Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Save this PDF as:

Size: px
Start display at page:

Download "Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes"


1 Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay, M.C Skarulis, C Ju, M Aouadi, M.P Czech and G Kunos. Fig. S1 Effects of JD5037 and its inactive diastereomer JD5037i on blood glucose, insulin and c- peptide levels in ZDF rats. Vehicle-treated lean (open columns), ZDF (gray columns), JD5037-treated ZDF (black columns) and JD5037i-treated ZDF rats (hatched columns) were sacrificed after 1 week of treatment. Blood glucose, plasma insulin and c-peptide concentrations were determined as described in Methods. Columns and bars represent means±sem from 10 animals/group; *P< Note that only JD5037, and not its inactive diastereomer JD5037i, was effective in improving glycemic control in ZDF rats.

2 Fig. S2 Effects of JD5037 treatment of ZDF rats on pro- and anti-apoptotic gene expression (a) β- cell mass (b), gene expression of beta cell proliferation markers (c), and beta cell proliferation (d). Vehicle-treated lean (open columns), ZDF (gray columns) and JD5037-treated ZDF rats (black columns) were sacrificed after 4 weeks of treatment. Pancreatic islets were isolated and analyzed for gene expression. Beta cell proliferation was assessed by quantifying cells double positive for insulin and Ki67 staining. Columns and bars represent means ± s.e.m. from 10 animals/group; *P<0.05, ** P<0.01, ***P< Scale bars, 80 μm.

3 Fig. S3 Expression of various inflammasomes in islets of lean, ZDF and JD5037-treated ZDF rats. (a) Islets from vehicle-treated lean (open columns) and ZDF rats (gray columns) or JD5037- treated ZDF rats (black columns) were isolated and analyzed for mrnas encoding various inflammasomes; (b) Effects of anandamide (1 μm) and LPS (10 ng/ml) on ASC protein levels and active, cleaved forms of caspase-1 (p10, p45) in islets isolated from lean rats; (c) Adiponectin receptor-1 and 2 gene expression in islets from lean, vehicle-treated ZDF and JD5037-treated ZDF rats. Columns and bars represent means ± s.e.m. from 10 animals/group; *P<0.05, ** P<0.01, ***P<0.001 relative to lean group.

4 Fig. S4 Analyses of co-localization of CB 1 R and Nlrp3 with CD68+ macrophages and insulin+ beta cells in islets of ZDF rats. Double immunohistochemistry was performed for insulin with CB 1 R, and for CD68 with CB 1 R or with Nlrp3. Representative sections from 8 separate experiments are shown. Co-localization is indicated by the yellow color in the merged pictures, with doublepositive cells marked by arrows. Note that co-localization is evident for CD68 with both CB 1 R and Nlrp3, but not for insulin with CB 1 R. Scale bar, 90 μm.

5 Fig. S5 Effects of treatment of ZDF rats with GeRPs containing CB 1 R sirna on CB 1 R expression in macrophages, monocytes and lymphocytes. (a) Thioglycollate-induced PECs were treated 48h with 40, 80 or 120 nm of either scrambled (gray columns) or CB 1 R SiRNA (black columns). CB 1 R expression was assessed by RT-qPCR. Columns and bars represent means±sem from 4 independent experiments; *P<0.05, ***P<0.001 relative to vehicletreated controls. (b) Isolated leukocytes from GeRP-treated ZDF rats were analyzed by FACS after staining for CD68 and CD3. No GeRPs positive cells were detected and the numbers of cells were comparable between scrambled and CB 1 R SiRNA groups. (c) PECs from GeRP-treated ZDF rats were analyzed by FACS after staining for CD68 and CD3 proteins; only CD68 + macrophages were also FITC + (GeRPs). The numbers of CD3 + and CD68 + cells were comparable between the 2 treatments. Blood and PECs from scrambled GeRP (gray) and CB 1 R-GeRP-treated ZDF rats (black columns) were collected. after 9-10 days of treatment. (d-e) Selective knockdown of Cnr1 but not Cnr2 expression in CD68 + (d) but not in CD3 + cells (e). **P<0.01 relative to scrb-gerp-treated group.

6 Fig. S6 Levels of anandamide and 2-AG in islets from lean, vehicle-treated ZDF and JD5037- treated ZDF rats, and the effects of high glucose and palmitic acid. (a) Higher anandamide in ZDF (gray) compared to lean rats (white) is reversed by chronic JD5037 treatment (black) and is associated with increased expression of the biosynthetic enzyme NAPE-PLD and decreased activity of the anandamide degrading enzyme FAAH. Unchanged 2- AG levels are associated with no change in MAGL activity of Daglb expression and decreased- Dagla expression; columns and bars are means ± s.e.m. from 6-9 preparations, *P<0.05; **P<0.01, ***P<0.001 relative to values in lean rats. (b) NAPE-PLD in the ZDF islet does not co-localize with insulin-containing beta cells (double immunostaining); (c) islet anandamide content is increased by high glucose (33 mm) and less so by palmitate (250 μm).

7 Fig. S7. Effects of anandamide and IL-1β on inflammasome expression and activity in RAW264.7 macrophages, MIN6 beta cells and human isolated islets. (a) Effects of anandamide (AEA) on Nlrp3 inflammasome and its downstream targets in RAW264.7 macrophages and in MIN6 insulinoma cells. Cells were incubated for 4 h with vehicle or the indicated concentrations of AEA, followed by analyses of cellular mrna levels and cytokines secreted into the medium; (b) Comparative effects of IL-1β and AEA on the expression of pro- and anti-apoptotic genes in MIN6 β-cells. MIN6 cells were incubated with maximally effective concentrations of AEA (0.5 μm) or IL-1β (30 ng/ml); (c) Effects of IL-1β and AEA on apoptotic markers in non-diabetic human isolated islets. (d) IL-1β down-regulates Cnr1 mrna and protein in MIN6 cells via the IL-1R, as indicated by blockade of this effect by IL-1R antagonist (10 ng/ml); Points/columns and vertical bars represent means ± s.e.m. from 6-8 independent experiments, statistics as in Figure 1.

8 Fig. S8 Effect of anandamide on inflammasome gene expression and activation in PECs from CB 1 R / (a) or Nlrp3 / mice (b) and their wild-type littermates. (c): Effect of acute in vivo treatment of mice with anandamide (10 mg/kg ip) on insulin-induced hypoglycemia in wild-type and Nlrp3 / - mice. Note that Nlrp3 / mice have increased baseline insulin sensitivity which remains unaffected by anandamide. Insulin sensitivity test in 4-6 mice/group was done as described in Methods.

9 Table. S1 Lean ZDF+Veh ZDF+JD5037 ZDF+Clodronate Leptin ng/ml 3.46 ± ± 0.48 *** 9.48 ± 0.31 ***### ± 0.98 *** Adiponectin µg/ml 4.60 ± ± 0.18 *** 5.70 ± 0.07 **### 2.35 ± 0.23 *** TG mg/dl 63.2 ± ± *** ± ***### 1136 ± 114 *** Cholesterol mg/dl 88 ± ± 3.85 *** ± 3.85 ### 159 ± 17 *** Uric acid µg/ml 2.27 ± ± 0.36 *** 2.57 ± 0.04 ### 5.01 ± 0.44 *** IL-1β ng/ml 4.06 ± ± 0.88 *** 7.63 ± 0.78 **### 8.42 ± 0.45 **### TNF-α pg/ml 1.71 ± ± 0.74 *** 0.83 ± 0.07 **### Effects of peripheral CB 1 R antagonism on plasma levels of hormonal/metabolic variables. ZDF rats were treated daily for 28 d with vehicle or 3 mg/kg/day of JD5037. Figures in table represent means ± s.e.m. from 20 animals/group, * P< 0.05, ** P<0.01, *** P<0.001 relative to values in lean littermate rats; # P<0.05, ## P<0.01, ### P<0.001 relative to values in ZDF + Veh group.

10 Table. S2: List of antibodies used Protein reference specificity Supplier dilution Primary Antibodies Insulin A0564 Guinea Pig anti-human Dako 1/100 CB 1 R PA1-743 Rabbit anti-human/rat Thermo scientific 1/200 NLRP3 LS-B1766 Goat anti-human Lifespan Biosciences 1/200 CD68 ab31630 Mouse anti-rat/mouse Abcam 1/100 NAPE-PLD LS-B6951 Rabbit anti-human/rat Lifespan Biosciences 1/125 Ki67 AB9260 Rabbit anti-human/rat/mouse Millipore 1/100 Secondary Antibodies ab6904 Goat anti-guinea Pig (FITC) Abcam 1/200 ab7007 Donkey anti-rabbit (PE) Abcam 1/200 ab8517 Rabbit anti-mouse (FITC) Abcam 1/100 ab7004 Donkey anti-goat (PE) Abcam 1/100 Table. S3: List of primers used for rat, mouse and human tissues Rat primers Mouse Primers Human Primers Gene Reference Gene Reference Gene Reference Gene Reference 18S QT IL-18 QT L19 QT S QT AdipoR1 QT IL-1R QT TBP QT ASC QT AdipoR2 QT IL-1Ra QT S QT CB1 QT AIM-2 QT IL-1β QT Nlrp3 QT CB2 QT Arginase 1 QT insulin QT Caspase 1 QT FAAH QT ASC QT L19 QT IL-1β QT IL-18 QT BAK QT L38 QT TNF-α QT IL-1β QT S BAX QT Mafa QT MCP-1 QT L19 QT Bcl-2 QT MCP-1 QT CB1 QT MAGL QT Bcl-xl QT Neurogenin3 QT CB2 QT NAPE-PLD QT CB1 QT Nlrp12 QT insulin QT Nlrp3 QT CB2 QT Nlrp3 QT BAK QT RPLP0 QT CD68 QT Nlrp6 QT BAX QT TBP QT FAS QT NOS QT Bcl-2 QT Fas QT PDX-1 QT Bcl-xl QT FasL QT SCD-1 QT Fat-CD36 QT TBP QT glucokinase QT TGF-β QT Glut 2 QT TNF-R1 QT ifi16 QT TNF-α QT IFN-g QT Txnip QT

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Metabolic Disease drug discovery at Evotec

Metabolic Disease drug discovery at Evotec Metabolic Disease drug discovery at Evotec Evotec, Metabolic Disease Drug Discovery, 2016 Evotec, an ideal partner in metabolic disease drug discovery The different ways to work with us On your specific

More information

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance

Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,

More information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen, Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,

More information

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona.

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene therapy: State of the art Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene Therapy: First Steps Type 1 diabetes: An islet disease Alpha cell Beta cell Pancreatic

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information


CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit]

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit] MANUAL IL-1alpha (mouse) ELISA Kit [Interleukin-1 alpha (mouse) ELISA Kit] For research use only. Not for diagnostic use Version 1 (March-5-2013) Cat. No. AG-45B-0003-KI01 www.adipogen.com Table of Contents

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS:

Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS: Cancer Cell, Volume 18 Supplemental Information The Therapeutic Effect of Anti-HER2/neu Antibody Depends on Both Innate and Adaptive Immunity SaeGwang Park, Zhujun Jiang, Eric D. Mortenson, Liufu Deng,

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm. SKG-c SKG-A mm 1.4 1.2 1.. Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Introduction to pathology lecture 5/ Cell injury apoptosis. Dr H Awad 2017/18

Introduction to pathology lecture 5/ Cell injury apoptosis. Dr H Awad 2017/18 Introduction to pathology lecture 5/ Cell injury apoptosis Dr H Awad 2017/18 Apoptosis = programmed cell death = cell suicide= individual cell death Apoptosis cell death induced by a tightly regulated

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,

More information

Animal Models of Diabetes and Insulin Resistance. Masakazu Shiota, D.V.M., Ph.D An Organ System.. Course. July 18, 2012

Animal Models of Diabetes and Insulin Resistance. Masakazu Shiota, D.V.M., Ph.D An Organ System.. Course. July 18, 2012 Animal Models of Diabetes and Insulin Resistance Masakazu Shiota, D.V.M., Ph.D An Organ System.. Course. July 18, 2012 What is different between human and animals? mouse rat dog human What is different

More information


ALKA VITA DIABETES TEST ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O

More information

Elastase Mediated Pulmonary Vascular Disease. Elastase

Elastase Mediated Pulmonary Vascular Disease. Elastase PPH Newborn Autoimmune Heart defect Lung abnormality Pathology of Pulmonary Arterial Hypertension () Endothelial and Smooth Muscle Dysfunction Liver disease portal hyper. Pulmonary Hypertension Infectious:

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

PT2385: HIF 2α Antagonist for the Treatment of. Peloton Therapeutics, Inc. 5/4/ th International VHL Medical Symposium April 8, 2016

PT2385: HIF 2α Antagonist for the Treatment of. Peloton Therapeutics, Inc. 5/4/ th International VHL Medical Symposium April 8, 2016 5/4/216 : Antagonist for the Treatment of VHL Mutant ccrcc 12th International VHL Medical Symposium Eli Wallace, Ph.D. Vice President of Chemistry Disclosure Information Eli Wallace I have the following

More information

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts

Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts Serena Del Turco, Teresa Navarra, Giuseppina Basta, Raffaele De

More information

How Reactive Metabolites Induce an Immune Response that Sometimes Leads to an Idiosyncratic Drug Reaction

How Reactive Metabolites Induce an Immune Response that Sometimes Leads to an Idiosyncratic Drug Reaction How Reactive Metabolites Induce an Immune Response that Sometimes Leads to an Idiosyncratic Drug Reaction Jack Uetrecht, M.D., Ph.D. jack.uetrecht@utoronto.ca It is very difficult to study the mechanisms

More information

Dioscin Exerts Protective Effects Against Crystalline Silica-induced Pulmonary Fibrosis in Mice

Dioscin Exerts Protective Effects Against Crystalline Silica-induced Pulmonary Fibrosis in Mice Ivyspring International Publisher 4255 Theranostics Research Paper 2017; 7(17): 4255-4275. doi: 10.7150/thno.20270 Dioscin Exerts Protective Effects Against Crystalline Silica-induced Pulmonary Fibrosis

More information



More information

Evaluation of fish oil-rich in MUFAs for anti-diabetic and antiinflammation potential in experimental type 2 diabetic rats

Evaluation of fish oil-rich in MUFAs for anti-diabetic and antiinflammation potential in experimental type 2 diabetic rats Original Article Evaluation of fish oil-rich in MUFAs for anti-diabetic and antiinflammation potential in experimental type 2 diabetic rats Waranya Keapai 1, Sopida Apichai 2, Doungporn Amornlerdpison

More information

Determination of serum insulin level by ELISA

Determination of serum insulin level by ELISA Practical course: Basic biochemical methods and ischemic heart models Determination of serum insulin level by ELISA A practical manual Tamas Csont, MD, PhD Supported by: HURO/0901/069/2.3.1 1 BACKGROUND

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

ParActin For Cold & Flu

ParActin For Cold & Flu ParActin For Cold & Flu Colds and flu can reach epidemic proportions during the winter months. There are more than 95 million flu cases in the U.S. annually, according to the Centers for Disease Control,

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

FAPESP Week /21/2017

FAPESP Week /21/2017 Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr

More information


ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Table S1. qpcr primer list.


More information

BPA exposure during pregnancy: risk for gestational diabetes and diabetes following pregnancy

BPA exposure during pregnancy: risk for gestational diabetes and diabetes following pregnancy BPA exposure during pregnancy: risk for gestational diabetes and diabetes following pregnancy Paloma Alonso-Magdalena Applied Biology Department and CIBERDEM, Miguel Hernández University, Elche, Spain

More information


SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

Dr. Hany M. Abo-Haded

Dr. Hany M. Abo-Haded BY Dr. Hany M. Abo-Haded Pediatric Cardiology Unit, Mansoura Universty Children Hospital, Mansoura, Egypt Co-authors: Dina S El-Agamy and Mohamed A Elkablawy Background Doxorubicin (DOX) is an anthracycline

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens

More information

Karen A. Hasty, PhD Wilhelm Professor of Orthopaedic Surgery

Karen A. Hasty, PhD Wilhelm Professor of Orthopaedic Surgery Karen A. Hasty, PhD Wilhelm Professor of Orthopaedic Surgery Osteoarthritis Research Areas Regulation of matrix metalloproteinases in cartilage degradation Theranostic nanosomes Tissue engineering of cartilage

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information


Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale i: Primers used for RT-PCR. References are provided under Source, except for primers

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures.

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures. TNF-alpha ELISA For the quantitative determination of TNF-alpha in serum, plasma, buffered solution or cell culture medium. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number:

More information

Contents Materials and Methods Figs. S1 and S8 References and Notes

Contents Materials and Methods Figs. S1 and S8 References and Notes Özcan et al., p. 1 Science Supporting Online Material Endoplasmic Reticulum Stress Links Obesity, Insulin ction, and Type 2 Diabetes Umut Özcan, Qiong Cao, Erkan Yilmaz, nn-hwee Lee, Neal N. Iwakoshi,

More information

Author's response to reviews

Author's response to reviews Author's response to reviews Title:CD14+ macrophages that accumulate in the colon of African AIDS patients express pro-inflammatory cytokines and are responsive to lipopolysaccharide Authors: Edana Cassol

More information

Week 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD

Week 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD Week 3, Lecture 5a Pathophysiology of Diabetes Simin Liu, MD, ScD General Model of Peptide Hormone Action Hormone Plasma Membrane Activated Nucleus Cellular Trafficking Enzymes Inhibited Receptor Effector

More information

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes Diabetes Volume 64, April 2015 1341 Subha Karumuthil-Melethil, 1 M. Hanief Sofi, 2 Radhika Gudi, 3 Benjamin M. Johnson, 2 Nicolas Perez, 1 and Chenthamarakshan Vasu 2,3 TLR2- and Dectin 1 Associated Innate

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Instant ELISA Kits. Accelerate Time to Result

Instant ELISA Kits. Accelerate Time to Result Instant ELISA Kits Accelerate Time to Result High quality by design equals performance. 1 Our ELISA portfolio provides you with a complete offering of kits with a reputation of: High sensitivity Reliable

More information

Supplemental Information. LEAP2 Is an Endogenous Antagonist. of the Ghrelin Receptor

Supplemental Information. LEAP2 Is an Endogenous Antagonist. of the Ghrelin Receptor Cell Metabolism, Volume 27 Supplemental Information LEAP2 Is an Endogenous Antagonist of the Ghrelin Receptor Xuecai Ge, Hong Yang, Maria A. Bednarek, Hadas Galon-Tilleman, Peirong Chen, Michael Chen,

More information

Drug profiling in an immune cell-tumor spheroid co-culture model

Drug profiling in an immune cell-tumor spheroid co-culture model Oncology Drug Discovery Molecular Pharmacology Drug profiling in an immune cell-tumor spheroid co-culture model Silvia Goldoni, Investigator Novartis Institutes for Biomedical Research, Cambridge MA, USA

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information


HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis My personal objective: identification of biomarkers of (optimal) health Biomarker Definition: a characteristic that is objectively measured and evaluated

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

C-Peptide and Exercise in people with Type 1 Diabetes. Guy Taylor

C-Peptide and Exercise in people with Type 1 Diabetes. Guy Taylor C-Peptide and Exercise in people with Type 1 Diabetes Guy Taylor Produced in equal amounts to insulin C-Peptide Used to assess endogenous insulin secretion not injected with exogenous insulin Pathogenesis

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

Hepatic CB 1 receptor is required for development of diet-induced steatosis, dyslipidemia, and insulin and leptin resistance in mice

Hepatic CB 1 receptor is required for development of diet-induced steatosis, dyslipidemia, and insulin and leptin resistance in mice Research article Hepatic CB 1 receptor is required for development of diet-induced steatosis, dyslipidemia, and insulin and leptin resistance in mice Douglas Osei-Hyiaman, 1 Jie Liu, 1 Liang Zhou, 1 Grzegorz

More information

NIH Public Access Author Manuscript Diabetologia. Author manuscript; available in PMC 2014 February 01.

NIH Public Access Author Manuscript Diabetologia. Author manuscript; available in PMC 2014 February 01. NIH Public Access Author Manuscript Published in final edited form as: Diabetologia. 2013 February ; 56(2): 231 233. doi:10.1007/s00125-012-2788-6. Lipotoxicity impairs incretin signalling V. Poitout 1,2

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information


METABOLISMO E VITAMINA D CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster

More information

Excerpt from MACS&more Vol 17 1/2016. Kenji Miki¹, Koji Nagaoka¹, Hermann Bohnenkamp², Takayuki Yoshimoto³, Ryuji Maekawa¹*, and Takashi Kamigaki⁴

Excerpt from MACS&more Vol 17 1/2016. Kenji Miki¹, Koji Nagaoka¹, Hermann Bohnenkamp², Takayuki Yoshimoto³, Ryuji Maekawa¹*, and Takashi Kamigaki⁴ Excerpt from MCS&more Vol 17 1/2016 Dendritic cells pulsed with induce both OV-specific CD4 + and CD8 + T cells and cause antitumor effects in a mouse model of lymphoma Kenji Miki¹, Koji Nagaoka¹, Hermann

More information

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages

Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.

More information

NIH Public Access Author Manuscript Nat Med. Author manuscript; available in PMC 2006 April 5.

NIH Public Access Author Manuscript Nat Med. Author manuscript; available in PMC 2006 April 5. NIH Public Access Author Manuscript Published in final edited form as: Nat Med. 2005 July ; 11(7): 774 779. Regulation of bone mass, bone loss and osteoclast activity by cannabinoid receptors Aymen I Idris,

More information

Recombinant Integrins

Recombinant Integrins Recombinant Integrins Ligand INTEGRIN α subunit S S β subunit Recombinant Integrins Integrins are heterodimeric integral membrane proteins that play key roles in regulating cell-cell and cell-extracellular

More information