.0 [ ] 1.17 ( ) sicam-1, ng ml [ ] 350 [ ] 1.52 ( ) c svcam-1, ng ml [ ] 678 [ ] 1.28 ( ) E-selectin, ng ml [ ] 56.2 [ ] 1.25 ( ) P-selectin, ng ml [ ] 204 [ ] 1.33 ( ) MMP-9, ng ml [ ] 305 [ ] 1.32 ( ) TIMP-1, ng ml [ ] 189 [ ] 0.99 ( ) MCP-1, pg ml [ ] 219 [ ] 1.00 ( ) Adiponectin, μg ml [ ] 9.9 [ ] 0.71 ( ) Hydroxyvitamin D, ng ml [ ] 29.3 [ ] 1.03 ( ) Osteocalcin, ng ml [ ] 23.1 [ ] 0.80 ( ) Soluble RANKL, pmol L [ ] 1.1 [ ] 1.58 ( ) c sicam-1 and svcam-1, soluble intracellular and vascular adhesion molecule-1, MMP-9, metalloproteinase-9; TIMP-1, tissue inhibitor of metalloproteinase-1; MCP-1, monocyte chemoattractant protein-1; RANKL, receptor activator of nuclear factor κb ligand. a Values presented are medians [inter-quartile range]. b Odds ratios (95%CI) and P values were derived from logistic regression analysis adjusted for age, sex, social status, cigarette smoking, alcohol consumption, physical activity, family history of diabetes, body mass index and waist-to-hip ratio. To facilitate a comparison between the various risk predictors all odds ratios were calculated for a one s.d. unit increase in log e - transformed variable levels. A one s.d. unit decrease in adiponectin concentration resulted in an odds ratio [95%CI] of 1.41 [ ]. All analyses consider baseline variable levels (instead of updated variable levels as in Table 2) because most of these variables were determined only once in c These variables are significant when controlling for the multiple comparisons performed (Bonferroni-corrected threshold for significance < ).
9 9 Supplementary Table 5: Risk for T2DM according to concentration of osteoprotegerin in the Bruneck Study. Tertile group for osteoprotegerin a Low Medium High Osteoprotegerin (pmol L 1 ) Median Range Incident T2DM No. of events Person-years of follow-up 4, , ,964.3 Incidence rate per 1,000 person 5.4 [ ] 7.1 [ ] 9.8 [ ] years [95%CI]) Pooled logistic regression (n = 2,278) b Odds ratio (95%CI) P for trend Odds ratio (95%CI) for a one s.d. unit higher OPG concentration P value Adjusted for age, sex and period ( ) 1.26( ) ( ) Multivariate adjustment (model 1) c ( ) 1.31( ) ( ) Multivariate adjustment (model 2) c ( ) 1.31( ) ( ) Multivariate adjustment (model 3) c ( ) 1.32( ) ( ) Extended Follow-up (n = 2,852) d Adjusted for age, sex and period ( ) 1.06( ) ( ) Multivariate adjustment (model 1) c ( ) 1.08( ) ( ) Multivariate adjustment (model 2) c ( ) 1.09( ) ( ) Multivariate adjustment (model 3) c ( ) 1.08( ) ( ) T2DM, type II diabetes ascertained according to American Diabetes Association criteria; CI, confidence interval, OPG, osteoprotegerin. a Categorization of OPG tertile group was based on the entire study population (n = 909). Seeming differences in the incidence rates across tertile groups for OPG are due to an uneven age distribution in these groups and disappear after adjustment for age.
10 10 b Odds ratios (95%CI) were derived from pooled logistic regression analysis and calculated for a one s.d. unit higher OPG concentration (right-hand columns) and in separate models for OPG tertile groups (left-hand columns). The bottom tertile group served as the reference category. Base models were adjusted for age, sex and period of follow-up ( , , ). Odds ratios reflect the risk for new-onset T2DM in a 5-year period. All covariates were up-dated every five years. c Analysis was further adjusted for social status, cigarette smoking, alcohol consumption, physical activity, and family history of diabetes (model 1), plus body mass index and waist-to-hip ratio (model 2), plus fasting glucose and log e -transformed concentration of high-sensitivity C-reactive protein (model 3), plus common types of medication (statins, ß-blockers, diuretics, calcium channel blockers, angiotensin-converting enzyme and angiotensin receptor inhibitors, corticosteroids, digitalis drugs, platelet inhibitors, oral anticoagulation and hormone replacement therapy, each considered a separate variable) (model 4). d These analyses focused on the extended follow-up between 1990 and 2010 (n = 2,852 observation periods) and considered 100 cases of incident T2DM. Because OPG concentration was not measured in 2005 blood samples, OPG concentration assessed in 2000 samples was used to predict T2DM risk in both the and the follow-up period.
11 11 Reference List 1. DeLong,E.R., DeLong,D.M., & Clarke-Pearson,D.L. Comparing the areas under two or more correlated receiver operating characteristic curves: a nonparametric approach. Biometrics 44, (1988). 2. Hanley,J.A. & McNeil,B.J. A method of comparing the areas under receiver operating characteristic curves derived from the same cases. Radiology 148, (1983). 3. Hosmer,D.W. & Lemeshow,S. Applied logistic regression(john Wiley, New York, 1989). 4. Pencina,M.J., D'Agostino,R.B., Sr., D'Agostino,R.B., Jr., & Vasan,R.S. Evaluating the added predictive ability of a new marker: from area under the ROC curve to reclassification and beyond. Stat. Med. 27, (2008). 5. Kiechl,S. et al. Soluble receptor activator of nuclear factor-kappa B ligand and risk for cardiovascular disease. Circulation 116, (2007). 6. Schett,G. et al. Soluble RANKL and risk of nontraumatic fracture. JAMA 291, (2004). 7. Lieb,W. et al. Biomarkers of the Osteoprotegerin Pathway. Clinical Correlates, Subclinical Disease, Incident Cardiovascular Disease, and Mortality. Arterioscler. Thromb. Vasc. Biol.(2010). 8. Semb,A.G. et al. Osteoprotegerin and soluble receptor activator of nuclear factor-kappab ligand and risk for coronary events: a nested case-control approach in the prospective EPIC- Norfolk population study Arterioscler. Thromb. Vasc. Biol. 29, (2009). 9. Jorgensen,L. et al. Bone loss in relation to serum levels of osteoprotegerin and nuclear factorkappab ligand: the Tromso Study. Osteoporos. Int. 21, (2010). 10. Rogers,A. & Eastell,R. Circulating osteoprotegerin and receptor activator for nuclear factor kappab ligand: clinical utility in metabolic bone disease assessment. J. Clin. Endocrinol. Metab 90, (2005).
12 a Osteoprotegerin [pmol L 1 ] > < Number of participants Males Females RANKL [pmol L 1 ] < Number of participants b Osteoprotegerin level [pmol L 1 ] prior to T2D manifestation ** ** Osteoprotegerin level [pmol L 1 ] after T2D manifestation Soluble RANKL level [pmol L 1 ] prior to T2D manifestation * * Soluble RANKL level [pmol L 1 ] after T2D manifestation Supplementary Figure 1 (a) Distribution of serum concentration of soluble RANKL and osteoprotegerin in Bruneck Study 1990 (n = 844). (b) Serum concentrations of OPG and soluble RANKL before and after T2DM manifestation. The dotted grey lines show individual changes and the solid red lines show mean changes of OPG and soluble RANKL in 61 patients with incident T2DM and two or more available measurements of OPG and RANKL ( ). The solid green lines represent mean changes in subjects who remained free of T2DM. * P < 0.05, ** P < 0.01 compared to baseline levels (change with manifestation of T2DM) calculated using the paired T test. * P < 0.05, ** P < 0.01 for a comparison of changes in OPG and RANKL concentration between the two groups of subjects with and without incident T2DM (general linear models adjusted for age and sex and allowing for repeated measurements).
13 a d g b c e f Supplementary Figure 2 Generation of Rank shrna (RANKi) vectors and bockade of Rank expression by RANKi. (a) Plasmid maps of the plko.1 control vector (CTRLi) (non-target shrna) and the plko.1 RANKi 1 vector. (b) Tested shrna binding sites in mouse Rank [TNFRSF11A] (NM009399). (c) List of the target site and target sequence of the seven RANKi 1 vectors as well as CTRLi vectors. Vectors in red were used in the in vivo experiments. (d) Ponceau S staining of nitrocellulose membranes after Western transfer showing total protein content of HEK293 cells transfected with the pcdna3 mrank 3xFLAG expression vector, an EGFP fusion protein expression vector for normalization of transfection efficiency as well as seven different RANKi or CTRLi vectors. (e) Western blot showing FLAG staining of HEK293 cells transfected with pcdna3 mrank 3xFLAG expression vector, an EGFP fusion protein expression vector for normalization of transfection efficiency as well as seven different RANKi versus CTRLi vectors. Red arrows mark RANKi vectors with prominent downregulation of RANK expression selected for the in vivo experiments. (f) Western blot showing Enhanced Green Fluorescent Protein (EGFP) staining of HEK293 cells transfected with pcdna3 mrank 3xFLAG expression vector, an EGFP fusion protein expression vector for normalization of transfection efficiency and seven different RANKi and CTRLi vectors. (g Plasmid map of the Rank expression vector used for transfection of HEK293 cells.
14 Supplementary Figure 3 Specific blockade of hepatic Rank expression. (a) Real-time PCR analysis for Rank, RANKL, and Opg mrna expression in the liver of mice fed with high-fat diet (HFD) and treated with CTRLi versus RANKi by hydrodynamic injection. Data presented are means + s.e.m. (n = 5). *** P < compared to control calculated using the Mann Whitney U test. (b) Western blot of liver, adipose and muscle tissue for expression of Rank, RANKL and Opg in mice fed a HFD and treated with CTRLi versus RANKi by hydrodynamic injection. Data from three representative mice per group are shown. (c) Western blot of liver, adipose and muscle tissue for expression of Rank in control rank WT and rank LKO mice. Data from three representative mice per group are shown.
15 Supplementary Figure 4 Effects of Rank inhibition on glucose tolerance in obese (ob/ob) mice. (a) Fasting glucose concentration, insulin concentration, and insulin resistance as estimated by HOMA-IR in 10- and 14-week-old control rank WT ob/ob (bars in white) versus littermate rank LKO ob/ob mice (bars in black) (n = 5 per group). (b) Fasting glucose concentration, insulin concentration, and insulin resistance as estimated by HOMA-IR in 8-week-old ob/ob mice (week 0) and after 4 weeks of treatment with CTRLi vector (bars in white) versus RANKi vector (bars in black) (n = 6 per group). (c) Fasting glucose concentration, insulin concentration, and insulin resistance as estimated by HOMA-IR in 8-week-old ob/ob mice (week 0) and after 6 weeks of treatment with PBS (bars in white) versus osteoprotegerin (OPG) (bars in black) (n = 8 per group). Data presented are means + s.e.m. * P < 0.05, ** P < 0.01 compared to control calculated using the Mann Whitney U test.
16 a b c Supplementary Figure 5 Hepatic triglyceride and cholesterol content and effect of RANKL stimulation on the expression of NF- B-inducible cytokines in hepatocytes. (a) Liver triglyceride (upper graph) and cholesterol content (lower graph) of 8- week-old control rank WT (bars in white) versus littermate rank LKO mice (bars in black) at baseline and after 4 weeks of normal-fat diet (NFD) or HFD (n = 5 per group). Data presented are means. Error bars indicate s.e.m. * P < 0.05 compared to control calculated using the Mann Whitney U test. (b) Real time PCR analysis of tumor necrosis factor alpha (TNF-α), interleukin(il)-1, and chemokine (C-X-C motif) ligand 1 (CXCL1) mrna expression in cultured mouse hepatocytes exposed to PBS versus 50 ng ml 1 mouse RANKL (n = 3 for all groups). Data presented are fold increases to baseline (means + s.e.m.) elicited by RANKL stimulation. Measurements were performed 1, 3 and 12 h after stimulation. (c) Real time PCR analysis of TNF-α, IL-1, and CXCL1 mrna expression in cultured mouse hepatocytes exposed to PBS versus 50 ng ml 1 mouse RANKL with or without IκB-kinase(IKK)ß inhibitor AS (10 μg ml 1 ) (n = 3 for all groups). Data presented are fold increases to baseline (means + s.e.m.) elicited by RANKL stimulation. Measurements were performed 1 and 3 h after stimulation. * P < 0.05, ** P < 0.01 compared to control calculated using the Mann Whitney U test.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More information300 Biomed Environ Sci, 2018; 31(4):
300 Biomed Environ Sci, 2018; 31(4): 300-305 Letter to the Editor Combined Influence of Insulin Resistance and Inflammatory Biomarkers on Type 2 Diabetes: A Population-based Prospective Cohort Study of
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationTypes of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline
INTRODUCTION TO BIOSTATISTICS FOR GRADUATE AND MEDICAL STUDENTS Files for today (June 27) Lecture and Homework Descriptive Statistics and Graphically Visualizing Data Lecture #2 (1 file) PPT presentation
More informationORIGINAL INVESTIGATION. C-Reactive Protein Concentration and Incident Hypertension in Young Adults
ORIGINAL INVESTIGATION C-Reactive Protein Concentration and Incident Hypertension in Young Adults The CARDIA Study Susan G. Lakoski, MD, MS; David M. Herrington, MD, MHS; David M. Siscovick, MD, MPH; Stephen
More informationElevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with
Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti
More informationHypoinsulinemia is strongly associated with coronary artery calcification (CAC) assessed by multislice computed tomography
Hypoinsulinemia is strongly associated with coronary artery calcification (CAC) assessed by multislice computed tomography Yohei Oda 1, Muhei Tanaka 2, Michiaki Fukui 2, Sei Tsunoda 1, Satoshi Akabame
More informationSupplemental Material
Supplemental Material Supplemental Results The baseline patient characteristics for all subgroups analyzed are shown in Table S1. Tables S2-S6 demonstrate the association between ECG metrics and cardiovascular
More information1 Introduction. st0020. The Stata Journal (2002) 2, Number 3, pp
The Stata Journal (22) 2, Number 3, pp. 28 289 Comparative assessment of three common algorithms for estimating the variance of the area under the nonparametric receiver operating characteristic curve
More informationBasic Biostatistics. Chapter 1. Content
Chapter 1 Basic Biostatistics Jamalludin Ab Rahman MD MPH Department of Community Medicine Kulliyyah of Medicine Content 2 Basic premises variables, level of measurements, probability distribution Descriptive
More informationNew therapeutic targets for T2DM
New therapeutic targets for T2DM Targeting inflammation: NF- B, salsalate Gwanpyo Koh Department of Internal Medicine Jeju National University School of Medicine Introduction Obesity is occurring at epidemic
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationLEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME
LEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME Diana A. Chirinos, Ronald Goldberg, Elias Querales-Mago, Miriam Gutt, Judith R. McCalla, Marc Gellman and Neil Schneiderman
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationCt=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationSupplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationTable S1. Characteristics associated with frequency of nut consumption (full entire sample; Nn=4,416).
Table S1. Characteristics associated with frequency of nut (full entire sample; Nn=4,416). Daily nut Nn= 212 Weekly nut Nn= 487 Monthly nut Nn= 1,276 Infrequent or never nut Nn= 2,441 Sex; n (%) men 52
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationCentral pressures and prediction of cardiovascular events in erectile dysfunction patients
Central pressures and prediction of cardiovascular events in erectile dysfunction patients N. Ioakeimidis, K. Rokkas, A. Angelis, Z. Kratiras, M. Abdelrasoul, C. Georgakopoulos, D. Terentes-Printzios,
More informationDiscrimination and Reclassification in Statistics and Study Design AACC/ASN 30 th Beckman Conference
Discrimination and Reclassification in Statistics and Study Design AACC/ASN 30 th Beckman Conference Michael J. Pencina, PhD Duke Clinical Research Institute Duke University Department of Biostatistics
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationTable S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group
Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,
More informationSoluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David
More informationLearning Objectives 9/9/2013. Hypothesis Testing. Conflicts of Interest. Descriptive statistics: Numerical methods Measures of Central Tendency
Conflicts of Interest I have no conflict of interest to disclose Biostatistics Kevin M. Sowinski, Pharm.D., FCCP Last-Chance Ambulatory Care Webinar Thursday, September 5, 2013 Learning Objectives For
More information9/4/2013. Decision Errors. Hypothesis Testing. Conflicts of Interest. Descriptive statistics: Numerical methods Measures of Central Tendency
Conflicts of Interest I have no conflict of interest to disclose Biostatistics Kevin M. Sowinski, Pharm.D., FCCP Pharmacotherapy Webinar Review Course Tuesday, September 3, 2013 Descriptive statistics:
More informationHigh-sensitivity Troponin T Predicts Recurrent Cardiovascular Events in Patients with Stable Coronary Heart Disease: KAROLA Study 8 Year FU
ESC Congress 2011 Paris, France, August 27-31 KAROLA Session: Prevention: Are biomarkers worth their money? Abstract # 84698 High-sensitivity Troponin T Predicts Recurrent Cardiovascular Events in Patients
More informationegfr > 50 (n = 13,916)
Saxagliptin and Cardiovascular Risk in Patients with Type 2 Diabetes Mellitus and Moderate or Severe Renal Impairment: Observations from the SAVOR-TIMI 53 Trial Supplementary Table 1. Characteristics according
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested
More informationAutonomic nervous system, inflammation and preclinical carotid atherosclerosis in depressed subjects with coronary risk factors
Autonomic nervous system, inflammation and preclinical carotid atherosclerosis in depressed subjects with coronary risk factors Carmine Pizzi 1 ; Lamberto Manzoli 2, Stefano Mancini 3 ; Gigliola Bedetti
More informationGenetic risk prediction for CHD: will we ever get there or are we already there?
Genetic risk prediction for CHD: will we ever get there or are we already there? Themistocles (Tim) Assimes, MD PhD Assistant Professor of Medicine Stanford University School of Medicine WHI Investigators
More informationSupplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC
Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT
More informationBiostatistics and Epidemiology Step 1 Sample Questions Set 2. Diagnostic and Screening Tests
Biostatistics and Epidemiology Step 1 Sample Questions Set 2 Diagnostic and Screening Tests 1. A rare disorder of amino acid metabolism causes severe mental retardation if left untreated. If the disease
More informationSupplementary Material 1. Statistical methods used to conduct power calculations.
Supplementary Material 1. Statistical methods used to conduct power calculations. Post-hoc power calculations and patient numbers needed to detect changes were conducted considering (i) the observed partial
More informationSupplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
More informationSupplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms
Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms QQ QR/RR n = 36 n = 80 Men (%) 20 (55) 54 (67) 0.216 Age (years) 57 ± 10 56 ±
More informationSummary HTA. HTA-Report Summary
Summary HTA HTA-Report Summary Prognostic value, clinical effectiveness and cost-effectiveness of high sensitivity C-reactive protein as a marker in primary prevention of major cardiac events Schnell-Inderst
More information5g vs. control, contrast. 10g vs. control, contrast. -3.6e-15 ± 4.3
Supplementary Materials: A Double-Blind, Randomized Controlled, Acute Feeding Equivalence Trial of Small, Catalytic Doses of Fructose and Allulose on Postprandial Blood Glucose Metabolism in Healthy Participants:
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More information902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationAcarbose Decreases the Rheumatoid Arthritis Risk of Diabetic Patients and. Attenuates the Incidence and Severity of Collagen-induced Arthritis in Mice
Acarbose Decreases the Rheumatoid Arthritis Risk of Diabetic Patients and Attenuates the Incidence and Severity of Collagen-induced Arthritis in Mice Authors: Chi-Chen Lin, Der-Yuan Chen, Ya-Hsuan Chao,
More information(n=6279). Continuous variables are reported as mean with 95% confidence interval and T1 T2 T3. Number of subjects
Table 1. Distribution of baseline characteristics across tertiles of OPG adjusted for age and sex (n=6279). Continuous variables are reported as mean with 95% confidence interval and categorical values
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationPlasma concentrations of afamin are associated with the metabolic syndrome and related diseases
Plasma concentrations of afamin are associated with the metabolic syndrome and related diseases Hans Dieplinger Division of Genetic Epidemiology Medical University of Innsbruck, Austria 6 th Munich Biomarker
More informationBariatric Surgery versus Intensive Medical Therapy for Diabetes 3-Year Outcomes
The new england journal of medicine original article Bariatric Surgery versus Intensive Medical for Diabetes 3-Year Outcomes Philip R. Schauer, M.D., Deepak L. Bhatt, M.D., M.P.H., John P. Kirwan, Ph.D.,
More informationSupplementary Material
Supplementary Material Identification of mir-187 and mir-182 as biomarkers for early diagnosis and prognosis in prostate cancer patients treated with radical prostatectomy Irene Casanova-Salas 1, José
More informationSTATISTICS AND RESEARCH DESIGN
Statistics 1 STATISTICS AND RESEARCH DESIGN These are subjects that are frequently confused. Both subjects often evoke student anxiety and avoidance. To further complicate matters, both areas appear have
More informationSupplementary Material to Manuscript SREP A
Supplementary Material to Manuscript SREP-15-29162A Monocyte-induced recovery of inflammation-associated hepatocellular dysfunction in a biochip-based human liver model Authors: Marko Gröger a,f,1, Knut
More informationIschemic Heart and Cerebrovascular Disease. Harold E. Lebovitz, MD, FACE Kathmandu November 2010
Ischemic Heart and Cerebrovascular Disease Harold E. Lebovitz, MD, FACE Kathmandu November 2010 Relationships Between Diabetes and Ischemic Heart Disease Risk of Cardiovascular Disease in Different Categories
More informationSystematic reviews of prognostic studies 3 meta-analytical approaches in systematic reviews of prognostic studies
Systematic reviews of prognostic studies 3 meta-analytical approaches in systematic reviews of prognostic studies Thomas PA Debray, Karel GM Moons for the Cochrane Prognosis Review Methods Group Conflict
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationMetabolic Syndrome. Antibodies and antigens
Metabolic Syndrome Antibodies and antigens HYTEST METABOLIC SYNDROME Introduction Metabolic syndrome is a cluster of conditions that increases the likelihood of cardiovascular heart diseases and diabetes.
More informationGALECTIN-3 PREDICTS LONG TERM CARDIOVASCULAR DEATH IN HIGH-RISK CORONARY ARTERY DISEASE PATIENTS
GALECTIN-3 PREDICTS LONG TERM CARDIOVASCULAR DEATH IN HIGH-RISK CORONARY ARTERY DISEASE PATIENTS Table of Contents List of authors pag 2 Supplemental figure I pag 3 Supplemental figure II pag 4 Supplemental
More informationSupplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
More informationSubclinical atherosclerosis in CVD: Risk stratification & management Raul Santos, MD
Subclinical atherosclerosis in CVD: Risk stratification & management Raul Santos, MD Sao Paulo Medical School Sao Paolo, Brazil Subclinical atherosclerosis in CVD risk: Stratification & management Prof.
More informationPROGNOSTIC VALUE OF OSTEOPROTEGERIN IN CHRONIC HEART FAILURE: THE GISSI-HF TRIAL
PROGNOSTIC VALUE OF OSTEOPROTEGERIN IN CHRONIC HEART FAILURE: THE GISSI-HF TRIAL Ragnhild Røysland MD 1,2, Serge Masson PhD 3, Torbjørn Omland MD, PhD, MPH 1,2, Valentina Milani MS 3, Mette Bjerre PhD
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationDOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Bidirectional optogenetic modulation of the tonic activity of CEA PKCδ + neurons in vitro. a, Top, Cell-attached voltage recording illustrating the blue light-induced increase in
More informationStatistical analysis plan
Statistical analysis plan Prepared and approved for the BIOMArCS 2 glucose trial by Prof. Dr. Eric Boersma Dr. Victor Umans Dr. Jan Hein Cornel Maarten de Mulder Statistical analysis plan - BIOMArCS 2
More informationCardiovascular risk assessment in the metabolic syndrome: results from the Prospective Cardiovascular Munster (PROCAM) Study
(28) 32, S11 S16 & 28 Nature Publishing Group All rights reserved 37-6/8 $3. www.nature.com/ijo ORIGINAL ARTICLE Cardiovascular risk assessment in the metabolic syndrome: results from the Prospective Cardiovascular
More informationResearch Article A Single 60 mg Dose of Denosumab Might Improve Hepatic Insulin Sensitivity in Postmenopausal Nondiabetic Severe Osteoporotic Women
International Endocrinology Volume 2015, Article ID 352858, 5 pages http://dx.doi.org/10.1155/2015/352858 Research Article A Single 60 mg Dose of Denosumab Might Improve Hepatic Insulin Sensitivity in
More informationHealth benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study
Title of Study: Health benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study Principal Investigator: Dr. Edralin A. Lucas Nutritional Sciences
More informationStatistics as a Tool. A set of tools for collecting, organizing, presenting and analyzing numerical facts or observations.
Statistics as a Tool A set of tools for collecting, organizing, presenting and analyzing numerical facts or observations. Descriptive Statistics Numerical facts or observations that are organized describe
More informationResearch Article Comparison of Different Anthropometric Measurements and Inflammatory Biomarkers
International Inflammation Volume 2012, Article ID 124693, 5 pages doi:10.1155/2012/124693 Research Article Comparison of Different Anthropometric Measurements and Inflammatory Biomarkers Yaron Arbel,
More informationT2D risk phenotype after recent GDM. Supplemental Materials and Methods. Methodology of IVGTT/euglycemic hyperinsulinemic clamp
Supplemental Materials and Methods Methodology of IVGTT/euglycemic hyperinsulinemic clamp A combined IVGTT/euglycemic hyperinsulinemic clamp was performed in subgroups of study participants following the
More informationPrimer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Solomon SD, Uno H, Lewis EF, et al. Erythropoietic response
More informationNon alcoholic fatty liver disease and atherosclerosis Raul Santos, MD
Non alcoholic fatty liver disease and atherosclerosis Raul Santos, MD Sao Paulo Medical School Hospital Sao Paulo, Brazil Disclosure Honoraria received for consult and/or speaker : Astra Zeneca, Amgen,
More informationSupplemental tables: Abbreviations:
Supplemental tables: Abbreviations: Osteoprotegerin (OPG), Receptor Activator of Nuclear factor Kappa beta Ligand (RANKL), fibroblast growth factor-23 (FGF-23), C-terminal cross-linked telopeptide of type-i
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationIndependent association between inflammatory markers (C-reactive protein, interleukin-6, and TNF-a) and essential hypertension
(2005) 19, 149 154 & 2005 Nature Publishing Group All rights reserved 0950-9240/05 $30.00 www.nature.com/jhh ORIGINAL ARTICLE Independent association between inflammatory markers (C-reactive protein, interleukin-6,
More informationChanges and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationPsoriasis and the metabolic syndrome
Psoriasis and the metabolic syndrome MD, PhD James G. Krueger 1 Inflammation as a foundation of metabolic dysregulation and cardiovascular disease risk Diseases of systemic immune activation and inflammation,
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationAdvanced IPD meta-analysis methods for observational studies
Advanced IPD meta-analysis methods for observational studies Simon Thompson University of Cambridge, UK Part 4 IBC Victoria, July 2016 1 Outline of talk Usual measures of association (e.g. hazard ratios)
More informationDaniel Boduszek University of Huddersfield
Daniel Boduszek University of Huddersfield d.boduszek@hud.ac.uk Introduction to Logistic Regression SPSS procedure of LR Interpretation of SPSS output Presenting results from LR Logistic regression is
More informationGeneration of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationNovel Markers of Arterial Dysfunction
혈관연구회창립심포지움, 3 월 3 일, 2005 Novel Markers of Arterial Dysfunction Kwang Kon Koh, MD, FACC, FAHA Cardiology Gachon Medical School Incheon, Korea Atherosclerosis: A progressive process PHASE I: Initiation
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationPerson-years; number of study participants (number of cases) HR (95% CI) P for trend
Table S1: Spearman rank correlation coefficients for cumulative factor score means of dietary and nutrient patterns among adults 18 years and above, the China Health and Nutrition Survey by age and sex
More informationetable 3.1: DIABETES Name Objective/Purpose
Appendix 3: Updating CVD risks Cardiovascular disease risks were updated yearly through prediction algorithms that were generated using the longitudinal National Population Health Survey, the Canadian
More informationATHEROSCLEROTIC cardiovascular complications are the leading cause of. Diabetes Mellitus Has an Additional Effect on Coronary Artery Disease
Diabetes Mellitus Has an Additional Effect on Coronary Artery Disease To Decrease Plasma Adiponectin Levels Kuei-Chuan CHAN, 1 MD, Hsi-Hsien CHOU, 1 PhD, Der-Jinn WU, 1 PhD, Yi-Liang WU, 1 MD, and Chien-Ning
More information8/10/2012. Education level and diabetes risk: The EPIC-InterAct study AIM. Background. Case-cohort design. Int J Epidemiol 2012 (in press)
Education level and diabetes risk: The EPIC-InterAct study 50 authors from European countries Int J Epidemiol 2012 (in press) Background Type 2 diabetes mellitus (T2DM) is one of the most common chronic
More informationPART FOUR. Metabolism and Nutrition
PART FOUR Metabolism and Nutrition Advances in Peritoneal Dialysis, Vol. 21, 2005 Maria Mesquita, 1 Eric Wittersheim, 2 Anne Demulder, 2 Max Dratwa, 1 Pierre Bergmann 3 Bone Cytokines and Renal Osteodystrophy
More informationSupplementary Online Content
Supplementary Online Content Willeit K, Pechlaner R, Willeit P, et al. Association between vascular cell adhesion molecule 1 and atrial fibrillation. JAMA Cardiol. Published online March 2, 2017. doi:10.1001/jamacardio.2017.0064
More informationInflammation and and Heart Heart Disease in Women Inflammation and Heart Disease
Inflammation and Heart Disease in Women Inflammation and Heart Disease What is the link between een inflammation and atherosclerotic disease? What is the role of biomarkers in predicting cardiovascular
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationEstablishment of Efficacy of Intervention in those with Metabolic Syndrome. Dr Wendy Russell - ILSI Europe Expert Group
Establishment of Efficacy of Intervention in those with Metabolic Syndrome Dr Wendy Russell - ILSI Europe Expert Group Conflict of interest regarding this presentation: I have no conflict of interest to
More information