Title Modified Western blotting for insulin and other diabetes-associated peptide hormones

Size: px
Start display at page:

Download "Title Modified Western blotting for insulin and other diabetes-associated peptide hormones"

Transcription

1 Supplemental Figures Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao Sekiya, Takashi Sasaki

2 Retrieval Order - Retrieval Quenching Quenching Retrieval Insulin Insulin Insulin Anti-insulin WB CBB (membrane) Supplemental Figure 1. Glycine quenching is effective when performed following the retrieval step. Dilution series (30, 100, 300 ng) of insulin were subjected to Tris/Tricine/urea SDS-PAGE. After electro-blotting/ga fixation, the one blotted membrane was separated into 3 slips for the control experiment (not subjected to retrieval and quenching steps) and the described experiments. To compare the effects of various conditions, WB images in each sub-part of the figure were captured at one time.

3 General procedure Proinsulin /Insulin Improved procedure Proinsulin /Insulin Anti-insulin Supplemental Figure 2. The improved methods are also effective when using another antibody against insulin (clone L6B10). Dilution series of equal moles of proinsulin and insulin (range, 51.1 to 0.5 pmol) were subjected to the general or the improved WB procedure with anti-insulin clone L6B10. The blotted slips for the general or improved protocol were separated from one blotted membrane.

4 Proinsulin /Insulin [fmol] Serum Anti-insulin Supplemental Figure 3. Application of the improved method for mouse serum sample. (a) Proinsulin/insulin standards were used at a range of fmol (Proinsulin, pg; Insulin, pg). As a serum sample, 1 µl of pooled serum (n=9) from normal diet-fed or high fat diet-fed C57BL/6 mice (both sexes, 22 weeks old) was prepared. Blood sampling was performed under no regulation of food intake. The samples were subjected to the improved WB.

5 a Insulin standards Spike [ng] Cell lysate Recovery rates 200 ng 105.0±5.6% 50 ng 124.4±4.4% b Insulin standards Spike [ng] Medium Recovery rates 25 ng 125.8±2.6% 6.25 ng 125.9±13.8% Supplemental Figure 4. Spike and recovery experiment in the improved method. Spike and recovery experiments were performed using MIN6c4 cell lysate (a) or culture medium (b). (a) Insulin standards were used at a range of ng (each 1/2 dilution, 6 points). As a cell lysate sample, 5 μg of extracted protein of MIN6c4 cells maintained with DMEM containing 12.5 mm glucose was prepared. Insulin spiking doses to cell lysates were 200 or 50 ng. (b) Insulin standards were used at a range of ng (each 1/2 dilution, 6 points). As a medium sample, a culture supernatant from MIN6c4 cells incubated with KRBH buffer containing 30 mm glucose for 2 h as shown in Methods was prepared. Insulin spiking doses to medium were 25 or 6.25 ng. The shown recovery rates (±standard error) were represented by averages from 4 independent data. The representative images were shown.

6 Supplemental Figure 5. WB of somatostatins in pancreas and islet sample. Somatostatins in mice pancreas and islet lysate (5 μg) were analyzed by WB with or without the additional steps. WB images in each sub-part of the figure were captured at one time. U.I.S. means unidentified signals. CBB staining of the blotted membrane were performed to ensure appropriate loading. The loaded standards of somatostatins were as follows: somatostatin-28/somatostatin-14, 611 to 6.11 fmol (each 1/10 dilution, 3 points).

7 Supplemental Information: Full Blot Images of WB in the Manuscript Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao Sekiya, Takashi Sasaki Description In the supplemental information, the original images (monochrome inversion) are shown without auto-contrast adjustment of Adobe photoshop software. Seven-digit numbers described after figure numbers, the data acquisition date (YYYYMMDD): Squares with bold solid lines, the location of images used in the main figures: Dot lines, the location of borderline between the different membranes captured at one time: Digital 6 dots traced in the WB images, the location of the colored molecular weight markers ( 42, 30, 16, 10, 4.6, and 1.7 kda) (CST Cat. No.13070).

8 Fig.1 ( ) SDS conc. in sample buf. [%] Insulin [µg] SDS conc. in running buf. : 0.1% SDS conc. in running buf. : 0.05%

9 Fig.2a ( ) PIns Ins [ng] Anti-Insulin WB Proinsulin Insulin CBB staining after WB (membrane) Proinsulin

10 Fig.2b ( ) PIns Ins [ng] CBB staining immediately after blotting (membrane) CBB (gel)

11 Fig.3a ( ) - Paraformaldehyde [%} Anti-Insulin b chain WB Membrane CBB

12 Fig.3b ( ) - Glutaraldehyde [%} Anti-Insulin b chain WB Membrane CBB

13 Fig.3c ( ) GA - + Retrieval Anti-Insulin b chain WB Proinsulin Insulin Membrane CBB Proinsulin Insulin

14 Fig.4a, b ( ) High dose(100-3 ng) Low dose( ng) NT Blocking x1/100 NT Blocking x1/100 Blocking x1/10 Blocking x1 Blocking x1/10 Blocking x1

15 Fig.4c ( ) Low dose( ng) 5 min 10 min 30 min

16 Fig.5a ( ) ( pmol) General procedure Improved procedure Insulin Proinsulin Insulin

17 Fig.5g ( ) ( pmol) Anti-Insulin WB Proinsulin Insulin CBB(membrane)

18 Fig.5h ( ) Pro( fmol) Ins( fmol) Anti-insulin WB Proinsulin Insulin CBB(membrane)

19 Fig.6a ( ) Anti-Insulin - 0.2% GA 0.4% PFA

20 Fig.6b ( ) Anti-Glucagon - 0.2% GA 0.4% PFA

21 Fig.6c ( ) Anti-GLP-1-0.2% GA 0.4% PFA

22 Fig.6d ( ) Anti-somatostatin - 0.2% GA 0.4% PFA

23 Fig.6e ( ) Anti-Ghrelin - 0.2% GA 0.4% PFA

24 Fig.6f ( ) Anti-Pancreatic polypeptide - 0.2% GA 0.4% PFA

25 Fig.7a ( ) pmol Anti-insulin proinsulin insulin CBB

26 Fig.7b ( ) pmol Anti-glucagon Unidentified bands glucagon CBB

27 Fig.7c ( ) pmol Anti-GLP-1 GLP-1(1-36)amide Unidentified bands GLP-1(7-36)amide CBB

28 Fig.7d ( ) pmol pmol Anti-insulin CBB - 0.2% GA

29 Fig.7e ( ) pmol pmol Anti-glucagon CBB - 0.2% GA

30 Fig.7f ( ) pmol pmol Anti-GLP-1 CBB - 0.2% GA

mm Distance (mm)

mm Distance (mm) b a Magnet Illumination Coverslips MPs Objective 2575 µm 1875 µm 1575 µm 1075 µm 875 µm 545 µm 20µm 2 3 0.5 0.3mm 1 1000 100 10 1 0.1 1000 100 10 1 0.1 Field Induction (Gauss) 1.5 0 5 10 15 20 Distance

More information

Control of Glucose Metabolism

Control of Glucose Metabolism Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream

More information

islets scored 1 week month months

islets scored 1 week month months Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken

More information

PRODUCT INFORMATION & MANUAL

PRODUCT INFORMATION & MANUAL PRODUCT INFORMATION & MANUAL Mitochondrial Extraction Kit NBP2-29448 Research use only. Not for diagnostic or therapeutic procedures www.novusbio.com P: 303.760.1950 P: 888.506.6887 F: 303.730.1966 technical@novusbio.com

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

More information

Mercodia Equine Insulin ELISA

Mercodia Equine Insulin ELISA Mercodia Equine Insulin ELISA Directions for Use 10-1205-01 REAGENTS FOR 96 DETERMINATIONS Manufactured by Mercodia AB Sylveniusgatan 8A SE-754 50 Uppsala Sweden EXPLANATION OF SYMBOLS USED ON LABELS =

More information

Mercodia Mouse Insulin ELISA

Mercodia Mouse Insulin ELISA Mercodia Mouse Insulin ELISA Directions for Use 10-1247-01 REAGENTS FOR 96 DETERMINATIONS 10-1247-10 REAGENTS FOR 10 X 96 DETERMINATIONS For Research Use only Manufactured by Mercodia AB, Sylveniusgatan

More information

Supplemental Materials, Nishimura et al, Page1 of 22 1

Supplemental Materials, Nishimura et al, Page1 of 22 1 Supplemental Materials, Nishimura et al, Page of 5 Quantitative assessment of Pdx promoter activity in vivo using a secreted luciferase reporter system 6 7 8 9 Wataru Nishimura, Koki Eto, Atsushi Miki,

More information

Protein MultiColor Stable, Low Range

Protein MultiColor Stable, Low Range Product Name: DynaMarker Protein MultiColor Stable, Low Range Code No: DM670L Lot No: ******* Size: 200 μl x 3 (DM670 x 3) (120 mini-gel lanes) Storage: 4 C Stability: 12 months at 4 C Storage Buffer:

More information

ENERGY FROM INGESTED NUTREINTS MAY BE USED IMMEDIATELY OR STORED

ENERGY FROM INGESTED NUTREINTS MAY BE USED IMMEDIATELY OR STORED QUIZ/TEST REVIEW NOTES SECTION 1 SHORT TERM METABOLISM [METABOLISM] Learning Objectives: Identify primary energy stores of the body Differentiate the metabolic processes of the fed and fasted states Explain

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

FOCUS SubCell. For the Enrichment of Subcellular Fractions. (Cat. # ) think proteins! think G-Biosciences

FOCUS SubCell. For the Enrichment of Subcellular Fractions. (Cat. # ) think proteins! think G-Biosciences 169PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name FOCUS SubCell For the Enrichment of Subcellular Fractions (Cat. # 786 260) think

More information

Mercodia Bovine Insulin ELISA

Mercodia Bovine Insulin ELISA Mercodia Bovine Insulin ELISA Directions for Use 10-1201-01 REAGENTS FOR 96 DETERMINATIONS Manufactured by Mercodia AB Sylveniusgatan 8A SE-754 50 Uppsala Sweden EXPLANATION OF SYMBOLS USED ON LABELS =

More information

Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes

Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes University of British Columbia Departments of Surgery and Cellular & Physiological Sciences Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes 2016 International Conference

More information

Metabolic Syndrome. Antibodies and antigens

Metabolic Syndrome. Antibodies and antigens Metabolic Syndrome Antibodies and antigens HYTEST METABOLIC SYNDROME Introduction Metabolic syndrome is a cluster of conditions that increases the likelihood of cardiovascular heart diseases and diabetes.

More information

Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion

Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella

More information

The Effects of Exenatide on the Autoimmune Development of Diabetes. A Senior Honors Thesis

The Effects of Exenatide on the Autoimmune Development of Diabetes. A Senior Honors Thesis The Effects of Exenatide on the Autoimmune Development of Diabetes A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for Graduation with Distinction in Microbiology in the Undergraduate

More information

SYNOPSIS OF RESEARCH REPORT (PROTOCOL BC20779)

SYNOPSIS OF RESEARCH REPORT (PROTOCOL BC20779) TITLE OF THE STUDY / REPORT No. / DATE OF REPORT INVESTIGATORS / CENTERS AND COUNTRIES Clinical Study Report Protocol BC20779: Multicenter, double-blind, randomized, placebo-controlled, dose ranging phase

More information

MULTI-SPOT. Mouse/Rat Active GLP-1, Insulin, Glucagon Kit. 1-Plate Kit 5-Plate Kit 20-Plate Kit

MULTI-SPOT. Mouse/Rat Active GLP-1, Insulin, Glucagon Kit. 1-Plate Kit 5-Plate Kit 20-Plate Kit Meso Scale Discovery MULTI-SPOT Assay System Mouse/Rat Active GLP-1, Insulin, Glucagon Kit 1-Plate Kit 5-Plate Kit 20-Plate Kit K15172C-1 K15172C-2 K15172C-3 Meso Scale Discovery Meso Scale Discovery Meso

More information

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson, Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David

More information

For the rapid, sensitive and accurate quantification of Ras in various samples

For the rapid, sensitive and accurate quantification of Ras in various samples ab128504 Ras Assay Kit Instructions for Use For the rapid, sensitive and accurate quantification of Ras in various samples This product is for research use only and is not intended for diagnostic use.

More information

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

More information

Protocol for Western Blo

Protocol for Western Blo Protocol for Western Blo ng SDS-PAGE separa on 1. Make appropriate percentage of separa on gel according to the MW of target proteins. Related recommenda ons and rou ne recipes of separa on/stacking gels

More information

Lipoprotein Lipase Activity Assay Kit (Fluorometric)

Lipoprotein Lipase Activity Assay Kit (Fluorometric) Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Canine Insulin ELISA Kit

Canine Insulin ELISA Kit Canine Insulin ELISA Kit Cat. No.:DEIA2033 Pkg.Size:96T Intended use This product provides a method for the quantitative determination of insulin in canine serum and plasma. General Description Insulin

More information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)

More information

Update on GLP-1 Past Present Future

Update on GLP-1 Past Present Future Update on GLP-1 p Past Present Future Effects of GLP-1: Glucose Metabolism and Nutritional Balance L-Cells: Glp-1 release Betacellfollowing ingestion Stress Increases satiety reduces appetite Betacell-

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

History of Investigation

History of Investigation Acini - Pancreatic juice (1º) (2º) Secretions- neuronal and hormonal mechanisms 1) Secretin - bicarbonate rich 2) Cholecystokinin - enzyme rich Islets of Langerhans (contain 4 cell types) Alpha cells (α)-

More information

Adrenal gland And Pancreas

Adrenal gland And Pancreas Adrenal gland And Pancreas Structure Cortex Glucocorticoids Effects Control of secretion Mineralocorticoids Effects Control of secretion Sex steroids Medulla Catecholamines Adrenal cortex 80% of an adrenal

More information

Mercodia Glucagon ELISA

Mercodia Glucagon ELISA Mercodia Glucagon ELISA Directions for Use 10-1271-01 REAGENTS FOR 96 DETERMINATIONS For Research Use Only Manufactured by Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Sweden EXPLANATION OF SYMBOLS

More information

Endocrine System. Regulating Blood Sugar. Thursday, December 14, 17

Endocrine System. Regulating Blood Sugar. Thursday, December 14, 17 Endocrine System Regulating Blood Sugar Stress results in nervous and hormonal responses. The adrenal glands are located above each kidney. Involved in stress response. Stress Upsets Homeostasis Stress

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal

More information

18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin

18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin 18. PANCREATIC FUNCTION AND METABOLISM ISLETS OF LANGERHANS Some pancreatic functions have already been discussed in the digestion section. In this one, the emphasis will be placed on the endocrine function

More information

igem2013 Microbiology BMB SDU

igem2013 Microbiology BMB SDU igem2013 Microbiology BMB SDU Project type: Creation of Biobrick with Prenyltransferase Project title: Biobrick_Prenyltransferase Sub project: Creation date: 13.08.09 Written by: SIS Performed by: PRA,

More information

Mammalian Tissue Protein Extraction Reagent

Mammalian Tissue Protein Extraction Reagent Mammalian Tissue Protein Extraction Reagent Catalog number: AR0101 Boster s Mammalian Tissue Protein Extraction Reagent is a ready-to-use Western blot related reagent solution used for efficient extraction

More information

Please use only the valid version of the package insert provided with the kit.

Please use only the valid version of the package insert provided with the kit. Please use only the valid version of the package insert provided with the kit. 1 INTENDED USE Insulin ELISA provides a method for the quantitative determination of human insulinin serum or plasma. 2 SUMMARY

More information

Physiology 12. Overview. The Gastrointestinal Tract. Germann Ch 19

Physiology 12. Overview. The Gastrointestinal Tract. Germann Ch 19 Physiology 12 The Gastrointestinal Tract Germann Ch 19 Overview 1 Basic functions of the GI tract Digestion Secretion Absorption Motility Basic functions of the GI tract Digestion: : Dissolving and breaking

More information

supplementary information

supplementary information DOI: 1.138/ncb1 Control Atg7 / NAC 1 1 1 1 (mm) Control Atg7 / NAC 1 1 1 1 (mm) Lamin B Gstm1 Figure S1 Neither the translocation of into the nucleus nor the induction of antioxidant proteins in autophagydeficient

More information

RayBio DPP4 Inhibitor Screening Kit

RayBio DPP4 Inhibitor Screening Kit RayBio DPP4 Inhibitor Screening Kit User Manual Version 1.0 Mar 25, 2013 RayBio DPP4 Inhibitor Screening (Cat#: 68SR-DPP4-S100) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon

Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Mercodia Ultrasensitive Rat Insulin ELISA

Mercodia Ultrasensitive Rat Insulin ELISA Mercodia Ultrasensitive Rat Insulin ELISA Directions for Use 10-1251-01 REAGENTS FOR 96 DETERMINATIONS 10-1251-10 REAGENTS FOR 10 X 96 DETERMINATIONS For Research Use only Not for Use in Diagostic Procedure

More information

Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR

Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded

More information

Insulin and the brain. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Insulin and the brain. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Insulin and the brain Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD 1921 Banting & Macleod Nobel Prize 1923 White, M. F. (2003) Science Berg, J. M., Tymoczko, J. L. and Stryer, L. (2007) Biochemistry

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Effect of macronutrients and mixed meals on incretin hormone secretion and islet cell function

Effect of macronutrients and mixed meals on incretin hormone secretion and islet cell function Effect of macronutrients and mixed meals on incretin hormone secretion and islet cell function Background. Following meal ingestion, several hormones are released from the gastrointestinal tract. Some

More information

MULTI-ARRAY. 1-Plate Kit 5-Plate Kit 25-Plate Kit

MULTI-ARRAY. 1-Plate Kit 5-Plate Kit 25-Plate Kit MESO SCALE DISCOVERY MULTI-ARRAY Assay System Active GLP-1 (ver. 2) Assay Kit 1-Plate Kit 5-Plate Kit 25-Plate Kit K150JWC-1 K150JWC-2 K150JWC-4 MESO SCALE DISCOVERY MESO SCALE DISCOVERY MESO SCALE DISCOVERY

More information

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells a CD11c Na + K + ATPase Na + K + ATPase CD11c x-y CD11c Na + K + ATPase Na + K + ATPase CD11c x-z c b x-y view BoNT NAPs CD11c BoNT CD11c NAPs BoNT NAPs CD11c 90 x-z view Apical Basolateral Supplementary

More information

*EP A2* EP A2 (19) (11) EP A2 (12) EUROPEAN PATENT APPLICATION. (43) Date of publication: Bulletin 2002/29

*EP A2* EP A2 (19) (11) EP A2 (12) EUROPEAN PATENT APPLICATION. (43) Date of publication: Bulletin 2002/29 (19) Europäisches Patentamt European Patent Office Office européen des brevets *EP001223221A2* (11) EP 1 223 221 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: 17.07.02 Bulletin 02/29 (1)

More information

Week 3 The Pancreas: Pancreatic ph buffering:

Week 3 The Pancreas: Pancreatic ph buffering: Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions

More information

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Author's response to reviews Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Authors: Yan Zhang (zhangy2@sysucc.org.cn) Chun-Fang

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

For the quantitative determination of Glucagon concentrations in cell culture supernates, serum and plasma.

For the quantitative determination of Glucagon concentrations in cell culture supernates, serum and plasma. Glucagon ELISA Kit Cat.No: DEIA2827 Lot. No. (See product label) Size 96T Intended Use For the quantitative determination of Glucagon concentrations in cell culture supernates, serum and plasma. General

More information

Nutritional Requirement for Protein Production from Trehalose Synthesis in the Male Accessory Gland of Tribolium castaneum

Nutritional Requirement for Protein Production from Trehalose Synthesis in the Male Accessory Gland of Tribolium castaneum Kaleidoscope Volume 11 Article 29 July 2014 Nutritional Requirement for Protein Production from Trehalose Synthesis in the Male Accessory Gland of Tribolium castaneum Ashlee Anciro Follow this and additional

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p

More information

Hormonal regulation of. Physiology Department Medical School, University of Sumatera Utara

Hormonal regulation of. Physiology Department Medical School, University of Sumatera Utara Hormonal regulation of nutrient metabolism Physiology Department Medical School, University of Sumatera Utara Homeostasis & Controls Successful compensation Homeostasis reestablished Failure to compensate

More information

Supplementary Figure S1 Supplementary Figure S2

Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented

More information

BIOLOGICALLY IMPORTANT MOLECULES

BIOLOGICALLY IMPORTANT MOLECULES BIOLOGICALLY IMPORTANT MOLECULES ( use with printout from zerobio website) Note: images from internet and used for educational purposes only CARBOHYDRATES: MONOSACCHARIDES H GLUCOSE FRUCTOSE GALACTOSE

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass

More information

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic

More information

Nature Medicine: doi: /nm.3922

Nature Medicine: doi: /nm.3922 Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun

More information

Overview. Physiology 1. The Gastrointestinal Tract. Guyton section XI

Overview. Physiology 1. The Gastrointestinal Tract. Guyton section XI Overview Physiology 1 The Gastrointestinal Tract Guyton section XI Basic functions of the GI tract Digestion Secretion Absorption Motility Basic functions of the GI tract Digestion: : Dissolving and breaking

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first? 7/31/29 My Anna will love it! Who needs a test drive? Or a Warranty? It looked great in the lot! Do mean to say that you never actually test drove the car? G.Y. Prince Used Cars 1 am Los Angelos, CA Mullholland

More information

GLP-1 agonists. Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK

GLP-1 agonists. Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK GLP-1 agonists Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK What do GLP-1 agonists do? Physiology of postprandial glucose regulation Meal ❶ ❷ Insulin Rising plasma

More information

Determination of serum insulin level by ELISA

Determination of serum insulin level by ELISA Practical course: Basic biochemical methods and ischemic heart models Determination of serum insulin level by ELISA A practical manual Tamas Csont, MD, PhD Supported by: HURO/0901/069/2.3.1 1 BACKGROUND

More information

Genotype analysis by Southern blots of nine independent recombinated ES cell clones by

Genotype analysis by Southern blots of nine independent recombinated ES cell clones by Supplemental Figure 1 Selected ES cell clones show a correctly recombined conditional Ngn3 allele Genotype analysis by Southern blots of nine independent recombinated ES cell clones by hybridization with

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +

More information

The pancreas and the adrenal glands are both examples of... glands. Adrenaline is a... that is secreted by the adrenal

The pancreas and the adrenal glands are both examples of... glands. Adrenaline is a... that is secreted by the adrenal 1 Within the mammalian body, different systems of communication are used to coordinate and control activities. (a) Complete the following passage by using the most suitable term in each case. The pancreas

More information

Improve Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant

Improve Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant Improve Protein Analysis with the New, Mass Spectrometry- Compatible Surfactant ABSTRACT Incomplete solubilization and digestion and poor peptide recovery are frequent limitations in protein sample preparation

More information

The Immunoassay Guide to Successful Mass Spectrometry. Orr Sharpe Robinson Lab SUMS User Meeting October 29, 2013

The Immunoassay Guide to Successful Mass Spectrometry. Orr Sharpe Robinson Lab SUMS User Meeting October 29, 2013 The Immunoassay Guide to Successful Mass Spectrometry Orr Sharpe Robinson Lab SUMS User Meeting October 29, 2013 What is it? Hey! Look at that! Something is reacting in here! I just wish I knew what it

More information

PERIOSTIN ELISA CONTENTS

PERIOSTIN ELISA CONTENTS PERIOSTIN ELISA for the quantitative determination of Periostin in human serum, EDTA plasma, heparin plasma, and citrate plasma Cat. No. BI-20433. 12 x 8 tests CONTENTS ASSAY CHARACTERISTICS Summary...

More information

DAFNE EDUCATOR PROGRAMME PEER SUPPORT: LEARNING OUTCOMES

DAFNE EDUCATOR PROGRAMME PEER SUPPORT: LEARNING OUTCOMES Session : 15.0 Session Title: Nutrition 4 Eating out Learning Outcome Achieved t Fully Achieved Be able to identify the advantages that DAFNE affords them with respect to eating out. (E) Identify carbohydrate

More information

Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus

Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino

More information

Supplementary Figure 1 (Mu)

Supplementary Figure 1 (Mu) Supplementary Figure 1 (Mu) SBP (mmhg) 2 18 16 p

More information

Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection

Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection Victoria L. Smith, Yong Cheng, Barry R. Bryant and Jeffrey S. Schorey Supplementary Figure 1: Unprocessed

More information

Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes. Post Transplantation in a Prevascularized Subcutaneous Site

Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes. Post Transplantation in a Prevascularized Subcutaneous Site Stem Cell Reports, Volume 8 Supplemental Information Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes Post Transplantation in a Prevascularized Subcutaneous Site Andrew R. Pepper, Rena

More information

Behavioral generalization

Behavioral generalization Supplementary Figure 1 Behavioral generalization. a. Behavioral generalization curves in four Individual sessions. Shown is the conditioned response (CR, mean ± SEM), as a function of absolute (main) or

More information

Supplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.

Supplementary Fig. 1 No relative growth advantage of Foxp3 negative cells. Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal

More information