An improved simple technique for the collection of blood samples from rats and mice
|
|
- Paula Jennings
- 6 years ago
- Views:
Transcription
1 Laboratory Animals (1988) 22, An improved simple technique for the collection of blood samples from rats and mice G. CONYBEARE, G. B. LESLIE, K. ANGLES, R. J. BARRETT, J. S. H. LUKE & D. R. GASK Department of Toxicology, Smith Kline & French Research Ltd, The Fry the, Welwyn, Herts AL6 9AR, UK Summary The technique of blood collection from the lateral caudal vein has been improved. The method requires only moderate skill and no anaesthesia is necessary. Collection of blood samples causes little trauma and can be repeated at frequent (8 h) intervals thus making the method particularly suitable for pharmacokinetic and hormonal studies. Blood samples are uncontaminated by tissue fluids. Large volumes can be obtained, in mice up to 1 5 ml and in Wistar rats over 4 mi. Keywords: Blood collection; Rat; Lateral tail vein; Venipuncture Methods for intravenous injection and collection of venous blood from rats have been extensively reviewed by Cocchetto and Bjornsson (1983). In toxicology, drug metabolism and pharmacokinetic studies those blood collection methods which require anaesthesia or surgery are often inappropriate because of possible interference with assay methods or with normal phys~ology. Many methods cause considerable trauma and do not lend themselves to frequent repetition or do not permit the collection of large volumes of blood. Some methods require considerable skill or can put the lives of the animals at risk which would be most undesirable in long term toxicity studies. Collection from the dorsal metatarsal vein has been described by Nobunaga, Nakamura and Imamichi (1966). This technique does not require Received 30 July Accepted 23 September anaesthesia and is relatively non-traumatic but it yields only small volumes and the vein can be difficult to locate in pigmented strains. Cardiac puncture has been widely used for collection of large blood samples and variations of the technique have been described by Cubitt and Barrett (1978), Frankenberg (1979) and Waynforth (1969). Performed under anaesthesia with the chest wall opened, cardiac puncture has a useful role in a terminal situation. Performed by needle puncture through the thorax under anaesthesia or in restrained conscious animals cardiac puncture enables large although variable volumes of blood to be taken. It can cause considerable trauma to the animal and deaths are not uncommon even in the hands of very experienced technicians. Repeated sampling endangers the animals to such an extent as to be unacceptable for long term toxicology studies. Blood samples taken by this method are often contaminated by tissue fluids. Most workers find the technique distasteful and acquiring skill could cause unacceptable suffering to the animals. A very commonly used vein for collection of blood is the external jugular. This vein can be cannulated under anaesthesia (Renaud, 1969), but it is possible to take samples by direct venipuncture in the depilated neck of rats. Very large volumes (up to 4 ml) can be taken and repeated sampling is possible. However, considerable skill is required and thrombotic complications can ensue. Perhaps the most widely used method for the collection of large blood samples involves puncture of the ophthalmic venous plexus or retro-orbital sinus (Stone 1954; Sanders 1963; Sorg & Buckner 1964). A siliconized microcapillary glass pipette
2 178 Conybeare, Leslie, Angles, Barrett, Luke & Gask is inserted under light anaesthesia. Large volumes can be taken but some trauma is involved and the procedure" cannot be repeated at frequent intervals. It requires consideral?le skill on the part of the operator who in the UK must hold an appropriate personal lincence under the Animals (Scientific Procedures) Act Training to acquire the skill can cause unacceptable suffering and many workers have ethical objections to the technique. The use of anaesthetics is undesirable for some blood biochemical and hormonal estimations. Tail tip amputation (the 'Farmer's Wife' technique) is easy to perform and requires minimal skill or training. Enta, Lockey and Reed (1968) and Stoltz and Bendall (1975) have recommended this method. Approximately 2 mm are cut off the tail tip, the animals are not endangered and do not appear to suffer, although tail necrosis can occur after frequent sampling. Relatively small volumes of blood can be taken (up to O' 5 ml from Wistar rats) and multiple sampling is limited by the length of the tail. Blood samples are inevitably contaminated by tissue fluids. Variants on this technique include cutting along the lateral caudal vein or artery. In our laboratories, for collection of blood samples in all studies except those involving the administration of compounds intravenously (when we use the lateral caudal vein for administration), we take blood from the lateral caudal vein. The major problem with the use of the laterai caudal vein is to ensure an adequate blood flow. One simple technique is to briefly warm the tail by immersion in a water bath (up to 45 C). This causes a local vasodilatation which permits the use of the caudal vein for intravenous administration but is not very useful for collection of large blood samples because the vasodilatatation is transient and is confined to the tail. Prolonged vasodilatation with increased caudal blood flow can be achieved by use of a heating lamp placed above the rodent cage. This warms the whole environment of the animals. A major disadvantage is the lack of temperature control and the danger of burns due to radiant heat. We have therefore improved the technique of collection from the lateral caudal vein by using a controlled warm environment to produce adequate tail blood flow and vasodilatation. Materials and methods Controlled warm environment By warming the total environment of the rat or mouse to temperatures around 40 C, a large blood flow through the tail is ensured since in these rodents the tail is a major thermoregulatory organ with a large surface available for heat loss. The resulting enhanced blood flow makes it possible to collect blood from the lateral caudal vein easily. The chamber used consists of a double skinned stainless steel washable and autoclavable box with internal dimensions 580mm high, 800 mm wide and 620 mm deep. The doors are made of a transparent acrylic material and fold completely back for easy access. Adjustable shelves allow the chamber to be used for cages in a range of sizes suitable for any species of small laboratory animal. It has the capacity to hold 30 Wistar rats in 6 standard cages of 5 animals or a smaller number of rats singly housed. Alternatively it can hold 12 standard mouse cages each housing 4 or 5 mice. The internal temperature can be maintained at ± I C in the range 33 to 45 C. A temperature of 40 C has been found suitable for most strains of rats or mice. The duration of exposure required for adequate increase in caudal blood flow is around IO to 15min but varies to some extent depending on the size of the animals. Warmed air enters the chamber through vents in the inner lateral walls and leaves through perforations in the ceiling. The electrical equipment and air warming system are in a detachable box mounted on the roof of the chamber and can easily be removed for sterilization with ethylene oxide. The chamber itself can be readily dismantled for cleaning and autoclaving. This makes it suitable for use in long term toxicity studies conducted in barrier facilities. The chamber is now manufactured commercially and is available from Harvard Instruments, Fircroft Way, Edenbridge, Kent, UK.
3 Blood collection from rodents 179 Catheter system and collection technique The use of a conventional hypodermic needle can lead to the formation of small clots due to turbulence in the 'dead space' at the base of the needle. This can be prevented by using heparinized needles but it is undesirable to use heparin for some purposes, e.g. haematology. A system with minimal 'dead space' and a wide bore to render the use of anticoagulants in the collecting catheter unnecessary is therefore used. The 21 gauge Abbott Butterfly set has been found most satisfactory (Abbott Laboratories, Queensborough, Kent, UK) with only 3 mm of the catheter tubing left attached to the needle. After collection of the required sample the Butterfly needle is withdrawn and the blood flow staunched by the application of a piece of tissue paper applied with brief pressure to the bleeding point. Mice are normally restrained in conventional 'tube' holders but for rats we have often found it most convenient to use manual restraint by a second technician who can also use his thumb as a tourniquet and can massage the tail to accelerate bleeding if necessary. We have used this technique during the last 5-6 years. Most of our studies have been in rats of the SK&F Wistar strain although the technique works just as well with larger rats such as the Sprague-Dawley. For mice we have sampled from the SK&F CD I albino strain and a pigmented mouse, the B6C3-F1 hybrid. We have taken blood from rats aged from 3 to 112 weeks and from mice aged 6 to 100 weeks. For routine haematology and clinical chemistry on rat studies samples of 2 ml are taken but samples in excess of 4 ml are possible. We have sampled weekly for up to 12 months and with smaller volumes daily for up to 30 days and for pharmacokinetic studies have taken up to 8 samples per hour. Such frequent repeated sampling has been limited to O 25 ml on each occasion. In mice we have taken weekly samples of 1ml and have also taken smaller volumes daily for 7 days. In no case have we lost an animal or caused serious damage to a tail in over sampling occasions. Experimental comparison of haematological and clinical chemistry parameters In a comparison of a range of clinical pathology parameters 9 female SK&F Wistar rats weighing between 220 and 240 g had 2 ml blood samples collected by three techniques. On the first day after an overnight fast the lateral caudal vein was used. Seven days later a sample was collected under ether anaesthesia from the ophthalmic venous plexus. The anaesthesia depth was then increased and a further terminal sample was taken from the inferior vena cava. Samples of 1ml were taken from each rat on each occasion into ethylene diamine tetra-acetic acid for haematology determinations and 1 ml into heparin for clinical chemistry determinations. The following haematological parameters were measured using the Coulter-Counter (Model S Plus): red blood cell count (RBC); haemoglobin (Hb); haematocrit ratio (HCT); mean corpuscular volume (MCV); mean corpuscular haemoglobin (MCH); mean corpuscular haemoglobin concentration (MCHC); platelet count (PLT); white blood cell count (WBC). The following clinical chemistry parameters were measured using the Hitachi 705 Multichannel Analyser: alanine aminotransferase (ALT); aspartate aminotransferase (AS); alkaline phosphatase (AP); glutamate dehydrogenase (GLDH); total plasma protein (T. prot); albumin (ALB); creatinine (CRE); glucose (Glu). Prolactin assays Prolactin was assayed in rat blood samples collected by three techniques. Groups of 10 male SK&FWistar rats weighing between 250 and 280g were used. A blood sample of I ml was collected form the rats in each group and a serum sample was used for assay. Group 1 had the blood sample collected from the ophthalmic venous plexus under Halothane anaesthesia. In group 2 the sample was collected from the ophthalmic venous plexus under ether anaesthesia and in the third group the sample was collected from the lateral caudal vein of the rats without the use of anaesthetic. Prolactin (PRL) concentrations were measured
4 180 Conybeare, Leslie, Angles, Barrett, Luke & Gask in duplicate 50 Itl aliquot volumes of serum using a double-antibody radioimmunoassay (RIA) system. Specific reagents for rat PRL RIA were supplied by the Pituitary Hormones and Antisera Centre, Harbor-UCLA Medical Centre, Torrance, California, USA. The results are expressed in terms of RP-2 standards. The limit of sensitivity of this assay is 2 0 ng/ml with an inter and intra-assay coefficient of variation for the medium quality control of 7,4 and 12'5070, respectively. Results Haemat%gy Table 1 lists the mean parameters for the blood samples taken by the three collection methods. Blood collected from the ophthalmic venous plexus had slightly lower erythrocyte counts than Table 1. Mean haematology volumes (± SEM) Blood collection RBC technique x /1 Hb (g/dl) HCT (Ratio) MCV (fl) MCH (pg) HCHC (G/dl) WBC (x 10 9 /1) Lateral caudal vein 8 15 ±0'20 16'0±0'3 0'427 ± 0,009 52'4±0'5 19'7±0'2 37'6±0'3 1020± 53 4'3±0'3 Ophthalmic venous plexus 7,66" ± O'l! 15'3 b ±0' ± 0,006 52'8±0'6 19'9±0'2 37'8±0'2 995'±66 4'7±0'5 Interior vena cava 8'09±0'l! 15'0 b ±0' ' ± 0, '± d ±O'2 32'9 d ± ± ±0 2 n = 9 unless otherwise indicated. 'Significantly lower than for vena cava blood (P= <0'05). bsignificantly lower than for caudal vein blood (P= <0'05). 'Significantly higher than for blood from caudal vein or ophthalmic plexus (P= <0'001). dsignificantly lower than for blood from caudal vein or ophthalmic plexus (P= <0'001). 'n=8. All P values are derived from Student's t test. Table 2 Clinical chemistry values (± SEM) Blood ALT AST AP GLDH T. Prot ALB CK BUN CREAT G/u collection (lull) (lull) (lull) (lull) (gil) (gil) (lull) (mmol/l) (mmol/l) (mmol/i) Lateral 64, '1 13'9 72, ' '51 b caudal vein ±6-7 ± 10'2 ±8'6 ±2'1 ±I'I ±0'3 ±66 ±0'35 ±2'9 ±0'16 Ophthalmic 57,8 98,6' 87,3 9, '2 d 300 8,33 67'3',8 8,73 venous plexus ±5'9 ±7'3 ±9'1 ± 1 7 ±0'8 ±0'8 ±62 ±0'33 ± 1-5 ±0-31 Inferior 53,4 90,0' 77,6 13,8 66'4 f vena cava ±4'8 ±3'9 ±5 4 ±2'0 ± 1 3 ±0'5 ±20 ±O-l! ±I-I ±0'32 n = 9 unless otherwise indicated 'Higher than for other two samples (P= <0'05). bhigher than for other two samples (P= <0-05). 'Lower than for caudal vein blood (P= <0-01). dlower than for caudal vein blood and higher than for vena cava blood (P= <0 05 'Lower than for vena cava sample (P= <0'05). flower than for other two samples (P= <0'01). 8n=8 All P values derived by Student's t test. and P= <0'01).
5 Blood collection from rodents E... 0).5.60 c: t5 (ll a ~ o orbit orbit sampling Fig. 1. Mean serum prolactin tail site levels for male rats. blood collected from the vena cava. Blood collected from the caudal vein had a significantly higher haemoglobin level than blood collected by the other two routes. In the blood samples taken from the vena cava the haematocrit, MCV, MCH and MCHC values were significantly different from those taken from the caudal vein or from the ophthalmic venous plexus. These statistically significant differences have not been confirmed in some other comparative haematological evaluations which we have performed. Clinical chemistry These results are shown in Table 2. Slight differences between the different blood samples were seen in this study. Although some of these were statistically significant other comparative studies have shown these variations are not consistent. Prolactin assays The results of these comparisons are shown graphically in Fig. 1. Blood sampled by the tail bleed method shows significantly lower prolactin levels than in blood taken under anaesthesia from the ophthalmic venous plexus. Despite the fact that no anaesthetic was used for the tail bleed sampling this low prolactin level indicates that little stress was caused by the sampling technique. Conclusions The method which we have improved has enabled us to take frequent blood samples of adequate size from rats and mice for hormonal studies, drug metabolism and pharmacokinetic studies and for haematology and clinical chemistry in long term toxicology studies in rats or mice. It causes minimal stress to the animals as shown by the low prolactin values reported here. There is virtually no risk to the animals. The range of clinical pathology values we have found in the study and in many other comparative studies which we have performed are consistently within the normal published range of such values for the rat and the mouse. Acknowledgments We wish to thank numerous colleagues in Pathology and Toxicology at SK&F Research Ltd, Welwyn for their contributions to this work. In particular, Dr C. G. Brown, Miss K. Fowler, Miss J. Moyes, Miss L. Reilly and Miss J. Bone. References Cocchetto DM & Bjornsson TD (1983) Methods for vascular access and collection of body fluids from the laboratory rat. Journal of Pharmaceutical Sciences Cubitt 10K & Barrett CP (1978) A comparison of serum calcium levels by two methods of cardiac puncture. Laboratory Animal Science 28, 347
6 182 Conybeare, Leslie, Angles, Barrett, Luke & Gask Enta T, Lockey SD and Reed CE (1968). A rapid safe technique for repeated blood collection from small laboratory animals: the Farmer's Wife method. Proceedings of the Society for Experimental Biology and Medicine 127, Frankenberg L (1979) Cardiac puncture in the mouse through the anterior thoracic aperture. Laboratory Animals Nobunaga T, Nakamura K & Imamichi T (1966) A method for intravenous injection and collection of blood from rats and mice without restraint and anaesthesia. Laboratory Animal Care 16, Renaud S (1969) Jugular vein technique for blood colleciton and intravenous injection in the rat. Laboratory Animal Care 19, Sanders BJ (1963) The application of the orbital sinus bleeding technic to germ free animals. American Journal of Clinical Pathology 40, Sorg DA & Buckner B (1964) A simple method of obtaining venous blood from small laboratory animals. Proceedings of the Society for Experimental Biology and Medicine 115, Stoltz DR & Bendall RD (1975) A simple technique for repeated collection of blood samples from mice. Laboratory Animal Science 25, Stone SH (1954) Method for obtaining venous blood from the orbital sinus of the rat or mouse. Science, New York 119, 100 Waynforth HB (1969) Animal operative techniques (in the mouse, rat, guinea pig and rabbit). In Techniques in Protein Biosynthesis (eds PN Campbell and JR Sargent), vol. 2. London: Academic Press
Caveat. 1. All procedures performed on animals at UTSA must receive prior IACUC approval, including those described in this guideline.
Laboratory Animal Resources Center Research, Surgical & Training Programs Title: Guidelines for Blood Collection from Mice, Rats & Rabbits Guideline #: 002 Date in Effect: 3/13/2008 Rev #: 01 Rev Date:
More informationStandard Operating Procedure: Blood Collection in Rodents (Revised 10/26/2017)
Standard Operating Procedure: Blood Collection in Rodents (Revised 10/26/2017) These guidelines have been developed to assist investigators and the Howard University Institutional Animal Care and Use Committee
More informationStandard Operating Procedure
1.0 Purpose: 1.1 The glucose tolerance test measures the clearance of an intraperitoneally injected glucose load from the body. Animals are fasted for approximately 16 hours, a solution of glucose is administered
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationClinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
More informationCTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
More informationCardiac Output Technique For Small Animals
Cardiac Output Technique For Small Introduction Cardiac output (CO) is a measure of the quantity of blood pumped by the heart each minute and is the product of stroke volume (ie. volume of blood ejected
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationMODULE 2 THE LABORATORY RAT
University Animal Care Committee LABORATORY ANIMAL BIOMETHODOLOGY WORKSHOP MODULE 2 THE LABORATORY RAT SUBSTANCE ADMINISTRATION AND BLOOD COLLECTION Substance Administration: Subcutaneous injection Intramuscular
More informationSALEM HOSPITAL SALEM, OREGON 97309
SALEM HOSPITAL SALEM, OREGON 97309 Department: Phlebotomy TITLE: BLOOD COLLECTIONS, VENIPUNCTURE Area: Phlebotomy Effective Date: 04/01/96 Authored By: Cindy Humphrey, Diane Duncan Revised: 09/26/2000,
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationBlood Sampling: Venipuncture
Approved by: Blood Sampling: Venipuncture Gail Cameron Senor Director, Operations, Maternal, Neonatal & Child Health Programs Dr. Paul Byrne Medical Director, Neonatology Neonatal Nursery Policy & Procedures
More informationImplanting an Adult Rat with the Single-Channel Epoch Transmitter for Recording Electrocardiogram in the Type II electrode configuration.
Implanting an Adult Rat with the Single-Channel Epoch Transmitter for Recording Electrocardiogram in the Type II electrode configuration. Recommended Surgical Tools A. Scalpel handle B. Scalpel blade (#15)
More informationAqueous lithium heparin is a superior anticoagulant to solid heparin for blood collection from the retro-orbital sinus of rats
272 Laboratory Animals (1991) 25, 272-276 Aqueous lithium heparin is a superior anticoagulant to solid heparin for blood collection from the retro-orbital sinus of rats M. R. SLAUGHTER & J. S. MOEN SmithKline
More informationSources for blood collection
Blood Collection Purpose Hematological investigations Biochemical investigations Serological investigations For culture For transfusion Therapeutic measure in polycythemia Sources for blood collection
More informationclearing activity is produced and destroyed in the rat. Both the
THE SITES AT WHICH PLASMA CLEARING ACTIVITY IS PRODUCED AND DESTROYED IN THE RAT. By G. H. JEFFRIES. From the Sir William Dunn School of Pathology, Oxford. (Received for publication 25th June 1954.) CLEARING
More informationGlossary of terms used in IEEM. Hong Kong College of Emergency Medicine March 2013
Glossary of terms used in IEEM Hong Kong College of Emergency Medicine March 2013 The Hong Kong College of Emergency Medicine IEEM uses several terms in examinations that may cause confusion. The following
More informationPhlebotomy and Basic Blood Analysis
Topic 2: Phlebotomy and Basic Blood Analysis Laboratory Manual Section 09 HPHE 6720 Dr. Cheatham Outline What is phlebotomy Review of Universal Precautions Phlebotomy Techniques Fingerprick Venipuncture
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationThe LaboratoryMatters
Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationYou have a what, inside you?
Costal Emergency Medicine Conference You have a what, inside you? Less than mainstream medical devices encountered in the ED. Eric Ossmann, MD, FACEP Associate Professor Duke University Medical Center
More informationSHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH
IN RATS SUB CHRONIC ORAL TOXICITY WITH NHH 44 Bt-COTTON SEEDS Report for: UNIVERSITY OF AGRICULTURAL SCIENCES AGRICULTURAL RESEARCH STATION DHARWAD-580007 KARNATAKA Guidelines: DBT, Guidelines for Toxicity
More informationYou have a what, inside you?
Costal Emergency Medicine Conference You have a what, inside you? Less than mainstream medical devices encountered in the ED. Eric Ossmann, MD, FACEP Associate Professor Duke University Medical Center
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationIV therapy. By: Susan Mberenga, RN, MSN. Copyright 2016, 2013, 2010, 2006, 2002 by Saunders, an imprint of Elsevier Inc.
IV therapy By: Susan Mberenga, RN, MSN 1 IV Therapy Types of solutions Isotonic Hypotonic Hypertonic Caution: Too rapid or excessive infusion of any IV fluid has the potential to cause serious problems
More informationGlossary of terms used in College examinations. The Royal College of Emergency Medicine
Glossary of terms used in College examinations The Royal College of Emergency Medicine The CEM uses several terms in examinations that may cause confusion. The following definitions are intended as a guide
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationDrawing Blood From the Llama (Venipuncture)
Drawing Blood From the Llama (Venipuncture) Drawing blood (venipuncture) in the llama is more difficult than in common domestic animals. Their wooly fleece impairs visibility when you try to locate the
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationInsertion of a totally implantable vascular access device (TIVAD)
Insertion of a totally implantable vascular access device (TIVAD) What is a TIVAD? A TIVAD is a long hollow tube that is inserted into one of the large veins in your body. One end of the tube sits in a
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationBiochemical alterations induced by the acute exposure to combination of chlorpyrifos and lead in Wistar rats
Biochemical alterations induced by the acute exposure to combination of chlorpyrifos and lead in Wistar rats 1 H Krishna*, 2 AV Ramachandran 1 Dhirubhai Ambani Life Sciences Centre, Reliance Life Sciences
More informationMODULE 2 Substance Administration and Blood Collection in the Laboratory Rat
LABORATORY ANIMAL BIOMETHODOLOGY WORKSHOP MODULE 2 Substance Administration and Blood Collection in the Laboratory Rat Table of Contents 1. GENERAL INFORMATION... 2 2. SUBSTANCE ADMINISTRATION... 3 3.
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationHM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
More informationProduct Catalog 2016 EMEA
Product Catalog EMEA 2016 PORTFOLIO SOL-M Standard medical devices SOL-GUARD Basic safety medical devices SOL-CARE Innovative and advanced safety-engineered medical devices Sol-Millennium Europe Sp. z
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationSTANDARD OPERATING PROCEDURE #403 GUIDELINES FOR BLOOD COLLECTION VOLUMES AND FREQUENCY
STANDARD OPERATING PROCEDURE #403 GUIDELINES FOR BLOOD COLLECTION VOLUMES AND FREQUENCY 1. PURPOSE This Standard Operating Procedure (SOP) describes recommended volumes and frequency for blood collection
More informationNutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China. Testing Report
Ministry Health approved Natural Health Products Testing Agency Issued by: Public Health Inspections, Ministry Health (1996) Publication # 53 Nutrition and Foods Safety Agency the Centre for Disease Prevention
More informationYear(Semester) At a Glance HST II Clinical Laboratory Science Semester Course
Year(Semester) At a Glance HST II Clinical Science Semester Course Three Weeks 1 st 3 weeks 2 nd 3 weeks 3 rd 3 weeks 4 th 3 weeks 5 th 3 weeks 6 th 3 weeks Topics/ Concepts Resource: Our Book Safety OSHA
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationIf viewing a printed copy of this policy, please note it could be expired. Got to to view current policies.
If viewing a printed copy of this policy, please note it could be expired. Got to www.fairview.org/fhipolicies to view current policies. Department Policy Code: D: PC-5555 Entity: Fairview Pharmacy Services
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationLaboratory Accreditation Programmes
Client No. 1609 LABNET Invermay Limited PO Box 371, Mosgiel, 9053 Puddle Alley, RD 2, Mosgiel, 9092 Telephone 03 489-4600 www.gribblesvets.co.nz Fax 03 489-8576 Authorised Representative Ms Denise Carian-Smith
More informationDetermination of hemoglobin concentration of blood
EXPERIMENT II Determination of hemoglobin concentration in blood RBC, WBC & platelet counts Determination of MCV, MCH, MCHC Determination of HCT/PCV Hemolysis & fragility test of RBC Dr. LL Wang Email:
More informationPeel-Apart Percutaneous Introducer Kits for
Bard Access Systems Peel-Apart Percutaneous Introducer Kits for Table of Contents Contents Page Bard Implanted Ports Hickman*, Leonard*, Broviac*, Tenckhoff*, and Groshong* Catheters Introduction....................................
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationVenepuncture and Cannulation. Louise Smith Clinical Nurse Specialist
Venepuncture and Cannulation Louise Smith Clinical Nurse Specialist Outcomes By the end of this session you will be aware of: Basic anatomy Preparation procedures including patient identification Equipment
More informationUniversity of Washington IACUC Approved Policy
These guidelines have been developed to assist investigators and the Institutional Animal Care and Use Committee (IACUC) in their choice and application of rodent bleeding procedures. The guidelines are
More informationProcedures/Risks:central venous catheter
Procedures/Risks:central venous catheter Central Venous Catheter Placement Procedure: Placement of the central venous catheter will take place in the Interventional Radiology Department (IRD) at The Ohio
More informationEvaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
More informationAdvanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
More informationVenous Access and Ports. Helen Starosta
Venous Access and Ports Helen Starosta Venous access and ports Peripheral IV access Arterio-Venous Fistula Central venous access Peripherally Inserted Central Catheter (PICC) Non Tunnelled Central Venous
More informationI. Subject: Ionized Calcium (Ca++) Analysis Whole Blood
I. Subject: Ionized Calcium (Ca++) Analysis Whole Blood II. Method: i-stat III. Principle: A. Ca++: is measured by ion-selective electrode potentiometry. Concentrations are calculated from the measured
More informationEfficacy of the AGRO-JET MIT-II NEEDLE-LESS JET INJECTOR for Iron Dextran Administration in Piglets
Almond, Page 1 Efficacy of the AGRO-JET MIT-II NEEDLE-LESS JET INJECTOR for Iron Dextran Administration in Piglets Final Report to Karim Menassa Medical International Technologies 2281 Guenette St-Laurent,
More informationno concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
More informationWHAT IS YOUR DIAGNOSIS?
WHAT IS YOUR DIAGNOSIS? A 12 year old, female neutered domestic shorthaired cat was presented to the R(D)SVS Feline Clinic with a 6 week history of polydipsia and polyuria, which was not quantified. The
More informationDr. prakruthi Dept. of anaesthesiology, Rrmch, bangalore
CENTRAL VENOUS CATHETERIZATION Dr. prakruthi Dept. of anaesthesiology, Rrmch, bangalore OBJECTIVES Introduction Indications and Contraindications Complications Technique Basic principles Specifics by Site
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationompanionport Speciality Medical Devices For The Veterinary Community Surgical Suggestions
Speciality Medical Devices For The Veterinary Community suture holes Place the CompanionPort in the subcutaneous port pocket off to one side so that the septum of the port will not lie directly beneath
More informationStorage of blood and the mean corpuscular volume
J. clin. Path., 1975, 28, 345-349 Storage of blood and the mean corpuscular volume A. C. K. LAWRENCE, J. M. BEVINGTON, AND M. YOUNG From the Haematology Department, Northern General Hospital, Sheffield
More informationStandard Operating Procedure
1.0 Purpose: 1.1 Relaxation, dissection, weighing and fixation of heart for histological analysis. Changes in heart weight and wall thickness are linked to cardiovascular phenotypes. This protocol describes
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationVeins that are firm to
Intravenous cannulation is a technique in which a cannula is placed inside a vein to provide venous access. Venous access allows sampling of blood as well as administration of fluids, medications, parenteral
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationAustralian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
More informationA Female Van Driver with a Swollen Arm
A Female Van Driver with a Swollen Arm Charles D Forbes,* William F Jackson,** A 28-year-old female van driver presented with a 5 day history of a swollen, painful left arm. The swelling had started shortly
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More informationCoping with Analytical Interferences
Coping with Analytical Interferences (Handling Icteric, Hemolytic and Lipaemic Samples) Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney Surabaya Indonesia 2016 Acknowledgements
More informationCentral venous access devices for children with lysosomal storage disorders
Great Ormond Street Hospital for Children NHS Foundation Trust: Information for Families Central venous access devices for children with lysosomal storage disorders This information explains about central
More informationPREPARATION OF FISTULA NEEDLES TO COMMENCE HAEMODIALYSIS VIA AVF OR GRAFT AND REMOVAL OF NEEDLES AT END OF DIALYSIS SESSION
Nephrology Directorate Lower Lane Fazakerly L9 7AL PREPARATION OF FISTULA NEEDLES TO COMMENCE HAEMODIALYSIS VIA AVF OR GRAFT AND REMOVAL OF NEEDLES AT END OF DIALYSIS SESSION A) PREPARATION Wash hands
More information2. PRESCRIPTION STATUS/RESTRICTION OF SALES TO PHARMACIES ONLY 3. COMPOSITION OF THE MEDICINAL PRODUCT
Title Page Product Information May 2000 1 (6) Product Nephrotect 1. NAME OF THE MEDICINAL PRODUCT Nephrotect 2. PRESCRIPTION STATUS/RESTRICTION OF SALES TO PHARMACIES ONLY For sale in pharmacies only 3.
More information8.2 Principles of Quantitative Hematologic Determinations (1)
3 8. FIELD CENTER HEMATOLOGY SERVICES 8.1 Clinical Significance Quantitation of the formed elements of the blood (erythrocytes -RBCs, leukocytes - WBCs, and platelets) is important in the ARIC study primarily
More informationlongitudinal sinus. A decrease in blood flow was observed when the pressure
362 J. Physiol. (I942) IOI, 362-368 6I2.I44:6I2.824 THE EFFECT OF VARIATIONS IN THE SU.BARACHNOID PRESSURE ON THE VENOUS PRESSURE IN THE SUPERIOR LONGITUDINAL SINUS AND IN THE TORCULAR OF THE DOG BY T.
More informationBlood and Heart. Student Learning Objectives:
Blood and Heart Student Learning Objectives: Identify the major components of the blood. Identify the primary structures associated with the heart Follow the blood through the path of the circulation.
More informationSample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone
Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China Xi Yuan Hospital of China Academy of Traditional Chinese Medicine Testing Report Sample processing
More informationH5N1 real- time Reverse Transcription Polymerase Chain Reaction (RT-PCR) assay
Case Study 1: H5N1 real- time Reverse Transcription Polymerase Chain Reaction (RT-PCR) assay Detection kit that can accurately and rapidly detect all known strains of the H5N1 Avian Influenza A virus in
More informationPortacath Insertion. Patient Information Leaflet
Portacath Insertion Patient Information Leaflet What is a Portacath? A Portacath (also referred to as Port, Chemoport or Power Port) is an implanted central venous access device (CVAD) recommended for
More informationBLOOD SCIENCES DEPARTMENT OF CLINICAL BIOCHEMISTRY. 2. Sample collection and requesting procedure for toxicology analysis
Authoriser: Peter Beresford Page 1 of 5 For the most up-to-date version of this document please view the online version at: https://www.nbt.nhs.uk/severn-pathology/pathology-services/clinical-biochemistry/toxicology
More informationUnderstanding your HICKMAN CATHETER
Understanding your HICKMAN CATHETER Patient Information What is the purpose of this information sheet? This information sheet has been written by patients, members of the public and health professionals.
More informationCollection of Blood Specimens. To provide instructions on correctly collecting blood specimens via vacutainer.
Page 1 of 9 Purpose: To provide instructions on correctly collecting blood specimens via vacutainer. Equipment: Tourniquet-one time use only Vacutainer holder Sterile multi-specimen needle Gauze swab Appropriate
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationEFFECT OF TIME AND TEMPERATURE ON THE STORAGE STABILITY OF HEPATOBILIARY ENZYME ACTIVITIES IN CATTLE SERUM
Indian J. Anim. Res., 48 (2) : 129133, 214 DOI1.5958/j.976555.48.2.28 AGRICULTURAL RESEARCH COMMUNICATION CENTRE www.arccjournals.com EFFECT OF TIME AND TEMPERATURE ON THE STORAGE STABILITY OF HEPATOBILIARY
More informationAspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:
Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: 5605-01 TABLE OF CONTENTS GENERAL INFORMATION... 2 Product Description... 2 Procedure Overview... 2 Kit Contents, Storage and Shelf
More informationAQUEOUS VEINS IN RABBITS*
Brit. J. Ophthal., 35, 119. AQUEOUS VEINS IN RABBITS* BY D. P. GREAVES AND E. S. PERKINS Institute of Ophthalmology, London Director of Research, Sir Stewart Duke-Elder IN the course of investigations
More informationBlood Collection Tubes
Blood Collection Tubes CTI group A constellation of 3 European manufacturers of high quality products for the healthcare sector The CTI group consists of: CHIRANA T. Injecta in Slovakia, CHIRANA T. Injecta
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationStep 2. Common Blood Tests, and the Coulter Counter Readout
Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationSuccessful IV Starts Revised February 2014
Successful IV Starts Revised February 2014 Why Intravenous Therapy? Used for access to the body s circulation Indications: Administer fluids, blood, medications, and nutrition Obtain laboratory specimens
More informationHematological Effects of Cadmium in Hybrid Isa brown
Available online at www.pelagiaresearchlibrary.com European Journal of Experimental Biology, 2012, 2 (6):2049-2054 Hematological Effects of Cadmium in Hybrid Isa brown * Imer Haziri 1, Bujar Mane 2, Arben
More information2007 U.S. EPINet Needlestick and Sharp-Object Injury Report
2007 U.S. EPINet Needlestick and Sharp-Object Injury Report International Healthcare Worker Safety Center, University of Virginia Total Cases: 951 Average Daily Census: 3400 9 Teaching facilities (average
More information